ID: 916732298

View in Genome Browser
Species Human (GRCh38)
Location 1:167577126-167577148
Sequence TCTCCTGGGGATGAAAGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916732298_916732303 4 Left 916732298 1:167577126-167577148 CCTTTACTTTCATCCCCAGGAGA No data
Right 916732303 1:167577153-167577175 TCACCTGCTTTCTGTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916732298 Original CRISPR TCTCCTGGGGATGAAAGTAA AGG (reversed) Intergenic