ID: 916735669

View in Genome Browser
Species Human (GRCh38)
Location 1:167605032-167605054
Sequence GTGGAGGCCTAGAGTAATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916735664_916735669 14 Left 916735664 1:167604995-167605017 CCTAAGGCCACAGGGCTTAGGCT No data
Right 916735669 1:167605032-167605054 GTGGAGGCCTAGAGTAATGTTGG No data
916735658_916735669 30 Left 916735658 1:167604979-167605001 CCAAGGACTTATCGGCCCTAAGG No data
Right 916735669 1:167605032-167605054 GTGGAGGCCTAGAGTAATGTTGG No data
916735663_916735669 15 Left 916735663 1:167604994-167605016 CCCTAAGGCCACAGGGCTTAGGC No data
Right 916735669 1:167605032-167605054 GTGGAGGCCTAGAGTAATGTTGG No data
916735666_916735669 7 Left 916735666 1:167605002-167605024 CCACAGGGCTTAGGCTTTGGTGA No data
Right 916735669 1:167605032-167605054 GTGGAGGCCTAGAGTAATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916735669 Original CRISPR GTGGAGGCCTAGAGTAATGT TGG Intergenic
No off target data available for this crispr