ID: 916732287

View in Genome Browser
Species Human (GRCh38)
Location 1:167577071-167577093
Sequence TTTATTTGGCAGTGATTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916732287_916732296 29 Left 916732287 1:167577071-167577093 CCTTTTAATCACTGCCAAATAAA No data
Right 916732296 1:167577123-167577145 TTCCCTTTACTTTCATCCCCAGG No data
916732287_916732289 -3 Left 916732287 1:167577071-167577093 CCTTTTAATCACTGCCAAATAAA No data
Right 916732289 1:167577091-167577113 AAAACCCTGTACCCATTAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916732287 Original CRISPR TTTATTTGGCAGTGATTAAA AGG (reversed) Intergenic
No off target data available for this crispr