ID: 916732303

View in Genome Browser
Species Human (GRCh38)
Location 1:167577153-167577175
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916732294_916732303 11 Left 916732294 1:167577119-167577141 CCCATTCCCTTTACTTTCATCCC No data
Right 916732303 1:167577153-167577175 TCACCTGCTTTCTGTTTCCATGG No data
916732297_916732303 5 Left 916732297 1:167577125-167577147 CCCTTTACTTTCATCCCCAGGAG No data
Right 916732303 1:167577153-167577175 TCACCTGCTTTCTGTTTCCATGG No data
916732300_916732303 -10 Left 916732300 1:167577140-167577162 CCCAGGAGACCACTCACCTGCTT No data
Right 916732303 1:167577153-167577175 TCACCTGCTTTCTGTTTCCATGG No data
916732298_916732303 4 Left 916732298 1:167577126-167577148 CCTTTACTTTCATCCCCAGGAGA No data
Right 916732303 1:167577153-167577175 TCACCTGCTTTCTGTTTCCATGG No data
916732299_916732303 -9 Left 916732299 1:167577139-167577161 CCCCAGGAGACCACTCACCTGCT No data
Right 916732303 1:167577153-167577175 TCACCTGCTTTCTGTTTCCATGG No data
916732295_916732303 10 Left 916732295 1:167577120-167577142 CCATTCCCTTTACTTTCATCCCC No data
Right 916732303 1:167577153-167577175 TCACCTGCTTTCTGTTTCCATGG No data
916732292_916732303 28 Left 916732292 1:167577102-167577124 CCCATTAAGCGGTTGTGCCCATT No data
Right 916732303 1:167577153-167577175 TCACCTGCTTTCTGTTTCCATGG No data
916732293_916732303 27 Left 916732293 1:167577103-167577125 CCATTAAGCGGTTGTGCCCATTC No data
Right 916732303 1:167577153-167577175 TCACCTGCTTTCTGTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type