ID: 916738884

View in Genome Browser
Species Human (GRCh38)
Location 1:167631080-167631102
Sequence CTGTGTGTATGGAGGTATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 5, 3: 13, 4: 235}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916738879_916738884 -8 Left 916738879 1:167631065-167631087 CCCTTGCCTCTGAAGCTGTGTGT 0: 1
1: 0
2: 3
3: 39
4: 319
Right 916738884 1:167631080-167631102 CTGTGTGTATGGAGGTATGCTGG 0: 1
1: 0
2: 5
3: 13
4: 235
916738880_916738884 -9 Left 916738880 1:167631066-167631088 CCTTGCCTCTGAAGCTGTGTGTA 0: 1
1: 0
2: 2
3: 16
4: 228
Right 916738884 1:167631080-167631102 CTGTGTGTATGGAGGTATGCTGG 0: 1
1: 0
2: 5
3: 13
4: 235
916738877_916738884 2 Left 916738877 1:167631055-167631077 CCCTTGGACACCCTTGCCTCTGA 0: 1
1: 1
2: 1
3: 13
4: 240
Right 916738884 1:167631080-167631102 CTGTGTGTATGGAGGTATGCTGG 0: 1
1: 0
2: 5
3: 13
4: 235
916738878_916738884 1 Left 916738878 1:167631056-167631078 CCTTGGACACCCTTGCCTCTGAA 0: 1
1: 0
2: 2
3: 20
4: 273
Right 916738884 1:167631080-167631102 CTGTGTGTATGGAGGTATGCTGG 0: 1
1: 0
2: 5
3: 13
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916738884 Original CRISPR CTGTGTGTATGGAGGTATGC TGG Intronic
900132736 1:1094910-1094932 CTTTGTGTATGGTGAAATGCAGG + Intronic
900330622 1:2132807-2132829 GTGTGTGTATGGTGGGAAGCGGG + Intronic
900646618 1:3711748-3711770 CTTTCTGTCTGGAGGAATGCTGG - Intronic
903749965 1:25615771-25615793 CTGAGTGTCTGTGGGTATGCGGG + Intergenic
904687685 1:32272758-32272780 CTGTGTGTGTGGGGGTGTGTGGG + Intronic
905778144 1:40683944-40683966 CTCTATGAATGAAGGTATGCTGG - Intergenic
906190240 1:43894248-43894270 CTGGGTGGAGGGGGGTATGCCGG + Intronic
906561854 1:46764107-46764129 CTCTGTCTATGGATGTATGCAGG - Intronic
908263740 1:62358868-62358890 CTGTGTGTCTGGTGGTTGGCAGG + Intergenic
908682984 1:66682779-66682801 ATGTGTGTATGTAGGCAAGCAGG + Intronic
909568751 1:77084460-77084482 CTCTCTGCAAGGAGGTATGCTGG + Intergenic
910490227 1:87761140-87761162 CTGTGTGCATGGGGGAAAGCAGG - Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
913610527 1:120505711-120505733 CTGTGGGTTTGGAGTTAAGCTGG + Intergenic
914580663 1:149016528-149016550 CTGTGGGTTTGGAGTTAAGCTGG - Exonic
915735305 1:158080864-158080886 CTGTGGGTAAGCAGGTACGCAGG - Intronic
916738884 1:167631080-167631102 CTGTGTGTATGGAGGTATGCTGG + Intronic
917772426 1:178294293-178294315 GTTTGTGTATGGAAGTATGTGGG - Intronic
919930092 1:202215474-202215496 TTCTGTGTGTGGAGGTATGTGGG - Intronic
920287355 1:204890218-204890240 CTGCGTGAATGGATGGATGCAGG - Intronic
922618752 1:226978200-226978222 GGGTGTGTAAGGAGGTGTGCAGG - Intronic
922618765 1:226978276-226978298 GGGTGTGTAAGGAGGTGTGCGGG - Intronic
922618873 1:226978732-226978754 GGGTGTGTAAGGAGGTGTGCAGG - Intronic
922618879 1:226978763-226978785 GGGTGTGTACGGAGGTATGCGGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923409783 1:233695554-233695576 GTGTGTGTATGGAGGTAGGCTGG - Intergenic
923786066 1:237070709-237070731 CTGTGTGTAGCCAGGCATGCTGG + Intronic
924286978 1:242497476-242497498 GTGTGTGTATGGAGGCAGGTGGG + Intronic
924659145 1:246000607-246000629 CTGTGTGTATGGTGGTGTCCAGG - Intronic
1062984303 10:1753248-1753270 TTGTGTGTTTGGAGGCATGGGGG + Intergenic
1063074206 10:2698831-2698853 ATGTGTGTCTGGAGATATCCTGG - Intergenic
1063221124 10:3969000-3969022 CCGTGTGTTAGGTGGTATGCTGG - Intergenic
1065962318 10:30743716-30743738 CTGTGTGCATGCATGTGTGCTGG - Intergenic
1067824228 10:49558323-49558345 CTGTGTGGAGTGAGGTAAGCTGG + Intergenic
1069319167 10:67146089-67146111 GTGTGTGTGTGGAGGGGTGCTGG - Intronic
1074288811 10:112122851-112122873 CTGTGTCTAAGGAGGTAGGAAGG + Intergenic
1076461334 10:130649472-130649494 CTGGGTGGATGGAGGTATCATGG - Intergenic
1076777034 10:132703647-132703669 GTGTGTGTGTGGGGGTGTGCGGG - Intronic
1077819797 11:5726132-5726154 TTGTGTGTATGTATGTATTCAGG + Intronic
1078085544 11:8231257-8231279 CTGTGTGTATGTTGGGAAGCTGG - Intronic
1078341450 11:10500381-10500403 CTGTGTGTTTTGAGGTGTGTGGG - Intronic
1081585141 11:44379122-44379144 CTGTGTGTGTCTGGGTATGCAGG - Intergenic
1082908685 11:58344196-58344218 CAGTGTGAATGGAGGCATTCAGG + Intergenic
1082913375 11:58402935-58402957 CAGTGTGGATGGAGGCATTCAGG + Exonic
1083861626 11:65423124-65423146 CTGTGTGGAAGGAGGAAGGCAGG + Intergenic
1084073421 11:66753205-66753227 GTGTGTGTATGCAGGCAAGCAGG + Intronic
1084564051 11:69919702-69919724 CTGTGTGTATGCATGTGTGGTGG - Intergenic
1084908690 11:72369763-72369785 CTGTGTGTGTGTATGTATGTGGG + Intronic
1084932060 11:72563985-72564007 CTGTGTGTGTGATGGTAAGCAGG + Intergenic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1087401350 11:97670348-97670370 CTGTGTGTGTGCATGTATGTAGG - Intergenic
1087843688 11:102946901-102946923 CTGTGTGTATGTAGAGATGGAGG + Intronic
1088078595 11:105881718-105881740 GTGTGTGTATGTGTGTATGCAGG - Intronic
1090641887 11:128736835-128736857 CTGTGTGTATGCAGGTGTGTGGG + Intronic
1092073860 12:5656800-5656822 CTCTATGTAAGGAGGCATGCAGG + Intronic
1093167366 12:15820030-15820052 CTGTGTGTATGCATGCATGAAGG - Intronic
1093472275 12:19515279-19515301 CTGTGCTTATGAAGGTATGTGGG + Intronic
1095330003 12:40948941-40948963 GTGTGTGTTTGCAGGTATGTGGG + Intronic
1096067900 12:48755648-48755670 GTGTGTGCTTGGAGGTGTGCTGG - Intergenic
1096124169 12:49107503-49107525 CAGTGTGCATGGAGGTAGGAGGG - Intronic
1097272261 12:57783284-57783306 GTGTGTGTGTGGAGGGGTGCAGG + Intronic
1098366266 12:69706428-69706450 CTGTGAGGAGGGAGGTGTGCAGG - Intergenic
1100614626 12:96221454-96221476 CGGTGGGTTTGGAGGTCTGCAGG - Intronic
1101395933 12:104347595-104347617 CTGTGTGCAAGGAGATGTGCTGG + Intronic
1102708486 12:114903969-114903991 CTGTGTGTATGAAAGTGTGTAGG + Intergenic
1105638179 13:22236370-22236392 GTGTGTGTATGCATGTGTGCAGG + Intergenic
1105707749 13:22978892-22978914 CTGTGTGACTGAAGGTATCCAGG + Intergenic
1107703295 13:43072056-43072078 CTGTGAGTATGCAGGAATGCGGG - Intronic
1108163049 13:47662796-47662818 ATGTGTGTATGTATGTATGTAGG - Intergenic
1112883485 13:104138050-104138072 GTGTGTGTGTGGTGGTATGGGGG + Intergenic
1113078830 13:106494843-106494865 CTGTGTGTATGGAGGTCTGTGGG - Intronic
1113192282 13:107762553-107762575 CATTGTGTATGGAGGTAAGGCGG + Intronic
1116284431 14:42953867-42953889 GTGTGTGTATGTATGTATGGAGG + Intergenic
1118562159 14:67097556-67097578 GTGTGTGTGTGCAGGTATGTAGG - Intronic
1119382617 14:74238978-74239000 CAGTGTGTGTGGTGGTAAGCTGG - Intergenic
1120616234 14:86708356-86708378 TTGTGTGTATGCAGATATGGAGG + Intergenic
1120961280 14:90127356-90127378 CTGTGTGTATGGATCTGAGCCGG + Intronic
1121265126 14:92596857-92596879 CTGTGTTTTTGGTGGCATGCTGG + Intronic
1122038205 14:98963681-98963703 CTGTGTGAATTGCTGTATGCAGG - Intergenic
1122842296 14:104472359-104472381 CTGTGTGTGTGGCTGTGTGCAGG - Intergenic
1123055767 14:105568928-105568950 GTGTGTGGATGGGGGTATGTGGG - Intergenic
1123080124 14:105688447-105688469 GTGTGTGGATGGGGGTATGTGGG - Intergenic
1123080172 14:105688701-105688723 GTGTGTGGATGGGGGTATGTGGG - Intergenic
1125592996 15:40866423-40866445 CTGTGTGTATACAGCTAGGCTGG - Intergenic
1125797530 15:42414519-42414541 CTGTGTGTGTGCAAGTGTGCAGG - Exonic
1126903531 15:53339430-53339452 TTGTGTGTATGTAGGCATGAAGG + Intergenic
1127659450 15:61086216-61086238 CTGTGATCATGGACGTATGCAGG - Intronic
1131300841 15:91198501-91198523 GTGTGTGTTTGGAGGTCTCCTGG + Intronic
1131484134 15:92806572-92806594 GTGTATGTATGTAGGTAGGCAGG + Intronic
1132565230 16:619383-619405 CAGTGTGTGTGCAGGTATGGTGG + Intronic
1133523544 16:6581724-6581746 CTGTGTTTATGGAGGTCACCTGG + Intronic
1133878299 16:9756373-9756395 CTGTGTGTATGGAGAACTTCTGG - Intronic
1140355311 16:74300481-74300503 CTGTTTTTATAGAGGTTTGCTGG - Intronic
1140835636 16:78791284-78791306 CTGTGTGTCTGGTGATGTGCTGG + Intronic
1142319672 16:89372963-89372985 CGGGGTGTATGTAGGTAGGCAGG - Intronic
1142721596 17:1779778-1779800 GTGTGTCTCTGGAGGTAAGCAGG + Exonic
1142736768 17:1905884-1905906 CTGTGTGTATGGGGGTGTGCTGG + Intergenic
1143529098 17:7490879-7490901 CAGAGTGTATGGAGGTACGGAGG + Intronic
1145977974 17:28995328-28995350 CTGTGTGTGTGCATGTATGTGGG + Intronic
1146184720 17:30717366-30717388 CTGTGTGTGGGGAGGGTTGCTGG - Intergenic
1146492888 17:33294568-33294590 CTGTGTGGATGTATGTATGTGGG - Intronic
1147302852 17:39543756-39543778 CTGTGAGAAAGGAGGTTTGCAGG - Intronic
1147311030 17:39596373-39596395 CTGTGTGTATGTGTGTATGTGGG + Intergenic
1147453629 17:40521114-40521136 CTGTGTGAATGGAGGGATGCAGG - Intergenic
1147875782 17:43619421-43619443 ATGTGTGTATGGAGGCTTCCTGG - Intergenic
1152001665 17:77649764-77649786 CTGTGTGGTTGGAGGGATGGAGG + Intergenic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1152473719 17:80504106-80504128 ATGTGTGGATGGAGGGATGGTGG + Intergenic
1153561208 18:6373514-6373536 CTGTGTGTAGGGGTGTGTGCAGG - Intronic
1154958915 18:21288314-21288336 CTCTGTGGAGGGAGCTATGCTGG + Intronic
1155728318 18:29118060-29118082 ATGTGTGTATGTATGTATACAGG - Intergenic
1155908709 18:31484206-31484228 ATGTGTGATTGGAGGGATGCTGG - Intergenic
1156463657 18:37335503-37335525 GTGTGTGTGTGGAGGTGTGGGGG + Intronic
1158387047 18:57006897-57006919 ATGTGTGTATGTATGTATACAGG + Intronic
1158679481 18:59554111-59554133 TTCTGTGTAGGGAGGTCTGCAGG + Intronic
1158981641 18:62767734-62767756 ATGTGTGTTTGGAGGCATGGGGG + Intronic
1161764400 19:6198607-6198629 CTGGGTGTATGGGGGTTTGGGGG + Intronic
1162788840 19:13052777-13052799 CTGTGTGTGTGGACGGGTGCAGG - Intronic
1162974063 19:14198327-14198349 CTGTGTGTGGGGAGGGTTGCTGG + Intronic
1163000962 19:14366953-14366975 CTGTATGTCTGGAGGTAGACAGG + Intergenic
1168588434 19:57613707-57613729 CAGTGGCTATGGAGGGATGCTGG - Intergenic
925521004 2:4745931-4745953 CTGTGTGTGTATAGGTATGCAGG - Intergenic
926197600 2:10773139-10773161 CTGTGTGTCAGGAGGGATGAAGG + Intronic
928168585 2:28988795-28988817 CTGTGCCTGTGGAGGCATGCGGG - Intronic
930367752 2:50462583-50462605 ATGTGTGTATGTGGATATGCAGG - Intronic
930409066 2:51000382-51000404 CTGTTTGTATGGATATATTCAGG - Intronic
932969978 2:76528794-76528816 CTGTGTGTATGGGTGGATGCAGG - Intergenic
935715617 2:105936650-105936672 GTGTGTGTATGGATGTTTGTTGG - Intergenic
936708953 2:115108881-115108903 CTGGTTGAATGGAGGTATGGTGG + Intronic
937660062 2:124420450-124420472 CAGTGTGAAGGGAGGTAAGCAGG - Intronic
939168379 2:138664397-138664419 CTGTGTGTATGGAGTTTTTATGG - Intergenic
943745657 2:191460355-191460377 GTGTGTGTGTGGAGGGATGGTGG - Intergenic
944662522 2:201933109-201933131 GTGTGTGTAGGGAGGCATGCGGG + Intergenic
944919596 2:204397809-204397831 TTGTGTGTATGCATGTGTGCAGG + Intergenic
946882658 2:224192038-224192060 CTACGTGTATGGCAGTATGCTGG - Intergenic
1169958272 20:11130194-11130216 ATGTATGCGTGGAGGTATGCTGG - Intergenic
1170748687 20:19124460-19124482 CTGAGAGTATTGAGGAATGCGGG + Intergenic
1173706330 20:45112942-45112964 CTGTGTGTATGTATCTATGTGGG - Intronic
1175323698 20:58107735-58107757 CTGTGTGCATGGAGCTGGGCAGG - Intergenic
1179921775 21:44511318-44511340 GTGTGTGTATGCATGCATGCAGG - Intronic
1180060045 21:45380199-45380221 CTGTGTGCATGGATGGACGCTGG - Intergenic
1182246533 22:28962675-28962697 CTGTATTTGGGGAGGTATGCAGG + Intronic
1182547386 22:31084137-31084159 CTCTGTGCATGGAGGTAGACAGG - Intronic
1183727582 22:39598054-39598076 CTGTGTGTGTGGTGGGTTGCGGG + Intronic
1184516155 22:44964029-44964051 CTGTGTGTTGGGAGGGTTGCTGG + Intronic
1184990628 22:48167034-48167056 CTGTGTGTGTGCATGTATGAAGG - Intergenic
951299295 3:20974731-20974753 CTGTGTGTTTGGGGGTGTGGTGG - Intergenic
952185021 3:30959382-30959404 CTGAGAGTATGCAGATATGCAGG - Intergenic
952942584 3:38455143-38455165 ATGTGTGTTTGGGGGTATGTGGG + Intronic
953095362 3:39769654-39769676 CTGTGGGTATGGATGTTGGCAGG - Intergenic
953922342 3:46960853-46960875 TTGTGGGTATGGAGGTATAAAGG + Intronic
957153416 3:76516286-76516308 GTGTGGGTATGGAGGTAGGATGG - Intronic
957530978 3:81440609-81440631 CTTTGCATATGGAAGTATGCTGG - Intergenic
958862236 3:99457985-99458007 CTGTGGGTGAGGAGGTTTGCAGG + Intergenic
959902505 3:111676006-111676028 CTGTATGTATGTATGTATACAGG + Intronic
960421969 3:117457627-117457649 CAGTGTGTAAGGAGGAATGAAGG + Intergenic
962104782 3:132379324-132379346 CTGTGTCTATGGAGGAAGGTGGG + Intergenic
962533073 3:136301526-136301548 CTGTGTGTGTGGAGGTCCGTGGG + Intronic
963927610 3:150967592-150967614 CTGTGTGGAAGCAGGTATGGGGG - Intronic
965978035 3:174649710-174649732 CTGTGTGTATGTATGTATAAAGG - Intronic
971130274 4:23801246-23801268 CTTTGTGTGTGTATGTATGCAGG - Intronic
972144695 4:36008513-36008535 TTTTGTGTATGGTGGTATGTAGG - Intronic
973966859 4:56171866-56171888 CTGTGTGTTTGGAGCTATAAAGG - Intronic
974751932 4:66153544-66153566 CTGTTAGAATGGTGGTATGCAGG + Intergenic
975031890 4:69630821-69630843 TTGTGTGTATGTGGGTGTGCTGG - Intronic
975459063 4:74629324-74629346 CTGTGTGCATGAAGGAATGAAGG - Intergenic
976133735 4:81912446-81912468 ATGGGTGTAGGGAGGTATGAGGG - Intronic
976490946 4:85669526-85669548 ATGTTTGTATGTAGGTATGTAGG + Intronic
981986059 4:150858089-150858111 CTGTGTGTATGCATTTCTGCTGG + Intronic
982655045 4:158137426-158137448 CTGTCTGTCTGAAGGGATGCTGG - Intronic
984138308 4:175969805-175969827 AAGTGTGTGTGGAGGGATGCAGG + Intronic
986034270 5:3923357-3923379 CTGTGTGTGTTTAGGTGTGCAGG + Intergenic
986719993 5:10554143-10554165 GTGTGTGCATGCAGGTGTGCTGG + Intergenic
986749861 5:10777249-10777271 CTGTGTGCATGCATGTGTGCAGG - Intergenic
987051612 5:14151402-14151424 GTGTGTGTATGTATGTATGTAGG + Intronic
987925112 5:24330843-24330865 CTGTATGTATGTATGTATGTAGG + Intergenic
989807274 5:45624779-45624801 TTGTGTTTATGGAGGCAAGCAGG + Intronic
991040121 5:62166846-62166868 CTGTGTGTGTGGAGGTGGGTGGG - Intergenic
991666006 5:69000605-69000627 CTGTGTTTATGGGGGTAGACTGG - Intergenic
993810543 5:92470713-92470735 GTGTAGGTATGGAGGTATGGAGG + Intergenic
998128754 5:139640661-139640683 CTGTGTGTGGGGAGGAATGAGGG + Intergenic
999269631 5:150289328-150289350 CAGTGTGTATGTAGGGATGAAGG - Intronic
999511785 5:152259838-152259860 CTGTGTGTATTGAGCCAGGCTGG + Intergenic
999859605 5:155631735-155631757 CTGTGTGTGTGGACTCATGCAGG + Intergenic
1000438181 5:161239170-161239192 GTGTGTGTATGTATGTATGTGGG - Intergenic
1000795892 5:165663912-165663934 GTGTGTGTGTGGAGGGGTGCTGG + Intergenic
1001604099 5:172947737-172947759 ATGTGTGTATTGAGGTACACAGG - Intronic
1003076252 6:2985957-2985979 GTGTGTGTATTGAGGTATTGAGG - Intergenic
1004075183 6:12338619-12338641 CTGTGTGCATGAAGGCATGTTGG - Intergenic
1004771292 6:18785553-18785575 CTGTGTGTATGTAGGTATGGGGG - Intergenic
1004819786 6:19354927-19354949 CTGTGTGTATGTTGGTGTGCTGG - Intergenic
1008378815 6:50820421-50820443 GTGTATGTGTGGAGGTATGTAGG + Intronic
1011312014 6:85989808-85989830 CTCTATGTCTGGTGGTATGCTGG + Intergenic
1011412409 6:87079555-87079577 CTGTGTGTATAAAGGGTTGCTGG - Intergenic
1012150384 6:95742757-95742779 CTGGGGTTATGGTGGTATGCTGG + Intergenic
1014568629 6:122981678-122981700 CTGTGTGTGTGCACGTGTGCAGG - Intergenic
1019135844 6:169907198-169907220 GTGTGTGTGTGCAGGTACGCAGG - Intergenic
1019786231 7:2979376-2979398 CTGTGTGCAGGGAGCTATGAAGG + Intronic
1022231593 7:28419109-28419131 CTGTGTGTTTGGTAGTATCCAGG + Intronic
1024100645 7:46029288-46029310 CTGTTAGCATGAAGGTATGCTGG + Intergenic
1024364745 7:48508101-48508123 GTGCGTGTATGGAGGGATGGAGG + Intronic
1027742586 7:82029731-82029753 ATGTATGTATGTATGTATGCAGG + Intronic
1028415872 7:90580103-90580125 CTGTCTGAATTGAGGTTTGCTGG - Intronic
1029423840 7:100484760-100484782 GTGTGTGTCTGGAGGTCTGTGGG + Intronic
1030232732 7:107225032-107225054 CTGTGTGTGTGTATGTATGAGGG + Intronic
1030708582 7:112721796-112721818 GTGTGTGTATGTATGTATGCAGG - Intergenic
1030848675 7:114455691-114455713 TTGTGTGTAAGGAAGTAGGCTGG - Intronic
1030930306 7:115515424-115515446 GTGTGTGTAAGAAGGTATGCAGG - Intergenic
1032417449 7:131747319-131747341 GTGTGTGTATGGAGGGGTGGGGG + Intergenic
1032469073 7:132164939-132164961 CTGTGTCTTTGGAGCTATGATGG + Intronic
1034400532 7:150858748-150858770 CTTGGTGCCTGGAGGTATGCAGG - Exonic
1034480053 7:151312814-151312836 CTGTGTGTATGAATGTGTGGGGG + Intergenic
1034749241 7:153553541-153553563 GTGTGTGTGTGGAGGTAGGGCGG - Intergenic
1034986926 7:155522072-155522094 CTGTGTGTGTGGATGCATGTGGG - Intronic
1036127577 8:6077152-6077174 CTGTGTGCATGTATGAATGCAGG + Intergenic
1037411228 8:18599828-18599850 TTGTGTGCATGGAGGGATGACGG + Intronic
1038634613 8:29275563-29275585 CTTTGTATATGGATGTAGGCTGG - Intergenic
1039370061 8:36975274-36975296 GTGTGTGTGTGTATGTATGCGGG - Intergenic
1040311223 8:46237860-46237882 CTGTGAGAATGCAGGAATGCTGG + Intergenic
1041749504 8:61244731-61244753 ATGTGTGTATGGGGGTATAGGGG + Intronic
1041877495 8:62707042-62707064 GTGTGTGTATGTATGTATGATGG - Intronic
1042706733 8:71671227-71671249 ATGTGTGCATGCAGGTATGTAGG + Intergenic
1047455604 8:125007056-125007078 CTCTGTGTATGAATGTATGAGGG + Intronic
1048033454 8:130654431-130654453 CTGTTTGTAGTGAGGGATGCTGG + Intergenic
1048493728 8:134918402-134918424 CTGTGTGCATGGGTGTGTGCAGG + Intergenic
1048955897 8:139535768-139535790 ATGTATGTATGGAAGTATGATGG - Intergenic
1049178323 8:141207235-141207257 CTGTGTGCATGGAGGAAATCAGG + Intronic
1049586702 8:143435720-143435742 CTGTGTGCCTGGAGGGGTGCCGG - Intergenic
1049638846 8:143705328-143705350 CTGTGTGTAGGGAGGTGCACGGG + Intronic
1049758381 8:144320818-144320840 CTGTGGGTATGGAGCCCTGCAGG - Intronic
1050412899 9:5384809-5384831 CTGTGTGTGAGGGGCTATGCTGG - Intronic
1053118033 9:35522592-35522614 CTGTGTATAAGGAGCTATGCTGG - Intronic
1053241466 9:36499167-36499189 CTGTGTGTAGGGAAACATGCTGG - Intergenic
1054841044 9:69740205-69740227 GTGTGTGTATGTATGTATGTAGG + Intronic
1056803725 9:89712302-89712324 ATGTGTGTATAGAGATATGTAGG - Intergenic
1058077953 9:100669567-100669589 GTGTGTGTGGGGAGGTAGGCGGG + Intergenic
1061623513 9:131826722-131826744 TTGTGTGTAGGGAGGGATGGGGG - Intergenic
1061912435 9:133732291-133732313 CTGTGAGGGTGGAGGTACGCTGG - Intronic
1062062707 9:134505157-134505179 CTGTGTGGATGGGTGGATGCGGG + Intergenic
1185701497 X:2234235-2234257 CTGTGTGCATGGATGCAGGCAGG - Intronic
1185701518 X:2234369-2234391 CTGTGTGCATGGATGAAGGCAGG - Intronic
1186650485 X:11554977-11554999 CTGTGTGAATGGGGTTGTGCTGG + Intronic
1186654917 X:11601992-11602014 CTGTGTGTATGGAGGTGAGAGGG + Intronic
1187762566 X:22603730-22603752 GTGTTTCTATGGAGGTATGAAGG + Intergenic
1189021164 X:37342266-37342288 GTGTGTGTATGGTGGTGTGGTGG + Intergenic
1190390019 X:49922663-49922685 CTGTGTGAATGAAGCTCTGCCGG + Exonic
1190473646 X:50807356-50807378 CAGTGTCAGTGGAGGTATGCAGG + Intronic
1192116497 X:68416706-68416728 GTTTGTGTAGAGAGGTATGCAGG - Intronic
1193598851 X:83483287-83483309 ATGTGTTTGTGGAGGTATGAGGG + Intergenic
1195713064 X:107790588-107790610 CAGTGTGTATGAAGGCATGAAGG - Intronic
1196602163 X:117614710-117614732 CAGTGAGTATGGAGGTATTAGGG - Intergenic
1198882310 X:141294879-141294901 CTCTGTGTATGGGGGTCAGCTGG - Intergenic
1201645809 Y:16230323-16230345 CTATGTGTGTGGATGGATGCTGG + Intergenic
1201657004 Y:16354993-16355015 CTATGTGTGTGGATGGATGCTGG - Intergenic