ID: 916732300

View in Genome Browser
Species Human (GRCh38)
Location 1:167577140-167577162
Sequence AAGCAGGTGAGTGGTCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916732300_916732303 -10 Left 916732300 1:167577140-167577162 CCCAGGAGACCACTCACCTGCTT No data
Right 916732303 1:167577153-167577175 TCACCTGCTTTCTGTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916732300 Original CRISPR AAGCAGGTGAGTGGTCTCCT GGG (reversed) Intergenic
No off target data available for this crispr