ID: 916738597

View in Genome Browser
Species Human (GRCh38)
Location 1:167629602-167629624
Sequence ACTCGTATACAGAAGATAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 146}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916738590_916738597 7 Left 916738590 1:167629572-167629594 CCTGATTTTCCTCCTCCTCCTCC 0: 2
1: 7
2: 113
3: 1258
4: 7458
Right 916738597 1:167629602-167629624 ACTCGTATACAGAAGATAGATGG 0: 1
1: 0
2: 0
3: 7
4: 146
916738592_916738597 -5 Left 916738592 1:167629584-167629606 CCTCCTCCTCCTCCTTCTACTCG 0: 1
1: 3
2: 350
3: 4564
4: 12189
Right 916738597 1:167629602-167629624 ACTCGTATACAGAAGATAGATGG 0: 1
1: 0
2: 0
3: 7
4: 146
916738593_916738597 -8 Left 916738593 1:167629587-167629609 CCTCCTCCTCCTTCTACTCGTAT 0: 1
1: 0
2: 5
3: 166
4: 2104
Right 916738597 1:167629602-167629624 ACTCGTATACAGAAGATAGATGG 0: 1
1: 0
2: 0
3: 7
4: 146
916738591_916738597 -2 Left 916738591 1:167629581-167629603 CCTCCTCCTCCTCCTCCTTCTAC 0: 4
1: 502
2: 4159
3: 9892
4: 18741
Right 916738597 1:167629602-167629624 ACTCGTATACAGAAGATAGATGG 0: 1
1: 0
2: 0
3: 7
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916738597 Original CRISPR ACTCGTATACAGAAGATAGA TGG Intergenic
901115508 1:6840716-6840738 CCTGGGATGCAGAAGATAGATGG + Intronic
906173619 1:43749413-43749435 ACTTGGATCCAGAAGATATAAGG + Intronic
907664081 1:56418726-56418748 GATGGTATACAGAAGAGAGATGG - Intergenic
912123977 1:106510316-106510338 ACTTGCATACAGAAGATTGGGGG - Intergenic
916738597 1:167629602-167629624 ACTCGTATACAGAAGATAGATGG + Intergenic
917400543 1:174644373-174644395 ACTAGGATACAGAAGAGAAAGGG + Intronic
917609775 1:176675840-176675862 ACTTGTATTTAGAAGATATACGG + Intronic
918642896 1:186864691-186864713 ACTGGTATCCAGAATATATAAGG - Intronic
919283597 1:195523538-195523560 ACTAGTATTCAGAATATATAAGG + Intergenic
921720766 1:218468437-218468459 ACTTATATACAGAAAATAAAAGG - Intergenic
922273611 1:224056659-224056681 ACTCATATACAGATGGTGGAAGG - Intergenic
1066358967 10:34712213-34712235 ACTGGTAGACAGAAAACAGAAGG + Intronic
1068637146 10:59360406-59360428 TCTTGTATCCAGAACATAGAGGG + Intronic
1070092983 10:73307450-73307472 TCTTGTAGACAGCAGATAGATGG - Intronic
1071208974 10:83316278-83316300 ACTAGTATCCAGAATATACAAGG - Intergenic
1072021129 10:91402967-91402989 ACTCCATTACAGAAGACAGAAGG + Intergenic
1074663266 10:115688691-115688713 ACTAATATACAGAATATATAAGG - Intronic
1075479399 10:122767146-122767168 AAAGGTATACAGAACATAGAAGG + Intergenic
1076983260 11:216718-216740 GCTGGAATACAGAAGACAGAGGG + Exonic
1080926511 11:36762309-36762331 ACTCATATCCAGAATATATAAGG - Intergenic
1081539561 11:44021497-44021519 ACTAATATACAGAAGCTACAAGG - Intergenic
1081555077 11:44151637-44151659 ATTCATATACAAAACATAGAAGG - Intronic
1082219416 11:49615952-49615974 AATCATATTTAGAAGATAGAAGG - Intergenic
1085839620 11:79996567-79996589 ACGGGAATACAGAAGACAGAGGG - Intergenic
1087264671 11:96047071-96047093 ACATGTAAAAAGAAGATAGAAGG - Intronic
1087434161 11:98091406-98091428 ACTAGTATACAGCAGTAAGAAGG - Intergenic
1092102155 12:5893352-5893374 ACTAGTATCCAGAATCTAGAAGG + Intronic
1099034594 12:77570168-77570190 ACTGTCATACAGAAAATAGAAGG - Intergenic
1099455559 12:82858461-82858483 ACTTGTATCCAAAAGATAGGCGG - Intronic
1106623408 13:31393683-31393705 TCTCGTATACAAAAGTGAGATGG - Intergenic
1106828475 13:33551527-33551549 TCTTGTAGACAGAAGATAGTTGG - Intergenic
1109618847 13:64873663-64873685 ACTAGTATCCAGAATATAAAAGG + Intergenic
1112060050 13:95729882-95729904 ACTAATATACAGAATATACAAGG - Intronic
1113490868 13:110690687-110690709 ACTCGTAGGCAGGAGACAGAGGG + Intronic
1113946459 13:114047177-114047199 ACTCGTATCCAGAATATACAGGG + Intronic
1114342505 14:21759942-21759964 ATACATATACAGAAGATACAAGG + Intergenic
1114550534 14:23530350-23530372 ACACCCACACAGAAGATAGAGGG + Intronic
1115713219 14:36073182-36073204 ACTCCTATGCAGAAGGTAGAAGG - Intergenic
1115762099 14:36584787-36584809 AATCTGATACAGAAGATAGTAGG + Intergenic
1116142628 14:41018414-41018436 ACTTTTATCCAGAAGTTAGAAGG - Intergenic
1120076433 14:80164106-80164128 AATTGTTTCCAGAAGATAGATGG + Intergenic
1122656346 14:103262591-103262613 ACTAATATCCAGAAGATACAAGG - Intergenic
1127273790 15:57424459-57424481 ACTCTTCTACAGCAGTTAGATGG - Intronic
1129089382 15:73132647-73132669 ACTAATATCCAGAAGCTAGAAGG + Intronic
1132038112 15:98503198-98503220 ACTCGTCTGCAGCAGAAAGAAGG + Intronic
1132923095 16:2410168-2410190 ACTCATCTACAGAACCTAGAAGG - Intergenic
1138637631 16:58354179-58354201 ACTAATATCCAGAATATAGAAGG - Intronic
1138703980 16:58895134-58895156 ACTCCTATGCAGAAGAGAGGAGG - Intergenic
1138755740 16:59482293-59482315 ACTCATATCCAGAATATACAAGG - Intergenic
1139062209 16:63265813-63265835 ACTCTTAAACAGAACAAAGAAGG - Intergenic
1140562263 16:75997165-75997187 GCTCGTGAACAGCAGATAGAGGG + Intergenic
1143292992 17:5846715-5846737 AGTGGAATACAGAAGACAGAAGG - Intronic
1143710035 17:8728072-8728094 AATAGTAAATAGAAGATAGATGG - Intergenic
1144097228 17:11910921-11910943 ACTTGTATACAGAATTTATAAGG - Intronic
1146117869 17:30158345-30158367 ACTAATATCCAGAATATAGAAGG - Intronic
1157267370 18:46238337-46238359 ACTTGGATACAGAAGATATAAGG - Intronic
1158239250 18:55358654-55358676 ACAAGTTTACAGAAGATAGCGGG - Intronic
1159191950 18:65057604-65057626 ACTCGTCTAGATAAGACAGAGGG - Intergenic
1159291678 18:66431305-66431327 TCTAGTATACAGAATATATAAGG + Intergenic
1159667106 18:71174981-71175003 ACTCCTATGCAGAGGATAGTGGG - Intergenic
1166164222 19:40975827-40975849 ACTCCAGTACAGAAGATGGAAGG - Intergenic
1166186611 19:41143542-41143564 ACTCCAGTACAGAAGATGGAAGG + Intergenic
1166422186 19:42646061-42646083 CCTCCTATACAGAAGAGAAACGG - Intronic
1167453088 19:49583748-49583770 ACAGGTATAGAGAAGAGAGAGGG - Intronic
926497533 2:13609441-13609463 ACTTGTATCCAAAACATAGAAGG + Intergenic
926817715 2:16816347-16816369 ACTAATATAGAGAAGAGAGATGG - Intergenic
929649805 2:43666830-43666852 ACTTGTATCCAGAATATATAAGG - Intronic
931841112 2:66149771-66149793 ACTAGTATCCAGAATATATAAGG - Intergenic
933904844 2:86881584-86881606 ACTAGTATCCAGAATATATAAGG + Intergenic
936367385 2:111870579-111870601 ACTAGTATCCAGAATATATAAGG - Intronic
936766436 2:115854645-115854667 ACTCATATCCAGAATATACAAGG - Intergenic
937144649 2:119633467-119633489 ACTTGTATCCAGAATATATAAGG + Intronic
938742456 2:134245668-134245690 ACAGGTATAAAGAAGACAGATGG - Intronic
938821165 2:134961701-134961723 GCTCGTATGAAGAAGAAAGACGG + Intergenic
939058302 2:137389450-137389472 ACTAATATCCAGAATATAGAAGG - Intronic
946918680 2:224554272-224554294 TCTCGTTTTCAGAAGATGGATGG + Intronic
947339618 2:229123889-229123911 ACTTGTATCCAGAATATATAAGG - Intronic
1170177758 20:13491455-13491477 ACTCGTGTACTCAAGATACAGGG - Intronic
1170413380 20:16114331-16114353 AATACTATACAGAAGATACAGGG - Intergenic
1170456095 20:16534399-16534421 ACTCATATCCAGAATATACAAGG - Intronic
1171509110 20:25665644-25665666 ACTAATATACAGAATATACAAGG - Intergenic
1182648728 22:31832797-31832819 ACTTGCATCCAGAAGATATAGGG - Intronic
1185078076 22:48693947-48693969 AATCGTCTACAGAAGACAGGAGG - Intronic
949848289 3:8394398-8394420 ACTAGTATACAGAATCTACAAGG + Intergenic
950489356 3:13294140-13294162 GCTCATATACAGAAGGTGGAGGG + Intergenic
951805552 3:26640214-26640236 ACTCGTAAAAAGAATATAGTGGG - Intronic
953095711 3:39773897-39773919 AATCGAAGACAGAAGATAAAAGG + Intergenic
953991876 3:47490118-47490140 ACTTGTATCCAGAATATGGAAGG - Intergenic
954469593 3:50680849-50680871 ACTAATATACAGAATATACAAGG - Intronic
954860502 3:53684765-53684787 AACCATACACAGAAGATAGAAGG + Intronic
957923937 3:86783571-86783593 ACACTTATACAGAATATAGTGGG + Intergenic
961192943 3:124977448-124977470 ACTTGTATCTAGAATATAGAAGG - Intronic
963602223 3:147388603-147388625 ACTTGTATACACAAGAAAAAAGG + Exonic
966236009 3:177702338-177702360 GCTCATAGACAGAAGATAGTGGG - Intergenic
967726612 3:192868232-192868254 AGTCATATCCAAAAGATAGAAGG + Intronic
971755841 4:30707174-30707196 ACTAGTATCCAGAATATAAAAGG - Intergenic
974640297 4:64621733-64621755 ATTTGTATACAGAATATATAAGG - Intergenic
976329600 4:83814093-83814115 ACTCCTTTCCAGAAGACAGATGG + Intergenic
977285411 4:95099895-95099917 ACTCTTATACAGACGAGAGATGG - Intronic
978912068 4:114075856-114075878 ACTAATATACAGAATATATAGGG + Intergenic
980757296 4:137181944-137181966 ATTTGAATACAGAAGATTGAAGG - Intergenic
982439453 4:155418247-155418269 ACTCATATCCAGAATATACAAGG - Intergenic
986030965 5:3892205-3892227 ACTCGAATACAGAAGACAATGGG + Intergenic
987832296 5:23110689-23110711 ACTAATATACAGAATATACAAGG + Intergenic
990704150 5:58508887-58508909 ACTAGTATACAGAATCTACAAGG + Intergenic
990745125 5:58951229-58951251 ACTAGTATCCAGAATATACAAGG + Intergenic
994064763 5:95526367-95526389 ACTAATATACAGAAAATACAGGG - Intronic
997058442 5:130472363-130472385 ACTAGTATCCAGAAGCTACAAGG - Intergenic
998715388 5:144878041-144878063 ACAGGTATAGAGAAGATATAAGG - Intergenic
999554994 5:152730500-152730522 AGTGGCATACAGAAAATAGAAGG - Intergenic
1004961650 6:20797138-20797160 ACTTGTATCCAGAATATATAAGG + Intronic
1010306505 6:74329529-74329551 ACTAATATACAGAATATACAAGG - Intergenic
1012558485 6:100547465-100547487 ACTTGTATCCAGAATATATAAGG + Intronic
1012679361 6:102159725-102159747 ATTCGTAACCAGAAGATATAAGG + Intergenic
1012826157 6:104149813-104149835 ACTAATATCCAGAAGATACAAGG - Intergenic
1015259156 6:131215084-131215106 ACTGTAATACAGATGATAGATGG + Intronic
1016735471 6:147474061-147474083 ACTAATATACAGAATATACAAGG + Intergenic
1018134784 6:160768524-160768546 ACTAGTATCCAGAATATACAAGG + Intergenic
1019638988 7:2092671-2092693 ACTGGTATCCAGAATATATAAGG - Intronic
1023678761 7:42661012-42661034 ACTTGTATCCAGAATATATAAGG + Intergenic
1027472155 7:78586762-78586784 ATTCATAGACAGAATATAGAAGG - Intronic
1027838197 7:83273494-83273516 ACTAGTATCCAGAATCTAGAAGG - Intergenic
1028140646 7:87271190-87271212 ACTAATATACAGAATATACAAGG - Intergenic
1029324935 7:99798057-99798079 ACTTGTAGACAGAATATAGTTGG - Intergenic
1030255204 7:107502888-107502910 ACTAGTATTCAGAAGCTACAGGG - Intronic
1030713476 7:112782003-112782025 GCTCGTATCCAGAATATATAAGG + Intronic
1031649440 7:124268741-124268763 ACTTGTATACAGTATATATAAGG - Intergenic
1031811230 7:126371745-126371767 AGTCATATGCAGAAGATTGAAGG + Intergenic
1035950098 8:4010536-4010558 ACTGGTAGTGAGAAGATAGAGGG - Intronic
1038236063 8:25757076-25757098 ACTTGTATCCAGAATATATAAGG + Intergenic
1038726970 8:30090276-30090298 ACTTGAATCCAGAAGACAGATGG + Intergenic
1039976141 8:42366681-42366703 ATTTGGATACAGAAGATAGAGGG + Intronic
1040858154 8:51971538-51971560 ACTAGTATCCAGAAGCTACAAGG - Intergenic
1041452762 8:58024930-58024952 ATAAGTCTACAGAAGATAGAAGG - Intronic
1041824638 8:62080206-62080228 AGTGCTATACAGAAGATTGATGG + Intergenic
1041863698 8:62543650-62543672 ACTCATATAAAGCAGATAAAAGG - Intronic
1042725518 8:71870947-71870969 ACTAATATACAGAATATACAAGG - Intronic
1042995926 8:74698619-74698641 ACTAATATACAGAATATACAAGG + Intronic
1045056875 8:98376301-98376323 ACTTGTATCCAGAATATAGAAGG - Intergenic
1047924331 8:129668247-129668269 ATTTGTATTCAGAATATAGAAGG + Intergenic
1052101119 9:24447300-24447322 TGTCCTATACAGAAGACAGATGG - Intergenic
1055834456 9:80421773-80421795 AGTGGAATTCAGAAGATAGAGGG - Intergenic
1056770933 9:89477908-89477930 ACTCGCATAAAAAAGATAGAAGG + Intronic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1057333726 9:94140469-94140491 ATTTGTATGCAGAAAATAGAGGG + Intergenic
1191943964 X:66510091-66510113 AGTCATATGCAGAAGATTGAAGG - Intergenic
1191964026 X:66736553-66736575 AGTCATATCCAGAATATAGAAGG - Intergenic
1193324453 X:80163239-80163261 ACTATTATACAGAATATACAAGG + Intergenic
1194347287 X:92781978-92782000 ACTAGTATCCAGAATCTAGAAGG + Intergenic
1194681619 X:96861147-96861169 ACTTGTCTCCATAAGATAGAAGG + Intronic
1195473027 X:105254753-105254775 AGTCATATGCAGAAGATTGAAGG - Intronic
1196912392 X:120497443-120497465 ACACGCATACAAAAGAGAGAGGG - Intergenic
1198867150 X:141135722-141135744 ACTCGTATGCAGAAGTTTAATGG + Intergenic
1200041164 X:153370664-153370686 TCTCGTAACTAGAAGATAGAAGG - Intergenic