ID: 916732294

View in Genome Browser
Species Human (GRCh38)
Location 1:167577119-167577141
Sequence GGGATGAAAGTAAAGGGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916732294_916732303 11 Left 916732294 1:167577119-167577141 CCCATTCCCTTTACTTTCATCCC No data
Right 916732303 1:167577153-167577175 TCACCTGCTTTCTGTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916732294 Original CRISPR GGGATGAAAGTAAAGGGAAT GGG (reversed) Intergenic
No off target data available for this crispr