ID: 916744351

View in Genome Browser
Species Human (GRCh38)
Location 1:167672955-167672977
Sequence TATCCCGTGATAGTTGGGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 34}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916744347_916744351 18 Left 916744347 1:167672914-167672936 CCAGGGTGCTTTCATTCATTGTG 0: 1
1: 0
2: 0
3: 16
4: 215
Right 916744351 1:167672955-167672977 TATCCCGTGATAGTTGGGATAGG 0: 1
1: 0
2: 0
3: 1
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916744351 Original CRISPR TATCCCGTGATAGTTGGGAT AGG Intronic
909582373 1:77252506-77252528 TATCCCTTTATATTTGGTATTGG - Intergenic
915077580 1:153322141-153322163 TATCCTGTGACAGTTGTGTTTGG - Intergenic
916287879 1:163131073-163131095 TAACCCTTGATATTGGGGATAGG + Intronic
916744351 1:167672955-167672977 TATCCCGTGATAGTTGGGATAGG + Intronic
1071121615 10:82285540-82285562 TATCCCGAGATGGAAGGGATAGG + Intronic
1075463377 10:122633213-122633235 AGTCCCCTGATGGTTGGGATAGG - Exonic
1087809550 11:102595414-102595436 TATCAAGTGATATTTGGAATGGG - Intronic
1104046856 12:125169334-125169356 TATCCCCTGAGAGTTTGCATGGG - Intergenic
1105047040 12:133013437-133013459 TATCCCTTGATAATTTGAATAGG + Exonic
1107889615 13:44902878-44902900 TAACCCGTGAGAGTGGGGATGGG - Intergenic
1112256519 13:97837844-97837866 TATCCAGTAATAGATGTGATTGG + Intergenic
1144704564 17:17358733-17358755 TATCCCTGGAGAGATGGGATAGG + Intergenic
1144991946 17:19238820-19238842 TATCCTGTGAAAGAAGGGATTGG + Intronic
1146998195 17:37339155-37339177 TATCTTCTGTTAGTTGGGATGGG - Intronic
1154042524 18:10870980-10871002 TATCACGTGATAGTTTGGGGTGG + Intronic
1159784066 18:72693077-72693099 TAAACAGTGATAGTTGGGTTGGG - Intergenic
933292566 2:80454085-80454107 CCTCCCTTGATAGTTGGAATGGG - Intronic
936860375 2:117010324-117010346 TATCAAGTGGTAGTAGGGATTGG - Intergenic
943001847 2:182337707-182337729 TATCCTGTGATACTTAGAATAGG - Intronic
945506282 2:210645080-210645102 TGTCCCGTGATATTTGGTGTTGG + Intronic
1177278007 21:18941299-18941321 TATCTGGTTATATTTGGGATGGG - Intergenic
1183075823 22:35426160-35426182 TTTTCCGTGGTAGTTGGGGTAGG + Intergenic
958905321 3:99935633-99935655 GATCCCGTGATAGCAGGGTTAGG + Intronic
959804613 3:110536162-110536184 TATCTCATGATAATTTGGATTGG - Intergenic
968379032 4:73014-73036 GATGCAGTGAGAGTTGGGATGGG + Intronic
968414324 4:417029-417051 GATGCAGTGAGAGTTGGGATGGG + Intergenic
977938747 4:102834992-102835014 TATCCTGAGAGAGTGGGGATTGG - Intronic
984411094 4:179399033-179399055 TATCAGGTGAGACTTGGGATAGG - Intergenic
988934829 5:36071413-36071435 TATTCCGTGATAGATGGTAGGGG + Intergenic
998463369 5:142325182-142325204 TAACCCGTGATTGCTGGGACTGG + Intronic
1008585672 6:52946578-52946600 TGTCTGGTGATAGTTGGGAACGG + Intergenic
1017556693 6:155579479-155579501 TGCCCCGTGATAGTGGGGAAGGG + Intergenic
1022888948 7:34676263-34676285 TATCTCAGGATAGTTGTGATGGG - Intronic
1040966839 8:53090807-53090829 TATCACATGATGGTTGTGATTGG + Intergenic
1060020700 9:120128145-120128167 TAGCCAGGGAGAGTTGGGATTGG + Intergenic
1193728382 X:85071498-85071520 TTTCCCATGATAGTTGGTAAAGG - Intronic