ID: 916732293

View in Genome Browser
Species Human (GRCh38)
Location 1:167577103-167577125
Sequence GAATGGGCACAACCGCTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916732293_916732296 -3 Left 916732293 1:167577103-167577125 CCATTAAGCGGTTGTGCCCATTC No data
Right 916732296 1:167577123-167577145 TTCCCTTTACTTTCATCCCCAGG No data
916732293_916732303 27 Left 916732293 1:167577103-167577125 CCATTAAGCGGTTGTGCCCATTC No data
Right 916732303 1:167577153-167577175 TCACCTGCTTTCTGTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916732293 Original CRISPR GAATGGGCACAACCGCTTAA TGG (reversed) Intergenic
No off target data available for this crispr