ID: 916732295

View in Genome Browser
Species Human (GRCh38)
Location 1:167577120-167577142
Sequence GGGGATGAAAGTAAAGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916732295_916732303 10 Left 916732295 1:167577120-167577142 CCATTCCCTTTACTTTCATCCCC No data
Right 916732303 1:167577153-167577175 TCACCTGCTTTCTGTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916732295 Original CRISPR GGGGATGAAAGTAAAGGGAA TGG (reversed) Intergenic
No off target data available for this crispr