ID: 916736447

View in Genome Browser
Species Human (GRCh38)
Location 1:167611392-167611414
Sequence GAGATAGATGAGGCAGAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916736447_916736450 -1 Left 916736447 1:167611392-167611414 CCCAATTCTGCCTCATCTATCTC No data
Right 916736450 1:167611414-167611436 CTTTAACGATTTTTCACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916736447 Original CRISPR GAGATAGATGAGGCAGAATT GGG (reversed) Intergenic