ID: 916736448

View in Genome Browser
Species Human (GRCh38)
Location 1:167611393-167611415
Sequence AGAGATAGATGAGGCAGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916736448_916736450 -2 Left 916736448 1:167611393-167611415 CCAATTCTGCCTCATCTATCTCT No data
Right 916736450 1:167611414-167611436 CTTTAACGATTTTTCACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916736448 Original CRISPR AGAGATAGATGAGGCAGAAT TGG (reversed) Intergenic