ID: 916736450

View in Genome Browser
Species Human (GRCh38)
Location 1:167611414-167611436
Sequence CTTTAACGATTTTTCACCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916736446_916736450 25 Left 916736446 1:167611366-167611388 CCAGTTTCAACAACTATCAATGC No data
Right 916736450 1:167611414-167611436 CTTTAACGATTTTTCACCCCTGG No data
916736445_916736450 26 Left 916736445 1:167611365-167611387 CCCAGTTTCAACAACTATCAATG No data
Right 916736450 1:167611414-167611436 CTTTAACGATTTTTCACCCCTGG No data
916736448_916736450 -2 Left 916736448 1:167611393-167611415 CCAATTCTGCCTCATCTATCTCT No data
Right 916736450 1:167611414-167611436 CTTTAACGATTTTTCACCCCTGG No data
916736447_916736450 -1 Left 916736447 1:167611392-167611414 CCCAATTCTGCCTCATCTATCTC No data
Right 916736450 1:167611414-167611436 CTTTAACGATTTTTCACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916736450 Original CRISPR CTTTAACGATTTTTCACCCC TGG Intergenic