ID: 916739446

View in Genome Browser
Species Human (GRCh38)
Location 1:167635542-167635564
Sequence CTTGGCGCGCGCGGTTCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 19
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 18}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916739440_916739446 13 Left 916739440 1:167635506-167635528 CCGCAGCGTGGCTCCTCACAGCA 0: 1
1: 0
2: 0
3: 15
4: 182
Right 916739446 1:167635542-167635564 CTTGGCGCGCGCGGTTCCGTGGG 0: 1
1: 0
2: 0
3: 0
4: 18
916739439_916739446 19 Left 916739439 1:167635500-167635522 CCTGATCCGCAGCGTGGCTCCTC 0: 1
1: 0
2: 1
3: 7
4: 66
Right 916739446 1:167635542-167635564 CTTGGCGCGCGCGGTTCCGTGGG 0: 1
1: 0
2: 0
3: 0
4: 18
916739441_916739446 0 Left 916739441 1:167635519-167635541 CCTCACAGCACTGCGAGCCAGAG 0: 1
1: 1
2: 0
3: 23
4: 191
Right 916739446 1:167635542-167635564 CTTGGCGCGCGCGGTTCCGTGGG 0: 1
1: 0
2: 0
3: 0
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916739446 Original CRISPR CTTGGCGCGCGCGGTTCCGT GGG Intronic
904054269 1:27659905-27659927 CGAGGCTCGCGCGGTTCCGGGGG - Intergenic
916739446 1:167635542-167635564 CTTGGCGCGCGCGGTTCCGTGGG + Intronic
1119948535 14:78720131-78720153 CTTGGCCTGCACGGTTCCCTTGG + Intronic
1125677896 15:41512235-41512257 TTTGCCGCCCGCGGCTCCGTAGG + Exonic
1142120197 16:88383274-88383296 CTGGGCGCGCGCGGTGCCTGGGG + Intergenic
1142958301 17:3535619-3535641 CTTGGCGTGCGCGTTGACGTCGG + Exonic
1155957497 18:31966232-31966254 CGTGGCGGCCGCGGCTCCGTTGG + Intergenic
1160816839 19:1040000-1040022 CTTGGCCCGCGCAGCTCCGACGG + Intergenic
1162683668 19:12364945-12364967 CTTGGCGCCAGCCTTTCCGTTGG - Exonic
1163720484 19:18896121-18896143 CGCGGGGCGCGCGGCTCCGTCGG - Exonic
1175859855 20:62144117-62144139 GTTGGGGCGCGCGGGTCCCTCGG + Intronic
1176376992 21:6091772-6091794 CTTGGGGCGGGCGGTGCCGGTGG - Intergenic
1179746483 21:43446472-43446494 CTTGGGGCGGGCGGTGCCGGTGG + Intergenic
953398386 3:42590866-42590888 CTTGGCGGTCGTGGTTCCGGAGG + Exonic
971161218 4:24136031-24136053 CTTGGCAGGCACGGTTCCCTTGG + Intergenic
991351137 5:65721944-65721966 GCTGGCCCGCGGGGTTCCGTAGG + Exonic
1020445173 7:8261431-8261453 CCTGGCGCGCCCGTTTCCTTTGG - Intronic
1057546032 9:96021125-96021147 CTTGGCCCGCGGGGTTCCCCGGG - Intergenic
1196735049 X:118975533-118975555 CCTGGCGCTCGCGGTACAGTCGG - Exonic