ID: 916732299

View in Genome Browser
Species Human (GRCh38)
Location 1:167577139-167577161
Sequence AGCAGGTGAGTGGTCTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916732299_916732303 -9 Left 916732299 1:167577139-167577161 CCCCAGGAGACCACTCACCTGCT No data
Right 916732303 1:167577153-167577175 TCACCTGCTTTCTGTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916732299 Original CRISPR AGCAGGTGAGTGGTCTCCTG GGG (reversed) Intergenic