ID: 916744420

View in Genome Browser
Species Human (GRCh38)
Location 1:167673763-167673785
Sequence CAAAGTGTCAAAAGCATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 586
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 540}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916744420 Original CRISPR CAAAGTGTCAAAAGCATGGA AGG (reversed) Intronic
900857747 1:5199594-5199616 CAAAGTGTCTTAATCATTGAAGG - Intergenic
901384514 1:8898706-8898728 CAAAGCTTCCACAGCATGGAAGG - Intergenic
904645488 1:31962607-31962629 CAATGTTTTAAAAGCATTGAGGG + Intergenic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
906767229 1:48444682-48444704 CAAAGCTTCCACAGCATGGAAGG - Intronic
907869056 1:58426367-58426389 CATAGTGTCAAATTCATGGCAGG - Intronic
908848411 1:68348540-68348562 CAAAGCTTCTACAGCATGGAAGG - Intergenic
909604747 1:77497017-77497039 CAAAGCTTCCACAGCATGGAAGG - Intronic
909860048 1:80593833-80593855 CAAAGTGTGGAAAGTATGAAAGG + Intergenic
910043572 1:82884622-82884644 CAAAGCTTCCACAGCATGGAAGG + Intergenic
910397847 1:86809542-86809564 CAAAGCTTCCACAGCATGGAAGG + Intergenic
911297942 1:96140400-96140422 CAAAGCTTCCACAGCATGGAAGG - Intergenic
911299352 1:96153407-96153429 CAAAGCTTCCACAGCATGGAAGG - Intergenic
911345416 1:96691134-96691156 CAAAGCTTCCACAGCATGGAAGG - Intergenic
912020976 1:105109338-105109360 CAAAGCTTCCACAGCATGGAAGG - Intergenic
912675884 1:111680263-111680285 CAAAGTGTCCACATCGTGGAAGG + Intronic
912729486 1:112089624-112089646 AAAAGTGCCAAAAACATGGAAGG + Intergenic
913097002 1:115528089-115528111 CAAAGTTTCCACAGCATGGAAGG + Intergenic
913279576 1:117172969-117172991 CAAAGCTTCCACAGCATGGAAGG - Intronic
913383366 1:118233259-118233281 CAAAGCTTCCACAGCATGGAAGG - Intergenic
914684753 1:149968588-149968610 CAAAATTTCAAAAGCATGTTGGG + Intronic
915330373 1:155108054-155108076 CAAAGTGTCAAAGTCACGAAAGG + Intergenic
915950852 1:160189083-160189105 GAAAATCTCAAAAGCATGGCAGG - Intergenic
916083293 1:161250444-161250466 CAAAGCTTCCACAGCATGGAAGG - Intergenic
916084325 1:161257639-161257661 CAAAGCTTCCACAGCATGGAAGG - Intergenic
916554654 1:165883745-165883767 CAAAGCTTCCACAGCATGGAAGG - Intronic
916744420 1:167673763-167673785 CAAAGTGTCAAAAGCATGGAAGG - Intronic
916871929 1:168924741-168924763 AAAAGTGTCTAAAGAATTGAAGG + Intergenic
917025758 1:170639571-170639593 CAAAGCTTCCACAGCATGGAAGG - Intergenic
917085823 1:171305244-171305266 CAAAGCTTCCACAGCATGGAAGG - Intergenic
917675931 1:177319682-177319704 CAAAGCTTCCACAGCATGGAAGG - Intergenic
917676756 1:177325855-177325877 CAAAGCTTCCACAGCATGGAGGG - Intergenic
918024138 1:180726327-180726349 CAAAGCTTCCACAGCATGGAAGG - Intronic
918170470 1:181991708-181991730 CAAAATTTCGTAAGCATGGATGG - Intergenic
918965579 1:191343570-191343592 CAAAGCTTCCACAGCATGGAAGG + Intergenic
919009034 1:191935951-191935973 CAAAGCTTCCACAGCATGGAAGG + Intergenic
919252471 1:195074724-195074746 CAAAGCTTCCACAGCATGGAAGG - Intergenic
919397516 1:197069377-197069399 CAAAGTTTCCACAGCCTGGAAGG + Intergenic
919537219 1:198802676-198802698 CAAGGAGTCAAAGCCATGGATGG + Intergenic
920053989 1:203179756-203179778 GAAAGCGTCAAAAGCAAGGTAGG - Exonic
922546263 1:226459535-226459557 CAAAGCCTCAAAAGTAGGGAAGG - Intergenic
923009387 1:230076034-230076056 CAAGATGTCTACAGCATGGAGGG - Intronic
923172468 1:231430300-231430322 CAAAGCTTCCACAGCATGGAAGG + Intergenic
924378255 1:243436221-243436243 CAAAGCTTCCACAGCATGGAAGG + Intronic
924641538 1:245837869-245837891 GAAAGGTTGAAAAGCATGGAGGG + Intronic
1063731531 10:8702793-8702815 CAAACTGTCACAAAAATGGAAGG - Intergenic
1063851144 10:10192199-10192221 CAAAGTGTCAAAATAGTGTAGGG + Intergenic
1064454990 10:15478935-15478957 CAAAGCGCTAAAAGCATTGATGG + Intergenic
1064665651 10:17648453-17648475 CAAAGCTTCCACAGCATGGAAGG - Intronic
1065389044 10:25163564-25163586 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1065884623 10:30066014-30066036 TAAAGTGTGAGAAGCAGGGATGG + Intronic
1066228422 10:33407696-33407718 AGAAGTGTCAAAGCCATGGATGG + Intergenic
1066479321 10:35780148-35780170 CAAAGATTCCACAGCATGGAAGG + Intergenic
1068484925 10:57645396-57645418 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1068499979 10:57832751-57832773 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1069364571 10:67684020-67684042 CAAAGCTTCCACAGCATGGAAGG + Intronic
1069371234 10:67749935-67749957 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1069526393 10:69175721-69175743 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1069967887 10:72136653-72136675 CAAAGCTTCCACAGCATGGAAGG - Intronic
1070036816 10:72733604-72733626 CAATGTGTGAAAAGCATTTATGG + Intronic
1070677790 10:78424362-78424384 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1070698192 10:78578664-78578686 CAAAGAGTCACAGGGATGGAAGG - Intergenic
1070719638 10:78747133-78747155 CAAAGACTCAAAAGCAAGGAGGG - Intergenic
1070988320 10:80707812-80707834 TAAAGTGGGAGAAGCATGGAAGG + Intergenic
1071054250 10:81490712-81490734 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1071308860 10:84324840-84324862 CAAAGCCTCAAAAGTAGGGAAGG - Intergenic
1072370695 10:94764161-94764183 CAAAGCTTCCACAGCATGGAAGG + Intronic
1072622196 10:97087418-97087440 CAATGTGACAAATGCAGGGATGG - Intronic
1072927073 10:99625231-99625253 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1074317299 10:112371183-112371205 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1075254036 10:120910120-120910142 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1075808333 10:125205972-125205994 CAAAGGGTCAAAGGCAGGAAGGG - Intergenic
1078681937 11:13485540-13485562 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1079401756 11:20111605-20111627 CAAAGTGTCTAAAGTCTGCAGGG + Intronic
1079469788 11:20767260-20767282 CAAAGCTTCCACAGCATGGAAGG + Intronic
1079650244 11:22919644-22919666 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1079863611 11:25706814-25706836 TAAAGTCTAATAAGCATGGAAGG + Intergenic
1080733037 11:34980403-34980425 CAAAGCTTCCACAGCATGGAAGG + Intronic
1081033841 11:38116963-38116985 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1082620838 11:55419958-55419980 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1082748286 11:56992102-56992124 GAAACTATCAAAAGCATGTACGG + Intergenic
1082889809 11:58126866-58126888 CAATGTGTCAAAAGGAAGGAAGG - Intronic
1082948985 11:58790141-58790163 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1082977067 11:59083208-59083230 CAAAGTGCCTAAAGCAGAGAAGG + Intergenic
1083090039 11:60190286-60190308 CAAAGTTACCACAGCATGGAAGG - Intergenic
1083125828 11:60564752-60564774 CAAAGCTTCCACAGCATGGAGGG - Intergenic
1084437089 11:69149392-69149414 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1084909942 11:72380405-72380427 AGAAGTGTCAAAAGCAAGAAAGG + Intronic
1085016341 11:73176679-73176701 CAAACTGTCCTAAGCATGGAAGG - Intergenic
1085772514 11:79337950-79337972 CACAGTCTCAAAAGCAGTGAGGG - Intronic
1085852604 11:80139333-80139355 CAAAGTTTCCACAGCCTGGAAGG - Intergenic
1086054335 11:82629216-82629238 CAAAGCTTCCATAGCATGGAAGG - Intergenic
1086916830 11:92539859-92539881 CAAAGTGATAAAAGCAGGGCTGG + Intronic
1087075708 11:94125663-94125685 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1087349324 11:97011276-97011298 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1087445076 11:98240769-98240791 CAAAGCATCCACAGCATGGAAGG - Intergenic
1087467006 11:98521137-98521159 CAAAGAGGAGAAAGCATGGAAGG + Intergenic
1088239721 11:107760653-107760675 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1088386609 11:109265134-109265156 CTAAGGGTCAAAAACATGAAAGG - Intergenic
1088493254 11:110406734-110406756 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1088709018 11:112489854-112489876 AAATGTGTCAAAAGGATGGATGG - Intergenic
1089759782 11:120714967-120714989 CAGAGTGGCAAATGCATGGGAGG + Intronic
1090513152 11:127396827-127396849 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1090560131 11:127923160-127923182 AAAAGTTTACAAAGCATGGAAGG + Intergenic
1091726477 12:2849761-2849783 CAGTATGTCAAAAGGATGGAAGG - Intronic
1091793896 12:3286544-3286566 TAAAGTGTCAAAAGCACAGCAGG + Exonic
1092714313 12:11372737-11372759 CAAAGCTTCCACAGCATGGAAGG + Intronic
1092718027 12:11411758-11411780 CAAAGCTTCCACAGCATGGAAGG + Intronic
1093182534 12:15983400-15983422 CAAAGACTCAAAAGGTTGGATGG - Intronic
1094125651 12:27020307-27020329 GAAAGTGTCCAAATCATGAAAGG + Intergenic
1094238492 12:28194999-28195021 CAAAGCTTCCACAGCATGGAAGG + Intronic
1094254916 12:28412643-28412665 CAAAGCTTCCAGAGCATGGAAGG + Intronic
1094736541 12:33241043-33241065 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1095597208 12:43972458-43972480 CAAAGTTTCCACAGCATGGAAGG + Intronic
1095605327 12:44060699-44060721 GAAAGTCACAAAAGCATGGGAGG + Intronic
1097211866 12:57377003-57377025 CAAAGCTTCCACAGCATGGAAGG - Intronic
1097428653 12:59475815-59475837 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1098652901 12:72995976-72995998 AAGTGTGTCAAAAGCCTGGAAGG - Intergenic
1098956208 12:76692548-76692570 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1098956943 12:76697452-76697474 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1099415052 12:82374276-82374298 CAAAGCTTCCACAGCATGGAAGG + Intronic
1099576471 12:84390288-84390310 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1099577189 12:84395438-84395460 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1099797816 12:87421212-87421234 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1100027481 12:90147726-90147748 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1100050477 12:90443492-90443514 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1100095589 12:91030862-91030884 AGAAGTGTCAAAAGCATGCGAGG + Intergenic
1100210537 12:92394027-92394049 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1100984148 12:100188921-100188943 CAAAGGTTCCACAGCATGGAAGG + Intergenic
1101050722 12:100861010-100861032 CAAAGCTTCCACAGCATGGAAGG + Intronic
1101482686 12:105116099-105116121 CAAGCTGTTAGAAGCATGGAGGG - Intronic
1102564974 12:113790711-113790733 TAAGGTCTCAAAATCATGGAAGG - Intergenic
1102565023 12:113791213-113791235 TAAGGTCTCAAAATCATGGAAGG - Intergenic
1102610816 12:114110571-114110593 GAATGTGACAGAAGCATGGAAGG + Intergenic
1103248928 12:119483196-119483218 CAAAGTGTGCAAAGCAGAGAGGG + Intronic
1104063003 12:125283748-125283770 CAAAGGGAGATAAGCATGGAAGG + Intronic
1104766789 12:131335224-131335246 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1105437116 13:20388894-20388916 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1106163440 13:27220395-27220417 CAAAGCTTCCATAGCATGGAAGG - Intergenic
1106471095 13:30054904-30054926 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1107028482 13:35826994-35827016 GAAAATGTCAAATGTATGGAAGG + Intronic
1107317770 13:39151824-39151846 CAAACTCTCAAAAGCCAGGATGG - Intergenic
1107848574 13:44546486-44546508 AAAAGTGTCAAAGTCATGAAAGG + Intronic
1107853692 13:44594211-44594233 CAAAGTTTCCACAGCGTGGAAGG + Intergenic
1108113496 13:47102764-47102786 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1108118891 13:47161402-47161424 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1108735475 13:53279154-53279176 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1108867675 13:54941545-54941567 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1108958305 13:56188186-56188208 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1109223920 13:59669863-59669885 TAAAGGGTCAAAAGCATGATTGG - Intronic
1109424023 13:62149279-62149301 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1109425212 13:62158068-62158090 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1109501140 13:63236970-63236992 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1109503112 13:63264110-63264132 CAAAGTTTCCACAGCATGAAAGG - Intergenic
1109534030 13:63693275-63693297 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1111017234 13:82397261-82397283 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1111250541 13:85595521-85595543 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1111710211 13:91802479-91802501 CAAAGCTTCCACAGCATGGAAGG + Intronic
1111729248 13:92052407-92052429 CAAAGTGTCCACAGCGTGGAAGG + Intronic
1113004011 13:105678564-105678586 GGAAGAGTCAGAAGCATGGAAGG + Intergenic
1113029904 13:105982038-105982060 CAAAGAATCAAAAGAATGGCAGG + Intergenic
1113204236 13:107897246-107897268 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1113480005 13:110613865-110613887 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1113482524 13:110632380-110632402 CAAAGTTTCCACAGCGTGGAAGG + Intronic
1115285825 14:31712048-31712070 CAAAGCTTCCACAGCATGGAAGG + Intronic
1115421216 14:33198224-33198246 CAAAGCTTCCACAGCATGGAAGG + Intronic
1115736902 14:36342132-36342154 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1115928125 14:38460469-38460491 CAGAGTGTCAGGAGCATTGAAGG - Intergenic
1116151974 14:41153719-41153741 CAAAGTTTCCACAGCATGGAAGG + Intergenic
1116305290 14:43246132-43246154 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1116346858 14:43804625-43804647 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1118379064 14:65203048-65203070 CAAAGCTTCTACAGCATGGAAGG - Intergenic
1118558773 14:67056077-67056099 CAAAGCTTCCACAGCATGGAGGG + Intronic
1120011162 14:79416282-79416304 CAAATTGTCATAAGAATGAACGG - Intronic
1120103765 14:80472149-80472171 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1120169845 14:81237155-81237177 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1121145541 14:91578968-91578990 CAAAGCTTCTACAGCATGGAAGG - Intergenic
1121154341 14:91668565-91668587 CAAAGCTTCCACAGCATGGAAGG - Intronic
1121483934 14:94299124-94299146 CAAAGTTTCAACAGTTTGGAGGG - Intergenic
1125769641 15:42156533-42156555 CAGAGTGCCCAAAGCATGGCTGG + Exonic
1126072348 15:44876049-44876071 CAAAGCCTCCACAGCATGGAAGG + Intergenic
1126723948 15:51611965-51611987 CAAAGCTTCCACAGCATGGAAGG - Intronic
1127093271 15:55487503-55487525 CAAAGCTTCCACAGCATGGAAGG - Intronic
1127785357 15:62350668-62350690 CAAAGATTCTAAAGCATAGATGG + Intergenic
1130028518 15:80291152-80291174 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1130285818 15:82553519-82553541 CAAAGAGCCAAAAACACGGAAGG + Exonic
1131008001 15:88994140-88994162 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1131198373 15:90375425-90375447 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1131719159 15:95148433-95148455 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1131934829 15:97491727-97491749 CAAAGTGTCAGAAGTGGGGAAGG + Intergenic
1132256116 15:100377918-100377940 CCAGGTGTCAACAGCTTGGAAGG + Intergenic
1135513748 16:23112114-23112136 CAAAGTTTCAAATACCTGGAAGG + Intronic
1136590753 16:31216365-31216387 CAAAGCTTCCACAGCATGGAAGG - Intronic
1137405703 16:48187559-48187581 CAATGATTTAAAAGCATGGATGG + Intronic
1137461704 16:48670511-48670533 TAAAGTACCAAAAGCAGGGAAGG - Intergenic
1138493853 16:57394954-57394976 CAAAGCTTCCATAGCATGGAAGG + Intergenic
1138826986 16:60332702-60332724 CAAAGCCTCCACAGCATGGAAGG - Intergenic
1140105977 16:71960505-71960527 CAAAGTGTCAACAGGATCAAAGG + Intronic
1140631778 16:76861941-76861963 CAAAGCTTCAAAAGCATGGAAGG - Intergenic
1143909127 17:10233421-10233443 CAGAGTGCCCAAAGCATGAAAGG + Intergenic
1144723361 17:17487319-17487341 CAAAGCTTCCACAGCATGGAAGG - Intronic
1146295115 17:31643453-31643475 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1146743555 17:35307246-35307268 CAAAGCTTCTACAGCATGGAAGG - Intergenic
1148018298 17:44537933-44537955 CAAAGCTTCCAAAGCAGGGAAGG + Intergenic
1148329475 17:46804963-46804985 CAAAGTTTCCACAGCATGGAAGG - Intronic
1149313302 17:55417022-55417044 CAGAATTTCAAAACCATGGAGGG + Intronic
1150600567 17:66647181-66647203 CACATTGTCAAAACCATGTATGG + Intronic
1151153438 17:72107616-72107638 CCAAGTGTCAGAAACAGGGAAGG + Intergenic
1153300484 18:3587610-3587632 CAAAGCTTCCACAGCATGGAAGG - Intronic
1153438444 18:5090800-5090822 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1153866425 18:9273711-9273733 CAAAGTGTGAACAGCCTGTAGGG + Intronic
1155590926 18:27426328-27426350 TAAAGTGCCAAAGGCATGGTAGG - Intergenic
1155727981 18:29113784-29113806 TAAAGTGTCAAATGAATTGAAGG + Intergenic
1155785807 18:29898335-29898357 CAAAGCTTCCACAGCATGGATGG + Intergenic
1155803467 18:30137716-30137738 CACAGTTCCAAAAGCGTGGAGGG + Intergenic
1157630500 18:49090685-49090707 CAGAGGGTGAAGAGCATGGAGGG - Intronic
1157914589 18:51652279-51652301 CAAAGTCACAAAAACATGGAGGG - Intergenic
1158523347 18:58190146-58190168 CAAAGTATCAAATACATAGAAGG + Intronic
1158744134 18:60178264-60178286 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1162057522 19:8073559-8073581 CCAAGTGTCAATAGCACTGAGGG - Intronic
1162108566 19:8386817-8386839 CAAAGTTTCCACAGCATGGAAGG - Intronic
1162656287 19:12133193-12133215 CACACCTTCAAAAGCATGGAAGG - Exonic
1163258954 19:16175152-16175174 CAAAGTGAGAAGGGCATGGAGGG - Intergenic
1164029550 19:21390053-21390075 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1165558007 19:36652742-36652764 CAAAGCTTCCACAGCATGGAAGG - Intronic
1167669927 19:50844890-50844912 CAAAGTGTGAAAAGTGTGAAGGG - Intergenic
1168385333 19:55958550-55958572 CAATATGTCACAAGCATGGCCGG - Intronic
925062901 2:906660-906682 CAAAGTCTCCAAAGCATGGGTGG + Intergenic
925685117 2:6463236-6463258 CAGATTGTCAAAAGCAGGCATGG - Intergenic
925780147 2:7374613-7374635 CTATGTGGCAAAGGCATGGATGG - Intergenic
925952806 2:8930903-8930925 CAAAGCTTCCACAGCATGGAAGG - Intronic
926480957 2:13393356-13393378 CAAATTTTCAATTGCATGGATGG - Intergenic
927518001 2:23683115-23683137 CCAAGTGTCAGAAGCAGGGCTGG + Intronic
927777949 2:25916477-25916499 CAAAGCTTCCACAGCATGGAAGG - Intergenic
928106683 2:28475080-28475102 CAAAGCTTCCACAGCATGGAAGG + Intronic
928595936 2:32858835-32858857 CAAAGCTTCCACAGCATGGAAGG + Intergenic
929254179 2:39791609-39791631 CAAAGCTTCCACAGCATGGAAGG + Intergenic
930703075 2:54478788-54478810 CAAACTGTTAATAGCATGAATGG + Intronic
931540130 2:63322361-63322383 CAAAGCTTCCACAGCATGGAAGG - Intronic
933320983 2:80775446-80775468 CAAAGCCACAAAAGCATGTAAGG - Intergenic
933419154 2:82025127-82025149 CAAAGTTTGATAACCATGGACGG + Intergenic
935762390 2:106333523-106333545 CAAAGAGTCCACAGCATGGAAGG + Intergenic
935789402 2:106577291-106577313 CAAAGCTTCCACAGCATGGAAGG + Intergenic
936803046 2:116289440-116289462 CAAAGCTTCCACAGCATGGAAGG - Intergenic
937706636 2:124928214-124928236 CAAAGCGTCCACAGTATGGAAGG - Intergenic
938806530 2:134811373-134811395 CAAAGCTTCCACAGCATGGAAGG + Intergenic
938911423 2:135888884-135888906 CAAAGCTTCCACAGCATGGAAGG - Intergenic
939062211 2:137435904-137435926 GAAAGTGGTAGAAGCATGGAAGG - Intronic
939255883 2:139744242-139744264 CAAAGCTTCCACAGCATGGAAGG - Intergenic
939551928 2:143626528-143626550 CAAAGCTTCCACAGCATGGAAGG + Intronic
939658604 2:144859063-144859085 CAAGGTGCCAAATGCATGGTCGG - Intergenic
939834409 2:147110887-147110909 CAAAGAATCAAAATCATTGATGG - Intergenic
940287882 2:152050244-152050266 CAGTGTGCCAAAAGGATGGAAGG - Intronic
941313518 2:163964177-163964199 CAAAGCTTCCACAGCATGGAAGG + Intergenic
941499893 2:166261131-166261153 GAAAATGTCAAAAGAATTGAAGG - Intronic
943005358 2:182382885-182382907 AAAAGTCTGAAAAGCATGTATGG + Intronic
943103388 2:183512763-183512785 CAAAGCTTCCACAGCATGGAAGG + Intergenic
943239884 2:185369085-185369107 CAAAGTGTCACTAGTAAGGATGG - Intergenic
943577735 2:189651020-189651042 CAAAGCTTCCACAGCATGGAAGG - Intergenic
943744581 2:191448300-191448322 CAAAGCTTCCAAGGCATGGAAGG - Intergenic
943810794 2:192186710-192186732 CAAAGTATTATAAGCAGGGATGG - Intronic
944053110 2:195493770-195493792 CAAAGCTTCCACAGCATGGAAGG - Intergenic
944460912 2:199949563-199949585 CAAAATGTCAAAGTCATAGAAGG - Intronic
945148403 2:206762825-206762847 CAGTGTTTCAAAAGCCTGGAAGG - Intronic
945289902 2:208116626-208116648 CAAAGTTACCACAGCATGGAGGG - Intergenic
945600856 2:211863393-211863415 CAAAGCTTCCACAGCATGGAAGG - Intronic
945869281 2:215208667-215208689 CAAAGCTTCCACAGCATGGAAGG - Intergenic
947937878 2:234023604-234023626 CAAAGCCTCTACAGCATGGAAGG + Intergenic
948643427 2:239389267-239389289 CAAAGCTTCCACAGCATGGAAGG - Intronic
949066011 2:241990630-241990652 CAGAGTGACAGATGCATGGATGG - Intergenic
1169496623 20:6122370-6122392 CAAAGAAACGAAAGCATGGAGGG + Intronic
1169583773 20:7057760-7057782 CAAAATCTCACAATCATGGAAGG + Intergenic
1169647757 20:7833038-7833060 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1169647954 20:7834490-7834512 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1170986541 20:21264567-21264589 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1172605830 20:36212978-36213000 CTAAGTTTAAAAAGCATGGAAGG - Intronic
1177140717 21:17354673-17354695 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1177384341 21:20389329-20389351 CAAAGCTTCCATAGCATGGAAGG - Intergenic
1177967911 21:27751395-27751417 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1178027002 21:28479409-28479431 CAAAATGTCAAGACCAAGGATGG - Intergenic
1178282275 21:31293766-31293788 CCAAGAGACAAAAGCTTGGATGG - Intronic
1179072270 21:38082970-38082992 CAAAGTCTCCCAACCATGGAGGG - Intronic
1179503497 21:41824548-41824570 CAATCTCTCAACAGCATGGAAGG + Intronic
1180204669 21:46251180-46251202 CAGAATGGCAAGAGCATGGATGG + Intronic
1180755229 22:18156372-18156394 CAAAGCTTCCACAGCATGGAAGG - Intronic
1180860724 22:19080028-19080050 AAAAGTGTCAACATAATGGAAGG - Intronic
1182741750 22:32572707-32572729 CAAAGTGTCAGAATTATAGATGG + Intronic
1182858525 22:33539184-33539206 AAAAGTGTGAAAAGTATGGTTGG + Intronic
1183048384 22:35240561-35240583 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1185393282 22:50573984-50574006 TACAGTGTCAGAAGCAGGGAAGG + Intronic
949133547 3:535622-535644 CAAAGTTTCCACAGCCTGGAAGG + Intergenic
949297236 3:2539565-2539587 CCAAGTGTAAATACCATGGACGG - Intronic
949449290 3:4167231-4167253 CAAAGCTTCCACAGCATGGAAGG + Intronic
949620596 3:5807364-5807386 CCAAGTGTTAACAGCATGAAAGG - Intergenic
950286922 3:11752319-11752341 CAAAGCTTCCACAGCATGGAAGG + Intergenic
950566125 3:13770672-13770694 CAAAGTCAGAAAAGCTTGGAGGG + Intergenic
950959356 3:17088777-17088799 CAAAATGTCAAGAGCAAAGAGGG + Intronic
951352867 3:21628132-21628154 AAAAGTTTCAAAAGCATGGAGGG + Intronic
951905962 3:27707803-27707825 AAAAATGTCAAAAGCATGGCCGG - Intergenic
952941273 3:38446084-38446106 CAAAGCTTCCACAGCATGGAAGG + Intergenic
953623269 3:44550624-44550646 CAAAGCTTCCACAGCATGGAAGG + Intergenic
954089179 3:48271275-48271297 CAAAGCTTCCACAGCATGGAAGG + Intronic
954599453 3:51856652-51856674 CAAAGCTTCCACAGCATGGAAGG - Intergenic
955350565 3:58190304-58190326 CAAAGAGTCTAAAGCTTGGCTGG - Intergenic
957175677 3:76805082-76805104 CATAGTGTCTAAAGCATAGTAGG + Intronic
957619364 3:82574810-82574832 CAAAGCTTCCACAGCATGGAAGG - Intergenic
958601728 3:96302721-96302743 CAAAGCTTCCACAGCATGGAAGG - Intergenic
958627590 3:96646177-96646199 CAAAGCTTCCACAGCATGGAAGG + Intergenic
958766528 3:98375204-98375226 AAAAGTGTCAAAGGCATGAATGG - Intergenic
959334412 3:105045968-105045990 CAAAGCTTCCACAGCATGGAAGG - Intergenic
959414891 3:106072110-106072132 CAAAGCTTCTACAGCATGGAAGG - Intergenic
959545494 3:107591344-107591366 AAATGGGTCAAAAGCATGGTTGG + Intronic
959564310 3:107818759-107818781 CAAAGCTTCCACAGCATGGAAGG - Intergenic
960048268 3:113217605-113217627 CAAAGTCTTAAAAGCAGAGATGG + Intronic
960063358 3:113346842-113346864 CAAAGCTTCCACAGCATGGAAGG - Intronic
960064123 3:113352322-113352344 CAAAGCTTCCACAGCATGGAAGG - Intronic
961999885 3:131284863-131284885 CAAAATCTCAAAAGTAGGGAGGG - Intronic
962196739 3:133370265-133370287 CAAAGGGTCAGAAGCAAAGAAGG - Intronic
962796862 3:138856955-138856977 CTAAGTGTGAAAGGCATGAAAGG + Intergenic
963014261 3:140806099-140806121 CAAAGTGTAAATGGCATGAATGG - Intergenic
963692794 3:148525689-148525711 CAAAGCTTCCACAGCATGGAAGG - Intergenic
963696393 3:148570912-148570934 CAAAGCTTCCACAGCATGGAAGG - Intergenic
963700333 3:148618103-148618125 CAAAGCTTCCACAGCATGGAAGG - Intergenic
964222953 3:154367650-154367672 CAAAGCTTCCACAGCATGGAAGG - Intronic
964604886 3:158549958-158549980 CAAAGCTTCCACAGCATGGAAGG + Intergenic
964916278 3:161846079-161846101 CAAAGCTTCCACAGCATGGAAGG + Intergenic
965102112 3:164311101-164311123 CAAAGCTTCCACAGCATGGAAGG + Intergenic
965249072 3:166318708-166318730 CAAAGCTTCCACAGCATGGAAGG + Intergenic
965851801 3:173035838-173035860 CAATGTTGCAAAAGCATGGTAGG + Intronic
967338456 3:188370627-188370649 CAAAGGATCGAAAGGATGGACGG - Intronic
967791827 3:193558061-193558083 CAGAGTGACAATAACATGGAAGG + Intronic
969111508 4:4847173-4847195 AGAAGTGTCAGAAGCAGGGAGGG + Intergenic
969622996 4:8288160-8288182 AAAAGTCTGAAAAGCAGGGAAGG - Intronic
971533707 4:27721544-27721566 CAAAGCTTCTACAGCATGGAAGG + Intergenic
971578168 4:28303384-28303406 CAAAGATTCCACAGCATGGAAGG - Intergenic
971630567 4:28987924-28987946 CAAAGCTTCCACAGCATGGAAGG + Intergenic
972132776 4:35859071-35859093 CAAAGCTTCCACAGCATGGAAGG + Intergenic
973044599 4:45520010-45520032 CAAAGCTTCCACAGCATGGAAGG + Intergenic
973952855 4:56035261-56035283 CAAAGTGAGAGAAGCATAGAAGG - Intergenic
974448237 4:62014452-62014474 AAAAATGTCAGAAGAATGGAAGG + Intronic
974520966 4:62979226-62979248 CAAAGCTTCCACAGCATGGAAGG + Intergenic
974526206 4:63052890-63052912 CAAAGCTTCCACAGCATGGAAGG - Intergenic
974645713 4:64688433-64688455 CAAAGCTTCCACAGCATGGAAGG - Intergenic
974976761 4:68902681-68902703 CAAAGTGGCAAAAGCATATTTGG + Intergenic
975004221 4:69267487-69267509 CAAAGCTTCCACAGCATGGAAGG - Intergenic
975013384 4:69381493-69381515 CAAAGCTTCCACAGCATGGAAGG - Intronic
975156732 4:71080577-71080599 CAAAGTGAGAAAGGCAGGGATGG - Intergenic
975208343 4:71669911-71669933 CAAAGCTTCCACAGCATGGAAGG - Intergenic
975235481 4:71990421-71990443 CAAAACCTCAAAAGCAGGGAAGG - Intergenic
976182937 4:82416104-82416126 CAAAGCATCCACAGCATGGAAGG - Intergenic
977102535 4:92835245-92835267 CAAAGTGTCAAAACAAAGGTAGG + Intronic
977155448 4:93567139-93567161 CAAAGTTTTAAAAGCAATGATGG + Intronic
977250793 4:94686439-94686461 CAAAGCTTCCACAGCATGGAAGG - Intergenic
977449922 4:97182350-97182372 CAAAGCTTCCACAGCATGGAAGG - Intergenic
977726533 4:100302789-100302811 CAAGGAGTCCAGAGCATGGAGGG - Intergenic
978685091 4:111431731-111431753 CAAAATTTCAAAAGCATTCAGGG - Intergenic
979318702 4:119298636-119298658 CAAAGTGTAAAATGAAAGGAAGG + Exonic
979631213 4:122905017-122905039 CAAAGTTTCCACAGCATGGAAGG + Intronic
980256089 4:130382428-130382450 CAAAGTCACAAAAGCATGGCTGG + Intergenic
980792172 4:137633629-137633651 CAAAGCTTCAAAAGTAGGGAAGG - Intergenic
982700767 4:158657964-158657986 CAAAGCTTCCACAGCATGGAAGG - Intergenic
982701831 4:158665441-158665463 CAAAGCTTCCACAGCATGGAAGG - Intergenic
982773056 4:159415616-159415638 CAAAGCTTCCACAGCATGGAAGG - Intergenic
982980527 4:162128593-162128615 CAAAATGTCATAAGCTGGGAAGG - Intronic
983084700 4:163428502-163428524 CAAAGCTTCCACAGCATGGAAGG - Intergenic
983633479 4:169874101-169874123 CAAATTGTAAAAAGGATTGAAGG - Intergenic
983964975 4:173798926-173798948 AAAATTGGCAACAGCATGGATGG - Intergenic
984431711 4:179659205-179659227 CAAAGACTCTAAAGCAGGGAAGG - Intergenic
984727726 4:183037507-183037529 CAAAATATCACACGCATGGAAGG - Intergenic
985026724 4:185746039-185746061 CAAAGTGACAGAAGCATAGAGGG + Intronic
986152140 5:5138597-5138619 CAAAGCTTCCACAGCATGGAAGG - Intergenic
986777583 5:11031910-11031932 AAAAGTCTCAAAAGTAGGGAAGG - Intronic
986975892 5:13393352-13393374 CAAAGCGTCAAAACACTGGAGGG + Intergenic
987545606 5:19307398-19307420 CAAAGCTTCCACAGCATGGAAGG + Intergenic
987699517 5:21378965-21378987 AAAAGTGTCAATAGTATTGAAGG - Intergenic
988039917 5:25875963-25875985 CAAAGCTTCCACAGCATGGAAGG + Intergenic
988158228 5:27482831-27482853 CAAAATGGCAAATGCATAGAGGG + Intergenic
988619128 5:32804535-32804557 CAAAGCTTCCACAGCATGGAAGG + Intergenic
988845271 5:35121089-35121111 CAATGTGTAAAAACCATGGGGGG + Intronic
988938108 5:36110651-36110673 CAAAGTGATGATAGCATGGAGGG - Intronic
989439438 5:41453203-41453225 AAAAATGTCAAAGTCATGGAAGG - Intronic
989721238 5:44531019-44531041 CAAAGCTTCAACAGCATGGAAGG - Intergenic
989754249 5:44933854-44933876 CAAAGTGTGGAAAGTGTGGAGGG - Intergenic
990043756 5:51403016-51403038 CAAAGCTTCCACAGCATGGAAGG - Intergenic
990116413 5:52397567-52397589 CAATGTTTCCACAGCATGGAAGG - Intergenic
990176356 5:53112616-53112638 CAAAGCTTCCACAGCATGGAAGG - Intergenic
990367295 5:55084407-55084429 CAAAGCTTCCACAGCATGGAAGG + Intergenic
990998123 5:61753902-61753924 TAAAGAGACAAATGCATGGATGG - Intergenic
991178015 5:63713077-63713099 CAAAGATTCCATAGCATGGAAGG - Intergenic
992048998 5:72926325-72926347 CAAAGTTTCCACAGCGTGGAAGG - Intergenic
992050477 5:72935936-72935958 CAAAGTTTCCACAGCATGGAAGG - Intergenic
992455816 5:76914511-76914533 CAAAGCTTCCACAGCATGGAAGG - Intronic
993864786 5:93179479-93179501 CAAATAGTCAAAATCATGGGTGG + Intergenic
993908855 5:93655774-93655796 CAAAGTATGAAAAAAATGGAAGG + Intronic
994230795 5:97309154-97309176 CAAAGCTTCCACAGCATGGAAGG + Intergenic
994419703 5:99516808-99516830 CAAAGTCTCTAAAGAATGGAAGG - Intergenic
994487508 5:100398333-100398355 CAAAGTCTCTAAAGAATGGAAGG + Intergenic
994768968 5:103957017-103957039 CAAATTTTCAAAAGCATATAAGG - Intergenic
994908652 5:105873008-105873030 CAAAGCTTCCATAGCATGGAAGG - Intergenic
994977633 5:106830290-106830312 AATAGTGTCCAAAGTATGGAGGG - Intergenic
995529255 5:113075752-113075774 CAAAGCTTCCACAGCATGGAAGG - Intronic
995707446 5:114999808-114999830 CAAAGCTTCCACAGCATGGAAGG - Intergenic
995821145 5:116234176-116234198 CAAAGTAACAAAAGCAGGCAGGG + Intronic
996099594 5:119432756-119432778 CAAAGCTTCCAAAGCGTGGAAGG + Intergenic
997709795 5:135994652-135994674 CTAAGGGTCAAAAGAATTGAGGG - Intergenic
997772100 5:136564738-136564760 CAAAGCTTCCACAGCATGGAAGG - Intergenic
998188809 5:140004646-140004668 AAAAGTGTCAAGATCATGGAAGG + Intronic
999348701 5:150846539-150846561 CAAAGCTTCCACAGCATGGAAGG - Exonic
999445508 5:151635536-151635558 CAAAGCTTCTACAGCATGGAAGG - Intergenic
1000352153 5:160360474-160360496 TAAGGGGTCAAAAGCAAGGAGGG - Intronic
1000603074 5:163298130-163298152 CAAAGTGGCAGATGCATGCATGG + Intergenic
1003329796 6:5120529-5120551 CAAAGTCTCCACAGCGTGGAAGG + Intronic
1004912779 6:20302266-20302288 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1005112259 6:22295165-22295187 CGAAGTGTCAAACACATGCATGG - Intronic
1005114134 6:22317879-22317901 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1005358259 6:25005994-25006016 CAAAATTTAAAAAGCCTGGAAGG - Intronic
1005649948 6:27877359-27877381 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1006714639 6:36108803-36108825 CAAAGTGGCAAAAGCATGACCGG - Exonic
1006734654 6:36264505-36264527 GAAAGTATAAAAAACATGGAAGG + Intronic
1008171278 6:48210360-48210382 CCAAGTGTAAATAGCATGAATGG - Intergenic
1008270069 6:49481546-49481568 CAAAGCTTCCACAGCATGGAAGG + Intronic
1008629929 6:53353883-53353905 CAGAGTGTGAAAGGCAGGGAGGG - Intergenic
1009687987 6:66988050-66988072 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1009688258 6:66991360-66991382 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1009946628 6:70348014-70348036 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1010074603 6:71785615-71785637 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1010392211 6:75350362-75350384 GAAAGTATCAAAAGCATGTTAGG + Intronic
1010768990 6:79806980-79807002 CAAAGCCTCCACAGCATGGAAGG - Intergenic
1010858750 6:80877924-80877946 AAAAGTTTCCACAGCATGGAAGG + Intergenic
1011375384 6:86681212-86681234 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1011404358 6:87002389-87002411 CAAAGTGTCCACAGTATGGAAGG + Intronic
1011488196 6:87864883-87864905 CAAAGTGTAGAAAACATGGCAGG + Intergenic
1011596365 6:89020397-89020419 CAGACGGTCAAAAGCAGGGAGGG + Intergenic
1012467376 6:99530587-99530609 CAAAGTATCAAACCCAAGGAAGG - Intergenic
1012598346 6:101066046-101066068 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1012739685 6:103000597-103000619 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1013182370 6:107729001-107729023 AAAAGTGACAGATGCATGGATGG + Intronic
1013661972 6:112307322-112307344 CAATTTGTAAAAAGCATGTAGGG + Intergenic
1013906905 6:115231902-115231924 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1013977073 6:116091388-116091410 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1014201873 6:118617649-118617671 CAAAGCTTCCACAGCATGGAAGG - Intronic
1015137248 6:129886966-129886988 CAAAGGATAAAAAGCATGAAAGG + Intergenic
1016171403 6:141022529-141022551 CTAAATTTCAAAAGCATGGAAGG - Intergenic
1016248405 6:142015219-142015241 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1016443593 6:144109702-144109724 GAAAATGTCAAAAGAATGGGTGG - Intergenic
1016685280 6:146874413-146874435 CAAAGTGTCAAATGAGTGGAAGG - Intergenic
1017100938 6:150849354-150849376 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1017188739 6:151629085-151629107 CAAAGTGTCATAAACATGACCGG - Intergenic
1017380399 6:153821685-153821707 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1017551378 6:155511895-155511917 AAAATTTTCAACAGCATGGAAGG + Intergenic
1018203316 6:161414718-161414740 CAAAGTGCAAAAGGCATGAAAGG + Intronic
1019202614 6:170330705-170330727 CAAAGTCCCAAAATAATGGAAGG + Intronic
1019225795 6:170506964-170506986 CACTGTGTCAAAACCACGGAAGG + Intergenic
1020245902 7:6429345-6429367 CAAAATGTCAATATCATGAAAGG + Intronic
1020784287 7:12555573-12555595 CAAACTTTCCACAGCATGGAAGG + Intergenic
1021347868 7:19549562-19549584 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1022421956 7:30231641-30231663 CAAAGTCTCAACAGCCTTGAAGG + Intergenic
1023077594 7:36499422-36499444 CAAAGCTTCCATAGCATGGAAGG + Intergenic
1023151418 7:37204553-37204575 CAAAGCTTCCACAGCATGGAAGG + Intronic
1023232893 7:38052267-38052289 CAAAACATCAAAAGCATGGAAGG - Intergenic
1023258609 7:38336224-38336246 CAAAGCTTCCAAAGCATGGAGGG + Intergenic
1023457262 7:40354106-40354128 CACAGTGTGAAAAGAAGGGAGGG - Intronic
1023467121 7:40468460-40468482 CAAAGTGTGAAAAGCAGAGTAGG - Intronic
1023787202 7:43719666-43719688 AAAAGTGACAAAGGGATGGATGG + Intronic
1023832771 7:44049674-44049696 CAAAGAGTCTCAAGCCTGGAAGG + Intronic
1024285313 7:47752026-47752048 CAAAGCTTCCACAGCATGGAAGG - Intronic
1024331886 7:48163051-48163073 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1024443243 7:49446129-49446151 CAAAGCTTCCAAAGCATGGAAGG - Intergenic
1024871149 7:53962727-53962749 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1026486104 7:70822829-70822851 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1027770848 7:82404143-82404165 CAAAGAGTCAAAATCTTGGATGG + Intronic
1027790758 7:82637160-82637182 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1027791966 7:82645634-82645656 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1028731993 7:94161601-94161623 AAAACAGTCAAAAACATGGAAGG + Intergenic
1029157703 7:98528952-98528974 CAAAATGTCAAAACCATAGAGGG - Intergenic
1030010884 7:105165785-105165807 CAAAGCTTCCACAGCATGGAAGG - Intronic
1030121683 7:106116205-106116227 CAAAGAGTCAAAAGCTTGCTAGG + Intergenic
1030356928 7:108553516-108553538 CAAAATTTCAAATCCATGGAAGG - Intronic
1030420856 7:109304522-109304544 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1031423281 7:121574855-121574877 GAATGTTTCAAAAACATGGAGGG - Intergenic
1031732403 7:125315159-125315181 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1032416985 7:131743322-131743344 CAGAGAGTCCAAAACATGGAAGG + Intergenic
1032683046 7:134205047-134205069 CAAAGTGTCCACAGCATGGAAGG + Intronic
1033772154 7:144564576-144564598 CTAACTGTCAAAAGCAGGGTAGG + Intronic
1034579234 7:152028136-152028158 CAAAGCTTCCACAGCATGGAAGG + Intronic
1034966983 7:155397864-155397886 CAAAGTTTCCACAGCCTGGAAGG + Intergenic
1036237282 8:7051161-7051183 AAAAGTTTCAAAAGCAAGGCTGG + Intergenic
1037173832 8:15924393-15924415 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1038430004 8:27492604-27492626 CAAAGCTTCCACAGCATGGAAGG + Intronic
1039129645 8:34248420-34248442 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1039752042 8:40487509-40487531 CAAAGTGTCAAAGAGATGTAGGG + Intergenic
1040526826 8:48233104-48233126 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1040764617 8:50892262-50892284 CAAAGTATCAACAGACTGGAAGG - Intergenic
1040794296 8:51272070-51272092 CAAAGTTTCCACAGCGTGGAAGG - Intergenic
1040999510 8:53437074-53437096 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1041000282 8:53442790-53442812 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1041001536 8:53459645-53459667 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1041002862 8:53468790-53468812 CAAAGTTTCCACAGCGTGGAAGG - Intergenic
1041818708 8:62004183-62004205 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1042919268 8:73906349-73906371 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1043178721 8:77056389-77056411 TAAATTGTCAAAAAAATGGAAGG + Intergenic
1043626708 8:82270492-82270514 CAAATTGTCAAAATTAAGGAGGG + Intergenic
1043703377 8:83318916-83318938 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1044679088 8:94759152-94759174 CAAAGCTTCCACAGCATGGAAGG + Intronic
1045589000 8:103572257-103572279 CAAAGCTTCCACAGCATGGAAGG + Intronic
1045929659 8:107606544-107606566 CAAAGTTTCCACAGCATGGAAGG + Intergenic
1046329736 8:112699127-112699149 CAAAGCTTCCACAGCATGGAAGG - Intronic
1046794119 8:118352086-118352108 CACAGTGTTAAACGCATGTAAGG - Intronic
1047354168 8:124104405-124104427 CAAGGTGTGAAATGCAGGGAAGG + Intronic
1048210423 8:132450103-132450125 CAAAGCTTCCACAGCATGGAAGG + Intronic
1049007196 8:139863142-139863164 CAAAGTGGCAGAAGCCAGGAAGG + Intronic
1049827106 8:144676116-144676138 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1049944020 9:577145-577167 CAAAGCTTCCACAGCATGGAAGG + Intronic
1050627562 9:7521426-7521448 CAAAGTGTCAAATACATGTATGG + Intergenic
1051968783 9:22862756-22862778 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1052058159 9:23925868-23925890 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1052372085 9:27676381-27676403 CAAAGTTTCCACAGCGTGGAAGG - Intergenic
1052463765 9:28802761-28802783 CAAAGGGTCAGAAGCAAGGACGG + Intergenic
1053860142 9:42378430-42378452 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1055241769 9:74194911-74194933 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1055401304 9:75927249-75927271 CAAAGGGGCAAAAGCTTGAATGG - Intronic
1056391815 9:86147818-86147840 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1056958254 9:91099677-91099699 CAAAGAGCCAGAAGGATGGAAGG + Intergenic
1057150715 9:92793796-92793818 CACAGTGGCAACAGCATGCATGG + Intergenic
1057343522 9:94225761-94225783 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1057547668 9:96030333-96030355 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1058738297 9:107917305-107917327 CAATGTGTACAAAGCTTGGATGG - Intergenic
1058941671 9:109818730-109818752 TAAAGTGTCAAAACCATGCCAGG - Intronic
1058984501 9:110198477-110198499 CAAAATGCCAAGAGCCTGGATGG - Intronic
1061765077 9:132876743-132876765 GAAATGGTCAAAAACATGGAGGG + Intronic
1185909900 X:3971699-3971721 CAAAGTTACCACAGCATGGAGGG - Intergenic
1186465839 X:9784409-9784431 CAAAGCTTCCACAGCATGGAAGG + Intronic
1186768339 X:12792723-12792745 CAAATGGTGAAAAGTATGGATGG - Intronic
1187010508 X:15273722-15273744 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1187739023 X:22335006-22335028 AAAAGTGTCAAGAACATGAAAGG - Intergenic
1188086239 X:25905201-25905223 CAAAGTGTTAAATGTAGGGATGG - Intergenic
1188176937 X:27002430-27002452 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1188248035 X:27857460-27857482 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1188999701 X:36930802-36930824 CAGAGTGTGAAAAGCACGAATGG + Intergenic
1189172142 X:38919136-38919158 CATGATTTCAAAAGCATGGACGG + Intergenic
1190541066 X:51479669-51479691 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1190706110 X:53029657-53029679 CACAGTGGCAAAAACATGCATGG + Intergenic
1191026220 X:55916584-55916606 CAAAGGGTAACAGGCATGGATGG + Intergenic
1192672046 X:73155087-73155109 CACAGCTTCAAGAGCATGGAGGG + Intergenic
1193888481 X:87013072-87013094 CAAAGTTTCCAGAGCGTGGAAGG + Intergenic
1193951632 X:87808196-87808218 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1194066615 X:89269444-89269466 CAAAGTTTCCACAGCATGGAAGG + Intergenic
1194155573 X:90383920-90383942 CAAAGTTTCCACAGCGTGGAAGG + Intergenic
1194408958 X:93533220-93533242 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1195439181 X:104882734-104882756 CAAAGCTTCTACAGCATGGAAGG - Intronic
1195440913 X:104896720-104896742 CAAAGCTTCCACAGCATGGAAGG - Intronic
1195579947 X:106490178-106490200 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1195850565 X:109277885-109277907 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1196108329 X:111919362-111919384 CAAAGCTTCCACAGCATGGAAGG - Intronic
1196720336 X:118847884-118847906 CAAAATGTCAAAACAATGGTAGG + Intergenic
1197209435 X:123816721-123816743 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1197398743 X:125962165-125962187 CAAAGCTTCCACAGCATGGAGGG + Intergenic
1197513026 X:127395093-127395115 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1198048408 X:132925364-132925386 CAAATTGTCAAACCCAAGGAGGG + Intronic
1198493719 X:137169260-137169282 CAAAGTCTCATAAGCTTGTAAGG + Intergenic
1200394138 X:155973401-155973423 CAAAGTTACCACAGCATGGAGGG + Intergenic
1200501924 Y:3960849-3960871 CAAAGTTTCCACAGCGTGGAAGG + Intergenic
1200694527 Y:6347183-6347205 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1200711728 Y:6490678-6490700 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1200720785 Y:6603598-6603620 CAAAGTTTCCACAGCATGGAAGG + Intergenic
1200775900 Y:7170177-7170199 CAAAGCTTCCACAGCATGGACGG - Intergenic
1200881134 Y:8212234-8212256 CAAAGTTTCCACAGCATGGAAGG + Intergenic
1201022208 Y:9671302-9671324 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1201040750 Y:9827527-9827549 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1201279140 Y:12326014-12326036 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1201404636 Y:13637114-13637136 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1201630916 Y:16071305-16071327 CAAAGCTTCCAAAGCATGGAAGG - Intergenic
1201644021 Y:16207713-16207735 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1201652918 Y:16310817-16310839 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1201658794 Y:16377608-16377630 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1201744310 Y:17353782-17353804 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1201750295 Y:17423960-17423982 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1201907470 Y:19100497-19100519 CAAAGTTTCCATAGCAAGGAAGG + Intergenic
1201910803 Y:19131899-19131921 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1201913318 Y:19155895-19155917 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1201981381 Y:19913801-19913823 CAAAGCTTCCACAGCATGGAAGG + Intergenic
1201982090 Y:19918946-19918968 CAAAGTTTCCATAGCATGGAAGG + Intergenic
1202021349 Y:20467852-20467874 CAAAGTTTCCACAGCCTGGAAGG - Intergenic
1202242519 Y:22786181-22786203 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1202395504 Y:24419930-24419952 CAAAGCTTCCACAGCATGGAAGG - Intergenic
1202475280 Y:25250162-25250184 CAAAGCTTCCACAGCATGGAAGG + Intergenic