ID: 916732296

View in Genome Browser
Species Human (GRCh38)
Location 1:167577123-167577145
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916732287_916732296 29 Left 916732287 1:167577071-167577093 CCTTTTAATCACTGCCAAATAAA No data
Right 916732296 1:167577123-167577145 TTCCCTTTACTTTCATCCCCAGG No data
916732292_916732296 -2 Left 916732292 1:167577102-167577124 CCCATTAAGCGGTTGTGCCCATT No data
Right 916732296 1:167577123-167577145 TTCCCTTTACTTTCATCCCCAGG No data
916732290_916732296 5 Left 916732290 1:167577095-167577117 CCCTGTACCCATTAAGCGGTTGT No data
Right 916732296 1:167577123-167577145 TTCCCTTTACTTTCATCCCCAGG No data
916732288_916732296 15 Left 916732288 1:167577085-167577107 CCAAATAAAACCCTGTACCCATT No data
Right 916732296 1:167577123-167577145 TTCCCTTTACTTTCATCCCCAGG No data
916732291_916732296 4 Left 916732291 1:167577096-167577118 CCTGTACCCATTAAGCGGTTGTG No data
Right 916732296 1:167577123-167577145 TTCCCTTTACTTTCATCCCCAGG No data
916732293_916732296 -3 Left 916732293 1:167577103-167577125 CCATTAAGCGGTTGTGCCCATTC No data
Right 916732296 1:167577123-167577145 TTCCCTTTACTTTCATCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type