ID: 916732288

View in Genome Browser
Species Human (GRCh38)
Location 1:167577085-167577107
Sequence AATGGGTACAGGGTTTTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916732288_916732296 15 Left 916732288 1:167577085-167577107 CCAAATAAAACCCTGTACCCATT No data
Right 916732296 1:167577123-167577145 TTCCCTTTACTTTCATCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916732288 Original CRISPR AATGGGTACAGGGTTTTATT TGG (reversed) Intergenic