ID: 916732297

View in Genome Browser
Species Human (GRCh38)
Location 1:167577125-167577147
Sequence CTCCTGGGGATGAAAGTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916732297_916732303 5 Left 916732297 1:167577125-167577147 CCCTTTACTTTCATCCCCAGGAG No data
Right 916732303 1:167577153-167577175 TCACCTGCTTTCTGTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916732297 Original CRISPR CTCCTGGGGATGAAAGTAAA GGG (reversed) Intergenic
No off target data available for this crispr