ID: 916732292

View in Genome Browser
Species Human (GRCh38)
Location 1:167577102-167577124
Sequence AATGGGCACAACCGCTTAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916732292_916732303 28 Left 916732292 1:167577102-167577124 CCCATTAAGCGGTTGTGCCCATT No data
Right 916732303 1:167577153-167577175 TCACCTGCTTTCTGTTTCCATGG No data
916732292_916732296 -2 Left 916732292 1:167577102-167577124 CCCATTAAGCGGTTGTGCCCATT No data
Right 916732296 1:167577123-167577145 TTCCCTTTACTTTCATCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916732292 Original CRISPR AATGGGCACAACCGCTTAAT GGG (reversed) Intergenic
No off target data available for this crispr