ID: 916728559

View in Genome Browser
Species Human (GRCh38)
Location 1:167545629-167545651
Sequence TTGTATTTTCATAAAGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 666
Summary {0: 1, 1: 1, 2: 3, 3: 65, 4: 596}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916728559_916728566 25 Left 916728559 1:167545629-167545651 CCACCCTCTTTATGAAAATACAA 0: 1
1: 1
2: 3
3: 65
4: 596
Right 916728566 1:167545677-167545699 TGCCTGTATTCCCAGCTGCTTGG 0: 33
1: 3697
2: 92676
3: 156909
4: 257741
916728559_916728569 29 Left 916728559 1:167545629-167545651 CCACCCTCTTTATGAAAATACAA 0: 1
1: 1
2: 3
3: 65
4: 596
Right 916728569 1:167545681-167545703 TGTATTCCCAGCTGCTTGGGAGG 0: 40
1: 4201
2: 102216
3: 224903
4: 577495
916728559_916728563 -10 Left 916728559 1:167545629-167545651 CCACCCTCTTTATGAAAATACAA 0: 1
1: 1
2: 3
3: 65
4: 596
Right 916728563 1:167545642-167545664 GAAAATACAAAAAATCAGCTGGG 0: 10
1: 1003
2: 24310
3: 73671
4: 46356
916728559_916728564 -5 Left 916728559 1:167545629-167545651 CCACCCTCTTTATGAAAATACAA 0: 1
1: 1
2: 3
3: 65
4: 596
Right 916728564 1:167545647-167545669 TACAAAAAATCAGCTGGGTGTGG 0: 93
1: 4840
2: 18294
3: 45361
4: 59431
916728559_916728565 -2 Left 916728559 1:167545629-167545651 CCACCCTCTTTATGAAAATACAA 0: 1
1: 1
2: 3
3: 65
4: 596
Right 916728565 1:167545650-167545672 AAAAAATCAGCTGGGTGTGGTGG 0: 249
1: 10867
2: 58100
3: 132101
4: 201835
916728559_916728567 26 Left 916728559 1:167545629-167545651 CCACCCTCTTTATGAAAATACAA 0: 1
1: 1
2: 3
3: 65
4: 596
Right 916728567 1:167545678-167545700 GCCTGTATTCCCAGCTGCTTGGG 0: 28
1: 3008
2: 77966
3: 268300
4: 502095

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916728559 Original CRISPR TTGTATTTTCATAAAGAGGG TGG (reversed) Intronic
900339296 1:2180276-2180298 ATGCATTTTCATAAACAGGTTGG - Intronic
900578578 1:3396260-3396282 TAGGATATTCATAAAGGGGGTGG - Intronic
900836989 1:5012617-5012639 TTGTATTTGCATAAGGAAGGGGG + Intergenic
901101894 1:6725563-6725585 TTGTATTTTTGTAGAGATGGGGG + Intergenic
901151442 1:7105768-7105790 TTGTATTTTTGTAGAGACGGTGG - Intronic
901513134 1:9727975-9727997 TTGTATTTTAGTAGAGACGGGGG + Exonic
901667559 1:10835346-10835368 TTAAATTTTCATAGAGCGGGCGG + Intergenic
901748406 1:11390003-11390025 TTGTGTTTTCTTAAAGAGTAAGG + Intergenic
902193693 1:14782180-14782202 ATATATTTGCCTAAAGAGGGTGG - Intronic
902212769 1:14915595-14915617 TTCATTCTTCATAAAGAGGGGGG - Intronic
902929703 1:19722449-19722471 TTTTATTTTCCTTAAGAGGTGGG + Intronic
903796942 1:25936442-25936464 TTGTATTTTTATAGAGACGGGGG - Intergenic
904482484 1:30802669-30802691 TTGTATTTTAGTAGAGACGGGGG - Intergenic
904514475 1:31043390-31043412 TTGTATTTTTGTAGAGATGGGGG + Intronic
904639096 1:31908950-31908972 TTGTATTTTCAGAAAAAGAAGGG - Exonic
905413918 1:37792005-37792027 TTGTATTTTAGTAGAGATGGTGG + Intergenic
905481848 1:38267428-38267450 TTATTTTTTCATGGAGAGGGAGG - Intergenic
906422650 1:45683731-45683753 TTGTATTTTATTAGAGAGGAGGG - Intronic
906745371 1:48217538-48217560 TTGCATTTTCCTAATGATGGGGG - Intergenic
907039140 1:51242451-51242473 TGGTATTTTAATAGAGATGGGGG - Intronic
908352843 1:63303046-63303068 TTGTATTTTAGTAGAGACGGGGG + Intergenic
908363008 1:63388337-63388359 TTGTATTTTTGTAGAGATGGGGG + Intronic
908776221 1:67643011-67643033 TTCTCGTTTCATAAAAAGGGTGG - Intergenic
908978079 1:69922096-69922118 TTGTATTTTTAGAGAGACGGGGG + Intronic
910582575 1:88844683-88844705 TTGTATTTTTAAAAATAAGGCGG - Intergenic
910637682 1:89427516-89427538 TTTTATTTTCAATAACAGGGTGG + Intergenic
910979643 1:92946769-92946791 TTGTATTTTTTTATAGAGGCAGG - Intronic
911145074 1:94543594-94543616 TACTATTTTCAAGAAGAGGGAGG + Intergenic
911174745 1:94807612-94807634 TTGTATTTTAGTAAAGACTGGGG - Intergenic
911786249 1:101951889-101951911 TTCTATCTTTATAAAGAAGGTGG + Intronic
912151481 1:106863815-106863837 TTGCATTTTCTTTAAGAAGGAGG - Intergenic
912318096 1:108684879-108684901 TTGTTTTTTTGTAAAGATGGGGG - Intergenic
912873355 1:113330001-113330023 TTTTATTGTTATAAAAAGGGTGG - Intergenic
913067637 1:115271176-115271198 TTGTCTTTTCACATAAAGGGGGG - Intergenic
913529378 1:119722707-119722729 TTGTATTTTTGTAGAGATGGGGG - Intronic
913992650 1:143628861-143628883 TTGTGTGTTCATAAAGGGAGGGG + Intergenic
914003995 1:143717070-143717092 TTGTATTTTAGTAGAGAGGGAGG - Intergenic
914709079 1:150196565-150196587 GTGAATATTCATAAAGAGGGGGG - Intergenic
914833550 1:151189000-151189022 TTGTATTTTAATAGAGACAGGGG + Intronic
915253732 1:154609389-154609411 TTGTAATTTCATAAGCATGGGGG - Intronic
916028360 1:160855146-160855168 TTCTGTTTTCTTAAAGAAGGAGG + Intronic
916076527 1:161203132-161203154 TTGTATTTTTTTAAAGACGGGGG - Intronic
916728559 1:167545629-167545651 TTGTATTTTCATAAAGAGGGTGG - Intronic
917772629 1:178296535-178296557 TTTTATTTTTTTAAAGATGGGGG + Intronic
918084199 1:181231404-181231426 TTGTCTTGTCTTACAGAGGGAGG + Intergenic
918210254 1:182344041-182344063 TTGTATTTTTATAGAGATGGGGG - Intergenic
918732485 1:188015387-188015409 TTGTATTTTCTTTAAAAGGTAGG + Intergenic
919417239 1:197326455-197326477 TTGTATTTTAGTAGAGATGGGGG - Intronic
919792873 1:201303630-201303652 TTGTTTTTTCTTAAAAAGAGAGG + Intronic
919807601 1:201389636-201389658 TTGTATTTTTGTAGAGATGGAGG - Intronic
920096283 1:203488344-203488366 TTGTATTTTAGTAGAGACGGGGG - Exonic
920322538 1:205135463-205135485 TTGTATTTTTGTAGAGATGGCGG - Intergenic
920810287 1:209278932-209278954 TTGTATTTTAATAGAGATGGGGG - Intergenic
921210655 1:212893946-212893968 TTGTATTTTAGTAGAGATGGGGG + Intronic
921261891 1:213391908-213391930 TTGTCTTTTCAGTAAAAGGGAGG + Intergenic
922315452 1:224437639-224437661 TTGTATTTTTAAAAATAAGGTGG + Intronic
923559862 1:235030826-235030848 TTGTATTTTTACAAAGAGACAGG - Intergenic
924334094 1:242969467-242969489 CTGTGTTTTCAAAAAAAGGGTGG + Intergenic
924413529 1:243833086-243833108 TTGTATTTTCATTAAGCGACGGG - Intronic
924541576 1:244985689-244985711 TTGTATTTTAGTAGAGACGGGGG - Intronic
924744804 1:246822122-246822144 TTGTATTTTAGTAGAGATGGGGG - Intergenic
1062818598 10:517768-517790 TTATATTATCACAGAGAGGGTGG - Intronic
1063586897 10:7360293-7360315 TTGTATTTTCGTAGAGATGGGGG - Intronic
1064404887 10:15052912-15052934 TTGTATTTTAGTAGAGACGGGGG + Intronic
1064416313 10:15153254-15153276 TTGTATTTTTTTAGAGATGGCGG - Intronic
1064618052 10:17183588-17183610 TTGTATTTTTAGAAAGAGACAGG + Intronic
1065098715 10:22311163-22311185 TTATATCTTTAAAAAGAGGGAGG - Intergenic
1065323514 10:24530723-24530745 TTTAATTTTTGTAAAGAGGGGGG - Intronic
1065386715 10:25141221-25141243 TTTTATTTTCGTAGAGATGGAGG + Intergenic
1065812263 10:29452977-29452999 TTTTCTTTTCAAAAAGAGGAAGG + Intergenic
1065920763 10:30390874-30390896 TTATACTTTAATAAAGATGGAGG + Intergenic
1066101210 10:32120330-32120352 TTGAAGTTTGACAAAGAGGGAGG + Intergenic
1066414087 10:35203380-35203402 TTGTTTTTTTAAAAAAAGGGTGG - Intronic
1066498194 10:35962773-35962795 TTGTATTTTAGTAGAGATGGGGG - Intergenic
1066561294 10:36672524-36672546 TTGTATTTTTTTAAATAGAGAGG + Intergenic
1067929013 10:50540861-50540883 TTTCCATTTCATAAAGAGGGTGG + Intronic
1069509972 10:69034896-69034918 TTGTATTTTTATAGATACGGGGG - Intergenic
1069590509 10:69638813-69638835 TTGTTTTTCCAGAATGAGGGAGG - Intergenic
1069763102 10:70829332-70829354 TTGTATTTTCTTACAGACGGTGG - Intronic
1070099003 10:73367408-73367430 TTGTATTTTAGTAGAGATGGGGG - Intergenic
1070460950 10:76669619-76669641 TTATATTTCCATATAGAGAGAGG + Intergenic
1070679886 10:78441537-78441559 TTGTATTTTAGTAGAGACGGGGG - Intergenic
1072076670 10:91982070-91982092 CTGTTTTTTCCTACAGAGGGAGG - Exonic
1072186840 10:93047771-93047793 TTGTATTTTAGTAGAGACGGGGG - Intronic
1072237192 10:93463570-93463592 TTGTATTTTAGTAGAGATGGGGG + Intronic
1074069534 10:110052244-110052266 TGGTGTTTTCCTAAAGAGGGAGG - Intronic
1074349763 10:112724773-112724795 TTTTTTTTTCAAAAAAAGGGGGG - Intronic
1074915631 10:117952192-117952214 TTGTATTTTAGTAGAGAAGGTGG + Intergenic
1075501489 10:122979286-122979308 TTGTATTTTCAGTAAGAACGGGG - Intronic
1075752082 10:124781117-124781139 TTGTATTTTAGTAGAGATGGGGG + Intronic
1076015090 10:127021336-127021358 TTTTATTTTAATAGAGACGGGGG + Intronic
1076702493 10:132281361-132281383 TTGTTTTTTAATAAACAGAGAGG - Intronic
1077165371 11:1132629-1132651 TTGTATTTTCTTATAGAGATAGG + Intergenic
1077517991 11:3013674-3013696 TTGTATTTTAGTAGAGACGGGGG - Intronic
1078243338 11:9550605-9550627 TTGTATTTTTATAGAGATGGGGG + Intergenic
1079043652 11:17080893-17080915 TTGTATTTTAGTAGAGATGGGGG + Intronic
1080099103 11:28438845-28438867 TTGTATTTTAGTAGAGACGGGGG + Intergenic
1080670937 11:34377123-34377145 TTGTATTTTAGTAGAGACGGGGG + Intergenic
1080672835 11:34396720-34396742 TTGTATTTTAGTAGAGACGGGGG + Intergenic
1081751706 11:45515783-45515805 TTGTATTTTAGTAGAGACGGGGG + Intergenic
1082033579 11:47625543-47625565 TGGTATTTTTTTAAAAAGGGGGG - Intronic
1082045939 11:47727420-47727442 TTGTATTTTTAGTAAGAGAGGGG + Intronic
1082099310 11:48158779-48158801 TTGTATTTTTGTAGAGATGGGGG - Intronic
1082264351 11:50103495-50103517 TTGCATTCTCATCAAGAGGCAGG + Intergenic
1082804908 11:57441772-57441794 TTGTATTTTTATTAAGAGATGGG - Intergenic
1083116736 11:60467447-60467469 TTGTATTTTTGTAGAGACGGGGG + Intronic
1083142600 11:60734080-60734102 TTGTATTTTTGTAGAGATGGCGG - Intronic
1083824642 11:65192777-65192799 TTTTATTTTTATAGAGATGGGGG + Intronic
1084003048 11:66308342-66308364 TTGTATTTTAGTAGAGACGGGGG - Intergenic
1084065203 11:66700125-66700147 TTTTTTTTTCATAGAGATGGGGG + Intronic
1084144498 11:67257105-67257127 TTGTCTTTTTATAAAAGGGGAGG + Exonic
1085067846 11:73514010-73514032 TTGTATTTTTTTATAGAGAGAGG - Intronic
1085669067 11:78444543-78444565 TTGTATTTTAGTAGAGACGGGGG - Intronic
1086360621 11:86055156-86055178 TTGTATTTTAGTAGAGACGGGGG - Intronic
1087408087 11:97754398-97754420 TTGTATTTTGGTAGAGATGGGGG + Intergenic
1087456138 11:98388917-98388939 TTATATTTTCAAAAGGAAGGAGG + Intergenic
1088218505 11:107540917-107540939 ATGTATTTTTACAAATAGGGTGG + Intronic
1088239004 11:107754936-107754958 TTGTATTTTTTTATAGAGGTGGG - Intergenic
1088631792 11:111780567-111780589 TTGTATTTTTGTAGAGATGGGGG + Intergenic
1090577401 11:128121189-128121211 TTCTAGTTTCATAAAGTGGAAGG - Intergenic
1091559872 12:1604000-1604022 TTGTATTTTTGTAGAGATGGGGG - Intronic
1092275960 12:7061124-7061146 TTGTATTTTCAGTAAGTTGGCGG + Intronic
1092368142 12:7894212-7894234 TTGTATTTTAGTAGAGATGGGGG - Intergenic
1092933826 12:13341577-13341599 ATGTAATGTCATTAAGAGGGGGG + Intergenic
1093225487 12:16478632-16478654 TTTTAATTTCAGAAAGTGGGAGG + Intronic
1093258026 12:16896583-16896605 TTCTATTTTCATAATAAGGAAGG - Intergenic
1093441778 12:19206738-19206760 TTATATATTCATGAAAAGGGAGG + Intronic
1093888981 12:24496857-24496879 TTGTATATTCATAAAGAGCAAGG - Intergenic
1093994272 12:25624849-25624871 TTGTATTTGCCTTTAGAGGGAGG - Intronic
1094662104 12:32479960-32479982 TTGTATTTTCTTATAGAGACAGG + Intronic
1095438349 12:42216406-42216428 GGATATTTTCAAAAAGAGGGGGG - Intronic
1095480990 12:42635523-42635545 TTTTATTTTCAAAAGAAGGGGGG - Intergenic
1095495020 12:42775292-42775314 TTTTATTTTCATGAAGGGGGAGG + Intergenic
1095887234 12:47201770-47201792 TTGTATTTTTGTAGAGATGGGGG + Intronic
1096026314 12:48366127-48366149 TTGTTTTTTAAGAATGAGGGAGG + Intergenic
1096314772 12:50554939-50554961 TTGTATTTTAGTAGAGATGGGGG + Intronic
1097164112 12:57073467-57073489 TTGTATTTTAGTAGAGACGGGGG - Intronic
1097631418 12:62068138-62068160 TTGTATTTTCAAAGTGAGGAAGG - Intronic
1097657060 12:62378242-62378264 TGGTATTTTCAAGATGAGGGTGG + Intronic
1097814937 12:64062688-64062710 TTGTATTTTAGTAGAGACGGGGG + Intronic
1098354505 12:69599258-69599280 TTTTATTTTCTTAGAGATGGGGG + Intronic
1098435747 12:70466782-70466804 TTTTATTTTTGTAAAGACGGTGG + Intergenic
1098772909 12:74577120-74577142 TTGTAGTTTAATAGAGACGGGGG - Intergenic
1099202840 12:79694986-79695008 TTGTATTTTAGTAGAGACGGGGG + Intergenic
1100031092 12:90192152-90192174 TTGTCTTTTCATACACAGGGAGG - Intergenic
1100931201 12:99611500-99611522 TTTTAATTTTATAAACAGGGAGG - Intronic
1101087320 12:101249571-101249593 TTGTATTTTAGTAGAGACGGGGG - Intergenic
1101210355 12:102529351-102529373 TTATATTTTGACAAAGAAGGAGG + Intergenic
1101774489 12:107781269-107781291 TTGTATTTTGGTAGAGATGGGGG + Intergenic
1102178275 12:110892402-110892424 TTTTATTTTTATAGAGATGGGGG - Intronic
1102667054 12:114583529-114583551 TTTTATTTTTATAGAGATGGGGG + Intergenic
1103786075 12:123434244-123434266 TTGTATTTTTGTAGAGATGGGGG - Intronic
1106998409 13:35515389-35515411 GTGTATTTTGATAAAAAGGGAGG - Intronic
1107056906 13:36115834-36115856 TAGTATTTTCAGAAAGTTGGAGG + Intronic
1107299639 13:38951570-38951592 TTTTATTTCTATAAAGAGGTGGG - Intergenic
1108222369 13:48248992-48249014 TTATATTTTGATATGGAGGGTGG - Intronic
1108976009 13:56443892-56443914 TTGTATTTTTATAGAGATGGGGG + Intergenic
1110403884 13:75126842-75126864 TTATATTTACATAAATATGGAGG + Intergenic
1110599984 13:77361829-77361851 TTGTTTTTTGATAGAGATGGGGG + Intergenic
1110609982 13:77476673-77476695 TTGTACATTCCTAAAGAGTGTGG - Intergenic
1110666669 13:78125303-78125325 TTGTATTTTTATAGAGACGGGGG + Intergenic
1111664643 13:91251759-91251781 TTGTATTTTAGTAGAGATGGGGG + Intergenic
1111720066 13:91932163-91932185 TTGTATTTTCAGAAAGAGACTGG + Intronic
1112443458 13:99442856-99442878 TCGTATTTTCATTAAGACGTGGG - Intergenic
1112938287 13:104827817-104827839 TTGTATTTTATTAGAGACGGGGG - Intergenic
1113116162 13:106876846-106876868 TTGTATTTTAGTAGAGATGGGGG - Intergenic
1115167505 14:30465337-30465359 CTGTATTTCCATATAGTGGGTGG + Intergenic
1116204863 14:41851680-41851702 TTTAATTTTCATAAACAGGTTGG + Intronic
1116406472 14:44572810-44572832 TTGTGTTTTAGTAGAGAGGGGGG - Intergenic
1116784671 14:49274387-49274409 TGGAAATTTCATAAAGAAGGGGG - Intergenic
1116806148 14:49495605-49495627 TTGTATTTTGGTAGAGATGGGGG - Intergenic
1116808781 14:49519612-49519634 ATGTAGTTTCCTTAAGAGGGAGG + Intergenic
1116923956 14:50613878-50613900 ATGTATTTACATAAAGTGGGAGG + Intronic
1116948657 14:50858938-50858960 TTTTATTTTTTTAAAGATGGGGG - Intronic
1117402075 14:55367569-55367591 TTGTATTTTAGTAAAGACGGGGG - Exonic
1117560623 14:56934206-56934228 TTGTATTTTTTTAGAGATGGGGG + Intergenic
1117703958 14:58443595-58443617 TTGTATTTTAGTAGAGATGGGGG + Intronic
1117839456 14:59844045-59844067 CTGTATTCTCACAAAGAGGCAGG - Intronic
1118275702 14:64384618-64384640 TTGTATTTTTATAGAGACGGAGG + Intergenic
1118928387 14:70215251-70215273 TTGTATTTTAGTAGAGATGGGGG + Intergenic
1119028741 14:71175031-71175053 TTGTATTTTTTTAGAGATGGGGG + Intergenic
1119204238 14:72782394-72782416 TTGTATTTTTTTATAGAGGCAGG + Intronic
1119354162 14:73991413-73991435 TTGTATTTTAGTAGAGACGGGGG - Intronic
1119395042 14:74320060-74320082 TTATTTTTTTGTAAAGAGGGAGG - Intronic
1119494409 14:75066366-75066388 TTATATTTTAATAAAGCTGGGGG + Intronic
1119727379 14:76929836-76929858 TTTTTTTTTCATGAAAAGGGTGG - Intergenic
1120183685 14:81370599-81370621 TTGCCTTTTCAATAAGAGGGAGG - Intronic
1121663490 14:95653677-95653699 TTTTATTTTTATAGAGATGGGGG + Intergenic
1122163361 14:99802540-99802562 CTGTATTTACATTAAGAGTGGGG + Intronic
1122670692 14:103369429-103369451 TTGTATTTTTGTAGAGATGGAGG + Intergenic
1122718836 14:103711000-103711022 TTCTATTTACATAAAGGGTGTGG - Intronic
1123453560 15:20392760-20392782 TTGAATTGTCATAGAGATGGTGG + Intergenic
1124329528 15:28797751-28797773 TTATATTTTCATAAGCAGAGTGG + Intergenic
1124940209 15:34210553-34210575 TTTTATTTTTATAGAGACGGGGG - Intergenic
1125254565 15:37748272-37748294 TTGAGTTTTTATAAAGATGGGGG - Intergenic
1125466978 15:39963011-39963033 TTGTATCTCCTTAAAGAGGAAGG - Intronic
1125625540 15:41106083-41106105 TTCTATTTTTATAGAGAGGTGGG - Intronic
1125905489 15:43388021-43388043 TTGTATTTTAATAGAGATGGGGG + Intronic
1126111247 15:45175989-45176011 TTGTATTTTTGTAGAGATGGGGG + Intronic
1126506445 15:49409289-49409311 GTTTATTTTCATAAAGGGGGTGG - Intronic
1126586980 15:50298654-50298676 TGTTATTTTCAAAAAGAGGCTGG + Intronic
1126927747 15:53609426-53609448 TTGTATTTTCAGATAGAGGGGGG + Intronic
1126934963 15:53696600-53696622 TTATATTTTCATAAAGCTAGGGG - Intronic
1127644360 15:60945171-60945193 TTGGATTTTCAGAGAGAGGGTGG - Intronic
1127923362 15:63512741-63512763 TTGTATCTTAAGAAAGGGGGAGG - Intronic
1128181901 15:65611774-65611796 TTGTATTTTAGTAGAGAGCGGGG - Intronic
1128317815 15:66672081-66672103 TTGTATTTTTATAAAGACGGGGG - Intronic
1128669519 15:69564047-69564069 TTGTATTTTTTTATAGAGGCAGG + Intergenic
1128755945 15:70184004-70184026 TTGTATTTTAGTAGAGACGGGGG + Intergenic
1129836563 15:78711355-78711377 TTATACTTTAATAAAGATGGAGG - Intronic
1130028300 15:80289134-80289156 TTGTATTTTAGTAGAGAAGGGGG - Intergenic
1130070717 15:80644710-80644732 TTATTTTTTTATAGAGAGGGTGG + Intergenic
1130241268 15:82194736-82194758 ATTTATTTTCATAACTAGGGAGG - Intronic
1130756298 15:86767827-86767849 TTGTATTATCAGAGAGATGGTGG - Intronic
1131011950 15:89025444-89025466 TTGTATTTTTGTAGAGATGGGGG - Intergenic
1131031890 15:89193410-89193432 ATGTCTTTCCCTAAAGAGGGTGG - Intronic
1131089602 15:89612943-89612965 TTGTATTTTAAATAACAGGGGGG + Intronic
1131199568 15:90385591-90385613 TTGTATTTTAGTAGAGACGGGGG + Intergenic
1131595959 15:93798496-93798518 TTGTATTTTAGTAGAGATGGGGG - Intergenic
1132558152 16:581634-581656 TTGTATTTTAGTAGAGATGGGGG + Intronic
1132923649 16:2415134-2415156 TTGTATTTTAGTAGAGATGGGGG + Intergenic
1133131826 16:3680817-3680839 TTGCATCTTCATACAGAAGGTGG - Intronic
1133576905 16:7100293-7100315 TTTTATTTTCAGAAAGAGTCAGG - Intronic
1134619563 16:15677275-15677297 GAGTAGTTTCATAAAGAGAGAGG + Intronic
1135566681 16:23516621-23516643 TTGGGTCTTCATAAGGAGGGAGG - Intronic
1135578226 16:23602686-23602708 TTGTATTTTAATAGAGATGGGGG - Intergenic
1135795731 16:25440823-25440845 TTGTTTTTTCACAGAGAGAGAGG - Intergenic
1135985115 16:27178479-27178501 TTTTATTTTCGTAGAGATGGGGG + Intergenic
1136706598 16:32194084-32194106 ATGTATTTTCAGAAAGAGATTGG - Intergenic
1136761313 16:32735333-32735355 ATGTATTTTCAGAAAGAGATTGG + Intergenic
1136806790 16:33135053-33135075 ATGTATTTTCAGAAAGAGATTGG - Intergenic
1137692265 16:50437183-50437205 TTTTTTTTTTATAAAGATGGGGG - Intergenic
1138987243 16:62344451-62344473 TTATGTTTCCATAAAAAGGGAGG + Intergenic
1138990652 16:62387087-62387109 TTTTATTTTAGTAGAGAGGGGGG + Intergenic
1139217043 16:65136204-65136226 TTGTATTTTTGTAGAGATGGGGG - Intergenic
1139592163 16:67939382-67939404 TTGTATTTTAGTAGAGACGGGGG + Intergenic
1139622878 16:68161130-68161152 TTGTATTCTCATTCAGAGGTTGG - Intronic
1139760329 16:69179825-69179847 GTGTAATTTCATAAGGAAGGAGG - Intronic
1139893371 16:70268908-70268930 TTTAAGTTTCATAAAGAGGCCGG + Intronic
1140069295 16:71635152-71635174 TTGTATTTTAGTAGAGACGGGGG - Intronic
1140674180 16:77310798-77310820 TTGTATTCTCATGGAGACGGGGG + Intronic
1140727664 16:77828489-77828511 TTGTATTTTTATAGAGATGGGGG - Intronic
1141586039 16:85034205-85034227 TTGTATTTTTAGTAAGAGAGAGG - Intronic
1141730657 16:85820863-85820885 TTGTATTTTTATAGAGACGGGGG - Intergenic
1203063465 16_KI270728v1_random:995650-995672 ATGTATTTTCAGAAAGAGATTGG + Intergenic
1142868458 17:2805543-2805565 TTGTATTTTAGTAGAGATGGGGG + Intronic
1142876750 17:2855784-2855806 TTGTATTTTAGTAGAGACGGGGG + Intronic
1143195119 17:5070292-5070314 TTGTATTTTTATAGAGACGGGGG + Intergenic
1143389449 17:6551701-6551723 TTTTTTTTTCATAACGATGGGGG - Intronic
1143566184 17:7722170-7722192 TTGTATTTTTATAGAGACGGGGG + Intronic
1144497744 17:15759272-15759294 GTGTATTTGAAGAAAGAGGGTGG - Intergenic
1144629542 17:16863760-16863782 GTGTATTTGAAGAAAGAGGGTGG - Intergenic
1144815882 17:18034398-18034420 TTGTTTTTTTTTAAAGAGAGGGG - Intronic
1146776361 17:35620810-35620832 TTGTATTTTTTTAAAGAGGCAGG - Intronic
1146887769 17:36483800-36483822 TTGTATTTTAGTAGAGACGGGGG + Intergenic
1147604283 17:41765206-41765228 TTTTCTTTTTATAAAGATGGGGG + Intronic
1147812408 17:43182024-43182046 TTTTTTTTTCCTAAAGAGGCTGG + Intronic
1147954539 17:44124970-44124992 CTGTATTTTAAAAAAGAGGCCGG + Intergenic
1148402253 17:47375466-47375488 TTTTTTTTTCATAGAGACGGGGG + Intronic
1148473543 17:47911630-47911652 TTGTATTTTTAGTAAGAGAGGGG - Intronic
1148502707 17:48103909-48103931 TTGTATTTTAGTAGAGACGGGGG + Intronic
1148531642 17:48398846-48398868 TTGTATTTTTAGAGAGACGGGGG - Intronic
1148885301 17:50767855-50767877 TTGTATTTTAGTAGAGATGGGGG - Intergenic
1149327047 17:55542521-55542543 TTGTATTTTACTAGAGACGGGGG - Intergenic
1149416393 17:56464344-56464366 TTGTATTATCATTAAGACGCCGG - Intronic
1149505410 17:57189948-57189970 TTGTATTTTTGTAGAGATGGGGG + Intergenic
1149960544 17:61105095-61105117 TTTTATTCTCATAAAAAGGGAGG - Intronic
1150716098 17:67573733-67573755 TTGTATTTTTGTAGAGATGGGGG + Intronic
1150765686 17:68000113-68000135 TTGTATTTTCAGTAAGAGATGGG - Intergenic
1150810929 17:68356700-68356722 TGAGGTTTTCATAAAGAGGGAGG - Exonic
1152557498 17:81060948-81060970 TTGTATTTTAGTAGAGATGGGGG - Intronic
1152990715 18:361439-361461 TGGTATTTTAATAAAGGGTGAGG - Intronic
1153681049 18:7501384-7501406 TTGTATTTTAGTAGAGATGGGGG - Intergenic
1155302383 18:24442324-24442346 TTGTATTTTAGTAGAGACGGGGG + Intronic
1155469835 18:26179910-26179932 TTTTTTTTTCATAGAGATGGGGG - Intronic
1155566226 18:27137675-27137697 TTGTATTTTTAAAAAACGGGTGG + Intronic
1155805004 18:30158472-30158494 TTGTCTTTTCATATATAGGGTGG - Intergenic
1155953064 18:31934013-31934035 TTGTATTTTAGTAGAGATGGGGG - Intronic
1155985325 18:32224771-32224793 TTGTATTTTTGTAGAGACGGGGG + Intronic
1156735236 18:40249385-40249407 TTGTATTCTGAAAGAGAGGGTGG + Intergenic
1156979461 18:43267272-43267294 TTATTTTTTCTTAAAGAAGGAGG - Intergenic
1157427253 18:47594565-47594587 TTGTATTTTGTTAAAGGGGCGGG + Intergenic
1158936003 18:62365131-62365153 TTGTATTTTTTTATAGAGGTGGG + Intronic
1159078558 18:63709182-63709204 TTCTATTTTCATAAACATGATGG + Intronic
1159158816 18:64618227-64618249 CTGTAGTCTCATACAGAGGGAGG - Intergenic
1159555241 18:69938911-69938933 TTGTATTTTTGTAGAGATGGGGG - Intronic
1159856471 18:73595715-73595737 TGATATTTTCATAAAAAGAGAGG + Intergenic
1161877869 19:6925866-6925888 TTGTATTTTTGTATAGAGAGGGG + Intronic
1162266502 19:9579941-9579963 TTGAATTTTCAAATAGAGGGTGG + Intronic
1162330141 19:10023031-10023053 TTGTATATTCTTAAAGAGGAAGG + Intergenic
1162418611 19:10553054-10553076 TTGTGTTTTTATAAAGGGAGGGG + Exonic
1162429583 19:10619779-10619801 TTGTATTTTAGTAGAGATGGGGG - Intronic
1162981246 19:14241520-14241542 TTGTATTTTAGTAGAGACGGGGG + Intergenic
1163252187 19:16132559-16132581 TTGTATATTCAGAGAGAGAGAGG + Exonic
1163617675 19:18339566-18339588 TTGTATTTTTGTAGAGATGGGGG - Intergenic
1163653167 19:18530628-18530650 TTTTTTTTTAATAAAGAGGTGGG - Intergenic
1163704769 19:18805805-18805827 TTGTATTTTAGTAGAGATGGGGG - Intergenic
1164026872 19:21360624-21360646 TTGTGTTTTTGTAAAGACGGGGG + Intronic
1164101434 19:22057932-22057954 TTGTATTTTTGTAGAGACGGGGG + Intronic
1164615475 19:29664862-29664884 TTGTATTTTTGTACAGACGGAGG - Intergenic
1164935302 19:32205679-32205701 TTGTATTTTTATTAAGAGACGGG - Intergenic
1165461780 19:35948198-35948220 TTGTATTTTTGTAGAGATGGGGG + Intergenic
1165525406 19:36350426-36350448 TTGTATTTTTTTAGAGATGGGGG - Intronic
1167048124 19:47063274-47063296 TTGTATTTTAGTAGAGATGGGGG + Intergenic
1167650606 19:50726577-50726599 TTGTATTTTTTTATAGAGGTTGG + Intergenic
1167842882 19:52136306-52136328 TTGTATTTTAGTAGAGACGGGGG - Intronic
1168165056 19:54541447-54541469 TTTTTTTTCCATAAGGAGGGAGG - Intronic
1168322856 19:55520714-55520736 TTCTTTTTTAATAAAGATGGGGG - Intergenic
1168377853 19:55895508-55895530 TTGTATTTTTGTAGAGATGGGGG - Intronic
1168637328 19:58006715-58006737 TTGTATTTTAGTAGAGACGGGGG - Exonic
926045589 2:9707534-9707556 TTGTATTTTAGTAGAGACGGGGG - Intergenic
926368756 2:12159128-12159150 TTGTATTTTCATATAAATGTAGG + Intergenic
927472062 2:23384708-23384730 CTGGAGTGTCATAAAGAGGGCGG + Intergenic
927567733 2:24127989-24128011 TTGTATTTCCCAAAAGATGGAGG - Intronic
928085892 2:28346156-28346178 TTGTATTTTTATATAGACGGAGG + Intergenic
928143902 2:28753908-28753930 TTGTATTTTTGTAGAGACGGAGG + Intronic
928216651 2:29367043-29367065 TTGTATTTTCAAAAAGAGGACGG - Intronic
928568970 2:32583903-32583925 TTGTATTTTTGTAGAGACGGAGG + Intronic
928585829 2:32757094-32757116 ATGTAGTTTGATAAAGAGGTAGG + Intronic
928872979 2:36003256-36003278 TTCCATTTTCATAAAGGTGGAGG + Intergenic
929636876 2:43532237-43532259 TTGTATTTTAGTAGAGACGGGGG - Intronic
929992780 2:46803739-46803761 TGGTATGTCCATCAAGAGGGTGG - Intergenic
930045175 2:47164416-47164438 TTGTGTTTTAATAGAGACGGGGG - Intronic
931080711 2:58766920-58766942 TTCTAATTTCATAAAAATGGTGG + Intergenic
931586549 2:63836025-63836047 TTGTATTTTAGTAGAGAAGGGGG + Intergenic
931797106 2:65721875-65721897 TTGCCTTTTTAAAAAGAGGGTGG + Intergenic
931974535 2:67628868-67628890 TTGTGTATTCTTAAAGTGGGAGG + Intergenic
932405315 2:71509025-71509047 TTGTATTTTTATAGAGATGGGGG + Intronic
932440981 2:71735055-71735077 TTGTATTTTTTTAAAGAGATAGG + Intergenic
932550577 2:72765498-72765520 TTGTAATTTAGTAGAGAGGGGGG - Intronic
932674239 2:73764792-73764814 TTGTATTTTAGTAGAGATGGGGG - Intronic
933204344 2:79488144-79488166 TTGTATTTTAGTAGAGACGGGGG - Intronic
933242010 2:79932226-79932248 TTGTTTTTTCAGAGAAAGGGAGG - Intronic
933904400 2:86875936-86875958 TTGTTTTTTAATAGAGATGGGGG + Intergenic
934505696 2:94891417-94891439 TTGTATTTTAGTAAAGACGGGGG - Intergenic
934684373 2:96309784-96309806 TTGTATTTTAATAGAGACAGGGG - Intergenic
934939632 2:98491133-98491155 TTGTATTTCCAAAAAGGGGGCGG + Intronic
935280569 2:101514214-101514236 TTGTATTTTTGTAGAGATGGGGG + Intergenic
935683125 2:105655608-105655630 TTGTATTTTCAAAAAAAGATTGG + Intergenic
936367842 2:111876215-111876237 TTGTTTTTTAATAGAGATGGGGG - Intronic
936718584 2:115220537-115220559 TTTTATTTTTATAGAGATGGGGG - Intronic
938216445 2:129521731-129521753 TTGTATTTTAATAGAGCCGGGGG + Intergenic
938871256 2:135479460-135479482 TTGTATTTTTGTAGAGATGGGGG - Intronic
939603208 2:144219646-144219668 TTGTATTTTTGTAGAGACGGGGG - Intronic
939696362 2:145329634-145329656 TTGTATTTTCACTAAGAGGAGGG + Intergenic
939702972 2:145417315-145417337 TTTCCTTTTCATAAAGTGGGGGG + Intergenic
940268119 2:151861667-151861689 TTGTATTTTAGTAGAGACGGAGG - Intronic
940893629 2:159059329-159059351 TTATTTTTTCATAGAGATGGAGG - Intronic
941201781 2:162520586-162520608 TTGTTTTTTTATAGAGATGGGGG - Intronic
941211201 2:162641993-162642015 TTGTTTGTTCATAAAGAAGCAGG + Intronic
941846362 2:170138331-170138353 TTGTATTTTAGTAGAGATGGGGG - Intergenic
942654789 2:178204194-178204216 TTGCATTTTAGTAGAGAGGGTGG + Intronic
943188431 2:184645673-184645695 TTTTATTTTCCCAAAGATGGGGG + Intronic
943910277 2:193556442-193556464 ATGTATTTTCAGAAGGAGGTAGG - Intergenic
944276736 2:197847420-197847442 TTTTATTTTCATAGAGAGAATGG + Intronic
944735510 2:202559126-202559148 TTGTATTTTAGTAGAGACGGGGG - Intronic
946283550 2:218684591-218684613 TTGTATTTTCATAGAGAGGGGGG + Intronic
946499953 2:220236910-220236932 TTGTATTTTAGTAGAGATGGGGG + Intergenic
946816676 2:223585760-223585782 TTTTATTTTCTTAAAGATGCAGG + Intergenic
947305971 2:228747786-228747808 TTTTGTTTCCATAAAGAAGGCGG + Intergenic
947601555 2:231453978-231454000 TTGTCTTTTACTAAAAAGGGAGG + Exonic
948118598 2:235512422-235512444 TTGTTTTTTCGTAGAGATGGGGG - Intronic
948217379 2:236241725-236241747 CTGTATCATCACAAAGAGGGTGG - Intronic
948591196 2:239051316-239051338 TTCTATTTTCAGAAAGTGAGAGG - Exonic
1170188302 20:13617593-13617615 TTATATTTTCATAAGCAGAGTGG - Intronic
1170590465 20:17767526-17767548 TTGTATTTTCAGTAAGAGACAGG + Intergenic
1172118898 20:32586142-32586164 TGGTAATTTCATTAAGGGGGAGG - Intronic
1172368472 20:34368094-34368116 TTGTATTTTAGTAGAGATGGGGG - Intronic
1172615981 20:36284863-36284885 TTGTATTTTTATAGACAGGGGGG + Intergenic
1172666579 20:36604737-36604759 TTGTATTTTAGTAGAGACGGGGG - Intronic
1173515653 20:43663833-43663855 TTGTATTTTAATAGAGATCGGGG - Intergenic
1174237612 20:49106976-49106998 TTTTTTTTTCAAAAAGTGGGTGG - Intergenic
1174847986 20:53962589-53962611 GTGTATTTTTATAAAGTGAGTGG - Intronic
1175620328 20:60439886-60439908 TAGTATTTTCAAAAAAATGGTGG - Intergenic
1176066666 20:63200737-63200759 TTGGGTTTTCATAAAGTGTGCGG - Intronic
1177074935 21:16559658-16559680 TTATATGTTAATAATGAGGGCGG + Intergenic
1177570042 21:22875295-22875317 TTATAATTTCAGAAATAGGGAGG + Intergenic
1178111328 21:29372929-29372951 TTGTATTTTAGTAGAGACGGGGG + Intronic
1178319440 21:31594105-31594127 TTGTATTTTTGTAGAGACGGGGG + Intergenic
1178545988 21:33493420-33493442 TTGTATTTTTAGAGAGATGGGGG - Intergenic
1178712992 21:34936265-34936287 TTTTTTTTTAAAAAAGAGGGGGG - Intronic
1178985751 21:37301425-37301447 TTGTATTTTAATATAGAGACGGG + Intergenic
1179030599 21:37716553-37716575 TTTTATTTTCATGGAGACGGGGG + Intronic
1179062475 21:37991809-37991831 TTTTATTTTCAACAACAGGGAGG - Intronic
1179842097 21:44083583-44083605 GTGTATTTTCATATGCAGGGGGG - Intronic
1180134048 21:45849376-45849398 TTGTATTTTGGTAGAGATGGGGG + Intronic
1181576460 22:23798391-23798413 TTTTATTTTTATAGAGATGGTGG - Intronic
1181659528 22:24333620-24333642 TTTTATTTTTTTAAAGAGTGTGG + Intronic
1181894971 22:26099188-26099210 TTGTATTTTCAGGCTGAGGGAGG - Intergenic
1183503876 22:38197945-38197967 TTGTATTTTTGTAGAGACGGGGG - Intronic
1183552246 22:38496520-38496542 TTGTATTTTTGTAGAGATGGGGG + Intronic
1184052579 22:42019044-42019066 TTGTATTTTTGTAGAGATGGGGG - Intronic
949320603 3:2806073-2806095 TTGTATTTTCAGAGAGACGGGGG + Intronic
949342029 3:3040628-3040650 TTGTATTTTCATAAAGCATATGG + Intronic
949538545 3:5014108-5014130 TTGTGTTTTCGTAGAGATGGGGG + Intergenic
950959022 3:17085306-17085328 TTGTATTTTTATATAGAGATGGG + Intronic
951515482 3:23554504-23554526 TTTTATTTTTTTAAAGAGAGAGG - Intronic
951747191 3:25992340-25992362 TTGATTATTCATAAAGAGGTGGG - Intergenic
951886490 3:27529701-27529723 TTGTATTTTAGTAGAGAGGGGGG - Intergenic
952821609 3:37491147-37491169 TTGTATTTTTGTAGAGATGGGGG + Intronic
953016633 3:39083112-39083134 ATGGATTTAAATAAAGAGGGTGG + Intronic
953302404 3:41791428-41791450 TAGCATTTTCATAAAGATTGAGG - Intronic
953396339 3:42573659-42573681 ATTTATTTTCATACAGATGGGGG - Intronic
953760965 3:45686838-45686860 TTGTATTTTTAAATAGAGAGAGG + Intergenic
954740628 3:52747280-52747302 TTGTATTTTTGTAGAGACGGGGG - Intronic
954858569 3:53667887-53667909 ACGTCTTTTCATAAAGAGGAAGG + Intronic
956085476 3:65604577-65604599 TTATATATTCATAGAGATGGGGG + Intronic
956293280 3:67684402-67684424 TTTTATTTTAATTTAGAGGGGGG - Intergenic
956535264 3:70268299-70268321 TTGTATTTTAGTACAGACGGTGG - Intergenic
956994074 3:74803429-74803451 TTGTCTTGTCACAAAGAAGGAGG - Intergenic
957169071 3:76714034-76714056 TAGTATGTTCAGAAATAGGGCGG + Intronic
958012236 3:87894427-87894449 TTGTATTTTCTTACAGAGACAGG + Intergenic
958065355 3:88538205-88538227 TAGTATTTTTATAAATAGGTAGG + Intergenic
959086992 3:101862042-101862064 TTGGATGTTCATATAAAGGGAGG + Intergenic
959429865 3:106239701-106239723 TTGAATTTGCATAAAGATAGTGG + Intergenic
959816518 3:110680223-110680245 TTGTATTTTTAAAAACAGGGGGG + Intergenic
960098890 3:113717160-113717182 TTGTATTTTAGTAGAGATGGGGG - Exonic
960876816 3:122304683-122304705 TTGTATTTTTGTAGAGAGCGGGG - Intergenic
961693317 3:128686158-128686180 TTGTATTTTAGTAGAGATGGGGG + Intergenic
961833772 3:129639791-129639813 TTGCATTTTAGTAGAGAGGGGGG - Intergenic
963361117 3:144273034-144273056 CAGTGTTTCCATAAAGAGGGCGG - Intergenic
963390125 3:144651120-144651142 TTAAACTTTCATAAAGAAGGAGG + Intergenic
964238055 3:154557641-154557663 TTGTTTTTTGTTTAAGAGGGAGG + Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
964788290 3:160424315-160424337 TTGTATTTTCAAAATACGGGAGG - Intronic
965737350 3:171835481-171835503 GTGGATTTTCATAAAGAAGAGGG + Intergenic
965782737 3:172304722-172304744 TTGTATTTTTGTAGAGATGGGGG - Intronic
965883190 3:173411936-173411958 TTGTATTTTCTGAAAGAGAATGG + Intronic
966874243 3:184313128-184313150 TTGTATTTTAGTAGAGATGGGGG + Intronic
966981700 3:185142283-185142305 TTTTATTTTTGTAGAGAGGGGGG - Intronic
967479330 3:189956097-189956119 TTGTATTTTGAGTAGGAGGGAGG + Intergenic
969420731 4:7093783-7093805 TTGTATTTTTATTAAGAGACGGG + Intergenic
969458593 4:7315255-7315277 TTGATATTTCACAAAGAGGGAGG - Intronic
969610046 4:8222544-8222566 TTGTATTTTTGTAGAGATGGGGG + Intronic
970197406 4:13565600-13565622 TTGTATTTTCATAAGAAATGGGG + Intergenic
970507143 4:16743115-16743137 TTGTATTTTAGTAGAGATGGGGG - Intronic
970924332 4:21433427-21433449 TTGTTTTTTAATAGAGATGGGGG - Intronic
971252213 4:24982852-24982874 TTGTATTTTTGTAGAGATGGGGG + Intergenic
971849448 4:31964693-31964715 TTATATTTTCATAACTAGTGAGG + Intergenic
972433958 4:39013572-39013594 TTGTATTTTAATAGAGACGGGGG + Intronic
972670665 4:41211653-41211675 TTGTATTTTTTTAGAGACGGGGG + Intronic
972767547 4:42165820-42165842 TTTTATTTTTATAGAGATGGTGG + Intergenic
973275270 4:48300527-48300549 TTGTATTTTAGTAGAGACGGGGG + Intergenic
973550427 4:52029728-52029750 CTGTGCTTTTATAAAGAGGGTGG + Exonic
975138687 4:70899048-70899070 TTATTTTTTCATAGAGATGGGGG + Intergenic
976180835 4:82397177-82397199 TTGTATTTTCTGATAGAGGCGGG - Intergenic
976254009 4:83082064-83082086 TTTTATTTTTTTAAGGAGGGGGG + Intergenic
976639925 4:87327579-87327601 TTGTATTTTAGTAGAGACGGGGG - Intergenic
976916384 4:90380300-90380322 ATGTATTTTTATAAAGAGAGAGG - Intronic
976930774 4:90564226-90564248 TTGTGATTTCATAGAGATGGGGG + Intronic
977351910 4:95898986-95899008 ATGTATTATCATCAGGAGGGAGG + Intergenic
977646040 4:99413700-99413722 ATGTATTTTAATACAGAAGGTGG + Intronic
977862818 4:101986393-101986415 ATGTTATTTCATGAAGAGGGAGG - Intronic
978810296 4:112842180-112842202 TTGTATTTTAGTAGAGATGGGGG + Intronic
979363103 4:119787605-119787627 TTGTATTTTTTTAAAGAGATGGG + Intergenic
979602867 4:122605426-122605448 TTCTATTTTTGTAAAGGGGGAGG + Intergenic
979693718 4:123588013-123588035 TTGTATTTTAATAGAGATGGGGG + Intergenic
979767537 4:124480321-124480343 TTTTGTTTTCATAAAGATAGAGG - Intergenic
980394658 4:132195190-132195212 TTGTATCTTCAAAATGAGTGTGG - Intergenic
980652755 4:135741618-135741640 TTGGATTGTTATAAAGAGAGGGG - Intergenic
980965435 4:139516291-139516313 TTGTATTTTTGTAGAGATGGGGG - Intronic
981234342 4:142397662-142397684 TTGTATTTTAGTAGAGACGGGGG - Intronic
981844160 4:149147499-149147521 TTGTATTTCCGTAAGAAGGGAGG - Intergenic
982505937 4:156218269-156218291 TTATATTTTAACAAAGAGGCTGG + Intergenic
982592767 4:157336183-157336205 CTGTGTATTCATAAAGAGGAGGG + Intronic
982738673 4:159034716-159034738 TTGTATTTTTGTAAAGATGAGGG - Intronic
983825557 4:172254331-172254353 TTAGATATTAATAAAGAGGGAGG + Intronic
986819897 5:11454772-11454794 TTGTATTTTAGTAGAGATGGGGG + Intronic
987874894 5:23668445-23668467 TTGTATTTTTGTAGAGATGGGGG + Intergenic
988144587 5:27289476-27289498 TTTTATTTACATAAACATGGTGG - Intergenic
989040368 5:37221279-37221301 TTGTATTTTTAAAAAGAGACAGG - Intronic
989069405 5:37494937-37494959 TTTTATTTACAAAAACAGGGTGG - Intronic
990219830 5:53575712-53575734 TTGTATTTTTGTAGAGATGGGGG + Intronic
990783019 5:59387540-59387562 TTGTATTTCCATAGTTAGGGTGG + Intronic
990843746 5:60113240-60113262 TTCTATTTTCTTAAGGAAGGAGG - Intronic
990875613 5:60481660-60481682 TTGTAGTTTTATAAAAAGGTGGG - Intronic
992952584 5:81874999-81875021 TAGTACTTAAATAAAGAGGGTGG + Intergenic
993601564 5:89932311-89932333 TTTTATTTTCAAAAATGGGGTGG - Intergenic
994618020 5:102130877-102130899 TTCTATTCTTATAAAGAGTGGGG - Intergenic
994790283 5:104216536-104216558 TTTTATTGTCACAAAGAGGTAGG - Intergenic
995000973 5:107129548-107129570 TTGACTTTTCATAAATTGGGGGG - Intergenic
995424722 5:112007695-112007717 TTGTTTTTTAATAAAGAGGAAGG + Intergenic
995689380 5:114806521-114806543 TTGTGTCTTTATAAAGAGGTAGG - Intergenic
996072603 5:119150615-119150637 TTTTGTTTTCATAGAGATGGGGG - Intronic
996394831 5:123003085-123003107 TTTTATTGTCAGAAACAGGGAGG - Intronic
996910040 5:128646096-128646118 ATGTAATTTCATAAGAAGGGGGG - Intronic
997129955 5:131266627-131266649 TTGTATTTTCAAAAAGAGACGGG + Intronic
998616563 5:143747054-143747076 TTTTATATTCATAAAAGGGGAGG - Intergenic
999360032 5:150976346-150976368 TTGTATTTTCAAAAGGAGTAAGG - Intergenic
999392051 5:151200309-151200331 TTGTATTTTTGTAGAGACGGTGG + Intronic
999811155 5:155128618-155128640 CTGTATCTTAATAAACAGGGAGG - Intergenic
1000120966 5:158197515-158197537 TTTTTTTTTCACAAAGAGGTGGG + Intergenic
1000719407 5:164688222-164688244 TTGTATTTTAGTAGAGATGGGGG + Intergenic
1002124295 5:177030444-177030466 TTGTATTTTAGTAGAGATGGGGG - Intronic
1002627226 5:180538510-180538532 TTGTATTTTAGTAGAGACGGAGG - Intronic
1003181471 6:3795512-3795534 TTGTATTTTAGTATAGACGGGGG + Intergenic
1003638273 6:7854621-7854643 TTGTATTTTAGTAGAGACGGGGG - Intronic
1003699635 6:8447400-8447422 TTGCATTTTAATAGAGATGGGGG + Intergenic
1003781484 6:9432491-9432513 TTGTATTTTAGTAGAGATGGGGG + Intergenic
1004084275 6:12429266-12429288 TTGTGTGTGCATGAAGAGGGTGG + Intergenic
1004117529 6:12785275-12785297 TTGTATTGTCATAGAAAAGGTGG + Intronic
1004164858 6:13247857-13247879 TTGTTTTTTTTTAAAGAGGCAGG - Intronic
1005201591 6:23351066-23351088 TTTTTTTTTCAGAAAGAGGGAGG + Intergenic
1005223227 6:23612226-23612248 TGCTATTTTGATCAAGAGGGGGG + Intergenic
1006078965 6:31553204-31553226 TTGTATTTTTGTAGAGATGGGGG + Intronic
1006916322 6:37596309-37596331 TTGTATTTTAGTAGAGATGGGGG - Intergenic
1007801181 6:44394682-44394704 TTGTATTTTTTTATAGAGGCAGG - Intronic
1007953862 6:45898268-45898290 TTGTATTTTAGTAGAGATGGGGG - Intergenic
1008178332 6:48295569-48295591 TTGTATTTCCATGAAAAGGGTGG + Intergenic
1008511817 6:52283125-52283147 TTTTTTTTTCAAAAAGTGGGTGG - Intronic
1008887210 6:56444379-56444401 CTGTATTTCCATATAGAGGGAGG - Intergenic
1008952677 6:57177480-57177502 TTGTGCTTTCATAAAAAGGAGGG - Intronic
1010049477 6:71485640-71485662 TTGTATTTTAGTAGAGATGGGGG + Intergenic
1010242208 6:73626942-73626964 TTGTATTTTGGTAGAGATGGGGG + Intronic
1010457518 6:76075364-76075386 TTGTATATTCTTAAAGAGATAGG + Intergenic
1010702031 6:79061978-79062000 GTGTATTTTGATAAAGAGTAAGG - Intronic
1012467614 6:99532985-99533007 TTGTATTTTAGTAGAGACGGGGG - Intergenic
1012509757 6:99989772-99989794 TTATATTTTCAAAAAGTGGAAGG - Intronic
1012589831 6:100967598-100967620 TTTAATTTTCATAAAGTGGGAGG + Intergenic
1012994968 6:105964030-105964052 TTATATTTTCCTAGAGATGGGGG + Intergenic
1014456920 6:121646404-121646426 TTGTATTTTTATTAAGAGACGGG - Intergenic
1014624611 6:123710428-123710450 TTTTATTTTTGTAAAGATGGAGG - Intergenic
1015693125 6:135948662-135948684 TTTTATTTTAATTAAGATGGTGG + Intronic
1015799938 6:137050425-137050447 TTGTATTTTAGTAGAGATGGGGG + Intergenic
1016591747 6:145753472-145753494 TTATATTTGCATTAAGAGAGAGG + Intergenic
1016913605 6:149223884-149223906 TTTTCTTTTCCTAAAGGGGGAGG - Intronic
1017352040 6:153454015-153454037 TTGTATTTTTGTAGAGACGGGGG + Intergenic
1017961728 6:159228846-159228868 TTGTATTTTAATAGAGACGGGGG + Intronic
1019576153 7:1738594-1738616 TTGTACTTTTTTAAAGAGGTGGG - Intronic
1019599264 7:1873339-1873361 TTGTAATTACAGCAAGAGGGTGG + Intronic
1019740165 7:2668849-2668871 TTGTATTTTAGTAGAGATGGGGG + Intergenic
1019826521 7:3289134-3289156 TTGTATTTTAGTAGAGACGGGGG + Intergenic
1019835356 7:3377949-3377971 TTGTATTTTAGTAAAGATGGGGG + Intronic
1020070059 7:5221279-5221301 TTGTATTTTAGTAGAGATGGGGG + Intronic
1020264325 7:6550393-6550415 TTATATATTGATCAAGAGGGTGG + Intronic
1020362688 7:7346462-7346484 TTGTATTGCCTTTAAGAGGGAGG - Intergenic
1021209904 7:17836344-17836366 TTGTATTTTTTTAAAGAGACAGG - Intronic
1021634115 7:22674398-22674420 TTGTATTTGCATAAAAAGTTAGG + Intergenic
1022332115 7:29389879-29389901 TTGTATTTTAGTAGAGACGGGGG - Intronic
1023053807 7:36275808-36275830 TATTCTTTTCAGAAAGAGGGAGG + Intronic
1023598995 7:41863043-41863065 TTGTATTTTAGTAGAGACGGGGG + Intergenic
1023610081 7:41964072-41964094 TTTTTTTTTTAAAAAGAGGGTGG + Exonic
1023773312 7:43580005-43580027 TTTTATTTTAATAGAGATGGGGG + Intergenic
1024386585 7:48758825-48758847 TTATATTTTCAGACAGAGGCTGG + Intergenic
1025828699 7:65031871-65031893 TTTTATTTTTATAGAGATGGGGG - Intergenic
1025907744 7:65801237-65801259 TTGCATTCTCATCAAGAGGCAGG - Intergenic
1026042564 7:66880375-66880397 TTGCATTCTCATCAAGAGGCAGG - Intergenic
1026154233 7:67813265-67813287 TTGTTTTTTTATAGAGATGGAGG + Intergenic
1027151394 7:75736542-75736564 TTATATTTTCATAGAGATGGGGG - Intronic
1027793682 7:82664470-82664492 TTGTATATTCATAAATTTGGAGG + Intergenic
1028487923 7:91380238-91380260 TTATATTTTCATAAATAGCCAGG - Intergenic
1028703490 7:93811531-93811553 TGATATGTGCATAAAGAGGGAGG - Intronic
1028762123 7:94508922-94508944 TTGTATTTTAATAGAGACGGGGG - Intergenic
1029360921 7:100088325-100088347 TTTTATTTTGATAGAGACGGGGG - Intergenic
1029566077 7:101338957-101338979 TTGTATTTTTATAGAGATGGGGG + Intergenic
1029593434 7:101522638-101522660 TTGTATTTTCATGGGAAGGGAGG + Intronic
1029643797 7:101838627-101838649 TTGTATTTTAGTAGAGACGGGGG - Intronic
1029845975 7:103412720-103412742 TTGTATTTTTACAAAGAGATGGG + Intronic
1029894815 7:103971898-103971920 TTGTATTTTACTAGAGACGGGGG - Intronic
1030654308 7:112149438-112149460 TTGTATTCTCATACACAGAGGGG - Intronic
1030686904 7:112496439-112496461 TTTTATTTGCAGAAAGAAGGGGG + Intergenic
1031026001 7:116680767-116680789 TTGTAATTTTTTTAAGAGGGGGG - Intronic
1031178962 7:118391137-118391159 TTGTATTTTCATTAGAGGGGGGG + Intergenic
1031282611 7:119822855-119822877 TTGAATTTTGATAAATAAGGAGG - Intergenic
1031488009 7:122353054-122353076 CTGAATTCTCATAATGAGGGAGG + Intronic
1031600915 7:123708011-123708033 TTGTATTTTCTTATAGAGATGGG - Intronic
1032135142 7:129269606-129269628 TTGTTTTTTAATAGAGATGGGGG + Intronic
1032715583 7:134506416-134506438 TGGTATTAACATAAAGATGGGGG + Intergenic
1032934682 7:136714927-136714949 TAGTATTTTCATCATGAAGGGGG - Intergenic
1033058527 7:138082372-138082394 TTTTATTTTAATAGAGATGGGGG + Intronic
1034082831 7:148296371-148296393 TTGTATTTTAGTAGAGATGGTGG - Intronic
1034230873 7:149527520-149527542 TTGCATGTTCATAGAAAGGGAGG - Intergenic
1034410220 7:150937162-150937184 TTGTATTTTTATAGAGAGGTGGG - Intergenic
1035138596 7:156733393-156733415 CTATATTTTCACAAAGAGGGAGG + Intronic
1035374452 7:158398233-158398255 TTGTGTTTTCAAAACCAGGGTGG + Intronic
1035827507 8:2660383-2660405 TTGTAATTTGACTAAGAGGGTGG + Intergenic
1035898603 8:3433128-3433150 TTGCATTTTGATAAACATGGTGG + Intronic
1036151886 8:6306711-6306733 TTGTATTTTAATAGACACGGGGG + Intergenic
1038800970 8:30748711-30748733 TTGTATTTTGGTAGAGATGGAGG + Intronic
1039478459 8:37854351-37854373 TTGTATTTTCATTTAGAGAAAGG - Intergenic
1039611647 8:38924022-38924044 TTGTATTTTATTAGAGATGGGGG + Intronic
1040697261 8:50015338-50015360 ATGTAGTTTCAGAAAGAGAGTGG + Intronic
1043079770 8:75751791-75751813 TTGTATTTTTAGAAAGAGATGGG + Intergenic
1043140440 8:76581998-76582020 TTGTATTTGCTTAAAGGGGAAGG + Intergenic
1043209527 8:77493646-77493668 TTTTTTTTTCATAAAAATGGAGG - Intergenic
1043612102 8:82077704-82077726 TTGTATTTTGAAATAGAGGCGGG + Intergenic
1045185379 8:99831920-99831942 ATGTATTTTTAGAAAGAGGCTGG - Intronic
1045900050 8:107267170-107267192 TTGTATTTTCACATGGAGAGAGG - Intronic
1046912761 8:119646879-119646901 TTGAATTTTCATAAATATGTTGG - Intronic
1046973430 8:120247830-120247852 TTGTATTTTTTTAAAGAAGTAGG + Intronic
1048433441 8:134392239-134392261 TTTTATTTTCATAGAGATGAAGG + Intergenic
1048556870 8:135486919-135486941 TTTTATTTTCTTAAAGAGGATGG + Intronic
1048951843 8:139502807-139502829 ATGTACTTTCATAAAGCTGGGGG + Intergenic
1049133354 8:140870058-140870080 TTCTGTTATTATAAAGAGGGCGG - Intronic
1049968563 9:801042-801064 TTGTATTTTAGTAGAGAGGCGGG - Intergenic
1050252924 9:3764712-3764734 TTGTATTTTAATAGAGAACGGGG + Intergenic
1050269421 9:3926402-3926424 TTGTATTTTAGTAGAGACGGGGG + Intronic
1050314113 9:4383817-4383839 TTACATTTTAATTAAGAGGGAGG + Intergenic
1050437665 9:5627885-5627907 TTGTATTTTCAGTAAGACGGGGG + Intergenic
1050787357 9:9422310-9422332 TTATACTATCATAAAGAAGGGGG + Intronic
1051646764 9:19276144-19276166 CTGTATTTTCTAGAAGAGGGAGG - Exonic
1051872181 9:21750778-21750800 TTGTATTTTCATATAGTAGCTGG - Intergenic
1052216957 9:25978049-25978071 TTGTATTTTCATTAAAAATGTGG - Intergenic
1052314655 9:27104022-27104044 TTGTATTTTTGTAGAGACGGGGG + Intergenic
1053124967 9:35573664-35573686 TTTTATTTTTGTAGAGAGGGGGG - Intergenic
1053233292 9:36430105-36430127 TTGTGTTTTTATCAAGAGGATGG + Intronic
1053290466 9:36876252-36876274 TTTTATTTTCTTAAAGAAGTAGG - Intronic
1053468405 9:38326680-38326702 TTATATTTTTATAAAGCTGGAGG + Intergenic
1053591615 9:39520223-39520245 GTGCATTTTCATAAATGGGGTGG - Intergenic
1054574693 9:66845066-66845088 GTGCATTTTCATAAATGGGGTGG + Intergenic
1054866087 9:70003215-70003237 TTGGATTCTCAGAAAGATGGTGG - Intergenic
1054999845 9:71436474-71436496 TTGTATTTTAGTAGAGACGGGGG + Intronic
1055360259 9:75482175-75482197 ATATATTTTCATAAAGTGGATGG - Intergenic
1055433875 9:76272598-76272620 TTGTATTTTAGTAGAGATGGGGG - Intronic
1055612750 9:78039861-78039883 TTGTATTTTAGCAAAGATGGGGG - Intergenic
1055957788 9:81790883-81790905 TTGTATTTTCAGAAAGGACGGGG - Intergenic
1056274031 9:84975215-84975237 TTGCATTTTGGGAAAGAGGGGGG - Intronic
1056370870 9:85953036-85953058 TTGTATTTTCTTATAGAGACGGG - Intronic
1056458392 9:86785427-86785449 TTGCACTTTCTTAAAAAGGGTGG - Intergenic
1056605800 9:88083835-88083857 TTGTATTTTAGTAGAGACGGGGG + Intergenic
1056633366 9:88311875-88311897 TTGTATTTTAGTAGAGATGGGGG + Intergenic
1057196357 9:93117509-93117531 TTGTATTTTAATAGAGACAGGGG + Intergenic
1057249987 9:93493384-93493406 TTGTATTTTCATTTAGAGAAAGG - Intronic
1057530990 9:95846516-95846538 TTGTATTTTCATAATAATGGGGG + Intergenic
1058318371 9:103598255-103598277 TAGTATTTTCACAGAGAGTGGGG + Intergenic
1058449443 9:105082361-105082383 TTGTATTTTTGTAGAGACGGGGG + Intergenic
1058478930 9:105371175-105371197 TTGTATTTCCAGTAAGAGGGTGG + Intronic
1058566350 9:106289301-106289323 TTGTTTTTTCTTAAAGAGCAAGG + Intergenic
1058687850 9:107493334-107493356 TTGTATTTTAGTAGAGATGGGGG + Intergenic
1058962739 9:110007066-110007088 TTCTTTTTTCTTAAAAAGGGAGG + Intronic
1060287006 9:122262754-122262776 TTGTATTTTCTTGTAGAGGCAGG + Intronic
1060413146 9:123413009-123413031 TTGTATTTTTGTATAGATGGGGG - Intronic
1060558428 9:124522361-124522383 TTGTATTTTGAGGGAGAGGGTGG - Exonic
1060618379 9:125040181-125040203 TTGTATTTTCTTATAGAGACGGG - Intronic
1060803659 9:126561555-126561577 TTGTATTTTTATAGAGAGAAGGG + Intergenic
1061522667 9:131129577-131129599 TTTTTTTTTCATGACGAGGGAGG + Intronic
1061558751 9:131389012-131389034 TTGTATTTTAGTAGAGATGGGGG + Intergenic
1062540130 9:137038128-137038150 TTGTATTTTAGTAGAGACGGGGG + Intergenic
1185472024 X:389631-389653 TTGTATTTTTGTAGAGACGGGGG - Intergenic
1185774968 X:2794635-2794657 TTGAATTTGCACAGAGAGGGTGG + Intronic
1185864015 X:3606545-3606567 TTGTATTTTAGTAGAGATGGGGG + Exonic
1186144506 X:6611287-6611309 TTTTATTTGCATAAAGATTGAGG - Intergenic
1186608152 X:11112311-11112333 TTGTATTTTTTTGTAGAGGGAGG - Intronic
1186672397 X:11780869-11780891 TTGTATTTTAGTAGAGATGGGGG + Intergenic
1187953193 X:24491139-24491161 TTGTATTTTTACAAAGAGATAGG - Intronic
1188043480 X:25398305-25398327 TTGTATTTTTAGAAAGAGACAGG + Intergenic
1188481084 X:30637640-30637662 TTGTATTTTTGTAGAGACGGGGG - Intergenic
1188807608 X:34611263-34611285 TTGTATTTTCCTAAACATGGTGG - Intergenic
1189709017 X:43789973-43789995 TTGTATTTTGATACAGACAGTGG - Intronic
1190125949 X:47705657-47705679 TTGCATTTACATTTAGAGGGAGG - Intergenic
1190168663 X:48094074-48094096 TTGTATTTTAGTAGAGATGGGGG - Intergenic
1190170475 X:48108250-48108272 TTGTATTTTAGTAGAGACGGGGG + Intergenic
1190692755 X:52925573-52925595 TTGTATTTTAGTAGAGACGGGGG + Intergenic
1191143585 X:57140816-57140838 TAGGATTTCCAAAAAGAGGGAGG + Intergenic
1191878095 X:65816802-65816824 TTGTATTTTTGTAGAGATGGGGG - Intergenic
1192824846 X:74684211-74684233 TTGTATTTTAGTAGAGACGGGGG - Intergenic
1193405345 X:81094174-81094196 TTGTTTTTGTATAAAGAGAGAGG - Intergenic
1196200423 X:112880409-112880431 TTGTATTCACATAAAAAGGGAGG + Intergenic
1197790668 X:130250924-130250946 TTGTATTTTAGTAGAGATGGGGG - Intronic
1197841186 X:130748662-130748684 CAGTAATTTCATAAAGAGTGAGG + Intronic
1198463065 X:136881524-136881546 TTGTATTTTTAAAAAGAGACGGG - Intergenic
1198468871 X:136927863-136927885 TTGTATTTTAGTAGAGACGGGGG + Intergenic
1200759500 Y:7025019-7025041 TTCTTTTTTCAAACAGAGGGTGG + Exonic
1201329383 Y:12801482-12801504 TTGTATCTTCATAAAGACAAAGG + Intronic
1202346130 Y:23929889-23929911 TAGTAGTTTTAAAAAGAGGGAGG + Intergenic
1202524641 Y:25740201-25740223 TAGTAGTTTTAAAAAGAGGGAGG - Intergenic