ID: 916746425

View in Genome Browser
Species Human (GRCh38)
Location 1:167688174-167688196
Sequence GGGTTTTATGGAGCATCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916746425 Original CRISPR GGGTTTTATGGAGCATCAGC TGG Intronic
902621270 1:17652336-17652358 GAGTGTGAAGGAGCATCAGCAGG + Intronic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
910221983 1:84897290-84897312 GGGTTTTCTGGAGCTTCAAAGGG + Intergenic
910638303 1:89433418-89433440 GGGTTTTATGGAGGGAAAGCAGG + Intergenic
911544653 1:99202294-99202316 GTGTTTCAAGGAGCAGCAGCAGG - Intergenic
912528093 1:110299692-110299714 GGGTTGTGGGGAGCAGCAGCTGG + Intergenic
914448960 1:147773733-147773755 GGCTTTCCTGGAGCATCAGCAGG + Intergenic
916153936 1:161825737-161825759 GGTTTTTATGGAGCTTCATTAGG + Intronic
916746425 1:167688174-167688196 GGGTTTTATGGAGCATCAGCTGG + Intronic
918230320 1:182524216-182524238 GGGTTTGTTGGAGCAGCAGGTGG + Intronic
919115637 1:193277203-193277225 GGGTTTTATAGAGCATCTTGAGG + Intergenic
919275653 1:195412752-195412774 GGGTTTTATGAAAAGTCAGCGGG - Intergenic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
921731728 1:218586471-218586493 GGGTTTTATTGAGCATAAAATGG - Intergenic
1064243779 10:13653604-13653626 TGGTTTGGTGGAGCATCAGGGGG - Intronic
1067814374 10:49461358-49461380 GGGATTTCTGGTGCACCAGCAGG - Exonic
1071491232 10:86137991-86138013 GGGTTGTCTGGAGAATCTGCAGG + Intronic
1075710080 10:124526109-124526131 GGGATTGAGGGAGCGTCAGCAGG + Intronic
1081716457 11:45254001-45254023 GGGGGTTATGGAGCCACAGCTGG + Intronic
1081737363 11:45413380-45413402 TGGTTTTATGGAGGATGAGGTGG + Intergenic
1084470381 11:69355995-69356017 AGGGCTTATGGAGCTTCAGCTGG + Intronic
1085796051 11:79540939-79540961 GGTTTTTCTGCAGCACCAGCTGG - Intergenic
1089152472 11:116374570-116374592 GGGGCATGTGGAGCATCAGCAGG - Intergenic
1093714515 12:22366342-22366364 TGGCTTTATGGAGCTTCAGTGGG - Intronic
1098597624 12:72293081-72293103 GTGTTTTATGGAACCTCAGCTGG + Intronic
1101869819 12:108556523-108556545 AGGTTTTATGAATCATAAGCAGG - Intronic
1102727118 12:115075434-115075456 GGGTTTTATTGAGCACCTACTGG + Intergenic
1104312881 12:127670448-127670470 GAATTTTATGGAGCAGCAGGAGG - Intergenic
1105257455 13:18753518-18753540 GGGTTTTAGGTACCATCAACGGG - Intergenic
1106501901 13:30336792-30336814 GGGTTTTGTGGAACACCTGCGGG - Intergenic
1109444478 13:62415511-62415533 GGATTTTATGAAGCTTCAGTAGG - Intergenic
1113415433 13:110125131-110125153 GGGTTACATGGAGGGTCAGCTGG - Intergenic
1115900287 14:38139368-38139390 GGTTGTTATGGAGTATCAGTGGG + Intergenic
1118251207 14:64163321-64163343 GATTTTGATGGAGCAGCAGCGGG + Intronic
1120719373 14:87873827-87873849 GGGGTTTATGAAACTTCAGCAGG - Intronic
1130839996 15:87689414-87689436 GGGTTGTAGGTAGCAGCAGCTGG + Intergenic
1131300327 15:91194084-91194106 TGAATTTATGCAGCATCAGCTGG + Intronic
1136591259 16:31219157-31219179 GGCTGTGCTGGAGCATCAGCTGG + Exonic
1145253431 17:21309333-21309355 CGGCTTAATGGAGGATCAGCAGG + Intronic
1148062965 17:44849130-44849152 TGGTTTTATGCAGCATCTGGTGG - Intronic
1151084060 17:71360767-71360789 TAGGTTTATGGAGCATCAGAGGG - Intergenic
1152637719 17:81436962-81436984 GGGTTTCCTGGAGCATCTCCTGG + Intronic
1154433597 18:14327209-14327231 GGGTTTTAGGTACCATCAACAGG + Intergenic
1155498195 18:26462988-26463010 GGGGTTTATGGGGCAGCAGCAGG + Intronic
1157849948 18:51039373-51039395 GGGTTTCAAGCAGCATCACCAGG + Intronic
1160001305 18:75026879-75026901 GACATTTGTGGAGCATCAGCTGG + Intronic
1160368422 18:78349645-78349667 AGGTCTGAGGGAGCATCAGCTGG + Intergenic
1162946333 19:14046233-14046255 GGGAATTAGGGAGCAGCAGCAGG - Exonic
1164984298 19:32637431-32637453 GGTTTTTATTGAGCATTGGCTGG - Intronic
926147574 2:10405996-10406018 GTGTTCTATGGAGCATTACCGGG + Intronic
929221480 2:39468996-39469018 GGGTCCTCTGGAGCAGCAGCAGG - Intergenic
930145987 2:48004767-48004789 GGGTTTGCTGGTGCTTCAGCTGG + Intergenic
932299508 2:70656199-70656221 GGGTTTTATGGGGGCTCAGTGGG + Intronic
934935190 2:98460267-98460289 GGGTTTTGGGGAGCATCACAGGG + Intronic
934977692 2:98816265-98816287 GGGTTTTATGACGTATCAGTGGG + Intronic
937385136 2:121423313-121423335 AGTTATTATGGAGCATCAGTAGG - Intronic
942583326 2:177445931-177445953 GGGTATTATGGATCATCAAATGG + Intronic
943463048 2:188193523-188193545 GGGTTGTATGGATAATCTGCAGG - Intergenic
948695535 2:239731427-239731449 GGGTTTGGGGGAGCATCTGCTGG + Intergenic
948865018 2:240770844-240770866 GGCCATTGTGGAGCATCAGCAGG - Intronic
1169199227 20:3699571-3699593 GGGCTTTGTGGTGCATCAGGAGG + Intronic
1175413708 20:58787709-58787731 AGGTTTTTTGGAGAATCATCCGG + Intergenic
1176843437 21:13858535-13858557 GGGTTTTAGGTACCATCAACGGG - Intergenic
950022930 3:9801331-9801353 GGGTGTTTTGCAGCATCACCTGG - Intronic
950181753 3:10918401-10918423 GGGTTTTATGGCGTACGAGCAGG + Exonic
957204319 3:77175349-77175371 GGGTTTTATAGAGCATCAATAGG + Intronic
958045610 3:88280495-88280517 GGCTTTTATTTAGCATCATCTGG + Intergenic
961586237 3:127928521-127928543 TGTTTTTATTGGGCATCAGCAGG + Intronic
969671449 4:8592487-8592509 GGGTTTTAGGCAGGATCAGCAGG + Intronic
973953216 4:56038293-56038315 GGGTTTTGTGGATCATGGGCTGG + Intergenic
977367997 4:96097378-96097400 GGTTTTGCTGCAGCATCAGCTGG + Intergenic
979038906 4:115761899-115761921 GGGTTCTATGGACCATCGGTTGG - Intergenic
982202715 4:152975295-152975317 GGGAATTAAGGAGCATGAGCTGG + Exonic
984309814 4:178042898-178042920 GGGTTTTATGGTTAGTCAGCTGG + Intergenic
985656424 5:1133874-1133896 GGGTTGTGTGGAGCTGCAGCTGG + Intergenic
986207337 5:5637421-5637443 GGATTTTATGAAGCATCTGTGGG - Intergenic
994097712 5:95862023-95862045 GGGGTTTAGGGAGATTCAGCTGG - Intergenic
998840969 5:146253304-146253326 TGGTTTTATTGATCATCATCAGG + Intronic
999142542 5:149371981-149372003 GGTGTTTATGGAGCATCTGGGGG + Intronic
999724010 5:154419801-154419823 GAGTTTTATTGAGCATCAGCTGG - Exonic
1000115161 5:158147236-158147258 GGGTTTTATTGGGAATCAGGTGG + Intergenic
1001276099 5:170352834-170352856 GTTTTTTATGGAGCAATAGCTGG + Intergenic
1003812524 6:9800687-9800709 GGGTGTTATGGAGCCACTGCAGG - Intronic
1006991410 6:38217909-38217931 GGGTACAATGGAGCAGCAGCAGG - Intronic
1007579857 6:42951317-42951339 GGGTTTTATTGAAAATGAGCCGG + Intergenic
1012015727 6:93848060-93848082 GTATTTTATGGAGCAGCTGCAGG + Intergenic
1013006864 6:106081887-106081909 GGCTTCTATGGAGGATGAGCAGG - Intergenic
1015597360 6:134878519-134878541 GGGATCTATGGAGCGTAAGCAGG - Intergenic
1018626096 6:165780500-165780522 GGGTCTAATGGAGCATCTGTTGG - Intronic
1024888361 7:54171094-54171116 GGGTTTTATTTGGCATCAACTGG + Intergenic
1024969592 7:55056093-55056115 AGGTTTTGAGGAGCATCTGCTGG - Intronic
1029311115 7:99665820-99665842 GGGTTTTCCAGAGCATTAGCAGG - Intronic
1030233857 7:107237292-107237314 GTATTTCATGGAGCATCAGCTGG - Intronic
1031596724 7:123657842-123657864 GGGTTTAGTGGAACATTAGCAGG + Intronic
1033283499 7:140022061-140022083 GGGTTTTTTGGAGGACCAGGCGG - Intergenic
1034538327 7:151739843-151739865 GGGTTTCATGGGGTTTCAGCAGG - Intronic
1045506298 8:102781186-102781208 GGGTCTTATGGAACATTTGCAGG - Intergenic
1052916679 9:33928631-33928653 GGGGCTGATGGAGCATCCGCTGG - Intronic
1054763774 9:69026014-69026036 GGGAGTTATGGGGCATCAGGGGG - Intergenic
1186459841 X:9739554-9739576 GGTTTTCATGGGGCATCAGTGGG + Exonic
1188048332 X:25453529-25453551 TGGGTTTATTGAGCATAAGCAGG + Intergenic
1188207785 X:27380935-27380957 GGCTTTTATGGGGCCTCAGATGG - Intergenic
1190360726 X:49645709-49645731 GGATTTTAGGAAGCATAAGCAGG - Intergenic
1192246857 X:69379865-69379887 GGGTTTTCAGCAGCATCTGCTGG + Intergenic
1195699048 X:107688682-107688704 GGGATTGATGGAGCATAAACTGG - Intergenic
1198041839 X:132860257-132860279 TGGTTTTATGGTGCCTCAGATGG + Intronic
1198446308 X:136719264-136719286 GGGTTTTATGGATCATAATGTGG - Intronic
1200126717 X:153818770-153818792 GGGTTTTCAGGAACATCAGAGGG + Intronic