ID: 916746467

View in Genome Browser
Species Human (GRCh38)
Location 1:167688535-167688557
Sequence CTACCAAGATGCAGCTGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916746467_916746474 -5 Left 916746467 1:167688535-167688557 CCCGCCCAGCTGCATCTTGGTAG 0: 1
1: 0
2: 1
3: 11
4: 157
Right 916746474 1:167688553-167688575 GGTAGAGGAGGCTGAGGCCAAGG 0: 1
1: 0
2: 6
3: 83
4: 865
916746467_916746476 6 Left 916746467 1:167688535-167688557 CCCGCCCAGCTGCATCTTGGTAG 0: 1
1: 0
2: 1
3: 11
4: 157
Right 916746476 1:167688564-167688586 CTGAGGCCAAGGGCTTCGTCTGG 0: 1
1: 0
2: 0
3: 9
4: 150
916746467_916746475 -4 Left 916746467 1:167688535-167688557 CCCGCCCAGCTGCATCTTGGTAG 0: 1
1: 0
2: 1
3: 11
4: 157
Right 916746475 1:167688554-167688576 GTAGAGGAGGCTGAGGCCAAGGG 0: 1
1: 0
2: 6
3: 72
4: 718

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916746467 Original CRISPR CTACCAAGATGCAGCTGGGC GGG (reversed) Intronic
900526851 1:3133569-3133591 TTACCAAGATCCACCTTGGCAGG + Intronic
901622682 1:10601396-10601418 CTGCCTAGCTGCAGCTGAGCTGG - Intronic
901917194 1:12508792-12508814 ATCCTGAGATGCAGCTGGGCTGG + Intronic
904253435 1:29239970-29239992 AAAACAAGATGCAGCTGGACAGG - Intronic
904316549 1:29669839-29669861 CCACCTAGATGCAGGGGGGCTGG - Intergenic
904383236 1:30125362-30125384 CCACCTAGATGCAGTGGGGCTGG + Intergenic
910446111 1:87300267-87300289 CAGCCAAGATGCATCTCGGCAGG - Intergenic
910446112 1:87300268-87300290 CTGCCGAGATGCATCTTGGCTGG + Intergenic
913676628 1:121146915-121146937 CTACCAAACTGAGGCTGGGCTGG + Intergenic
914028525 1:143934865-143934887 CTACCAAACTGAGGCTGGGCTGG + Intergenic
915939415 1:160109408-160109430 CTATCAAGAGGCAGCTGGCTTGG - Intergenic
916212840 1:162372738-162372760 CTGCCAGGCTCCAGCTGGGCTGG - Intronic
916746467 1:167688535-167688557 CTACCAAGATGCAGCTGGGCGGG - Intronic
919639989 1:200038125-200038147 CTTTGAAGATGCGGCTGGGCTGG + Intronic
919812496 1:201417862-201417884 CTCCCAAGGCCCAGCTGGGCAGG - Intronic
920258763 1:204674597-204674619 ATAACAAGCTGCAGGTGGGCAGG - Intronic
920279032 1:204829315-204829337 ACACCAAGAGGCAGCTGGGAAGG - Intronic
920385805 1:205569444-205569466 CGGCCAAGATGGAGCTGGGAGGG - Intronic
920463991 1:206165756-206165778 CTACCAAACTGAGGCTGGGCTGG + Intergenic
920634859 1:207691927-207691949 CTTCCACCACGCAGCTGGGCAGG - Intronic
921909393 1:220529689-220529711 TTATCAAGATGCAGATGTGCCGG + Intronic
923099574 1:230801618-230801640 AAGCCAAGATTCAGCTGGGCAGG - Exonic
1069631689 10:69901169-69901191 CAACCAACATGCAGCCGGGTGGG + Intronic
1070007180 10:72435811-72435833 CTGCAAGGCTGCAGCTGGGCAGG + Intronic
1075071914 10:119325429-119325451 CTCCCAGGAACCAGCTGGGCAGG - Intronic
1076164309 10:128269443-128269465 CCTCCAAGATGCAGCTGGGCAGG + Intergenic
1081479458 11:43471507-43471529 AAACCAAACTGCAGCTGGGCTGG - Intronic
1082957597 11:58886776-58886798 ATACCCACATGAAGCTGGGCTGG - Intronic
1083707430 11:64526012-64526034 CTGCCAAGAGGCTGCTGGGGTGG - Intergenic
1084470951 11:69358673-69358695 CTGGCAAGATGCACCTGGACAGG + Intronic
1088374391 11:109124047-109124069 CTGCCAAACTGCAGCTTGGCAGG - Intergenic
1088849802 11:113695457-113695479 GTACCAACAAGAAGCTGGGCAGG + Intronic
1090648850 11:128789076-128789098 CTAGCAAGCTGCAGCATGGCAGG + Intronic
1090686081 11:129121526-129121548 CTGGCAAGGTGCAGCTGGGCTGG + Intronic
1091282071 11:134387503-134387525 CTACCAAGGCCCAGCTGGGCAGG + Intronic
1091820442 12:3471780-3471802 CCACCAAGACACAACTGGGCTGG + Intronic
1091831562 12:3554095-3554117 CTGCCATGATGCCCCTGGGCAGG - Intronic
1092732296 12:11546189-11546211 CTAAGAAAATTCAGCTGGGCAGG + Intergenic
1095468645 12:42513545-42513567 ATAGCAAGATGCTGTTGGGCTGG + Intronic
1096868744 12:54580155-54580177 CTTCCCAGAGGCAGCTTGGCAGG + Exonic
1097855371 12:64456231-64456253 CTACCATTAGGGAGCTGGGCTGG - Intronic
1100758459 12:97778205-97778227 CTTCCACTATGCAGCTGTGCTGG - Intergenic
1101396680 12:104354946-104354968 CTACAAAGATGATGATGGGCAGG - Intergenic
1102642527 12:114379524-114379546 CTCCCAAGCTTAAGCTGGGCTGG - Intronic
1103248933 12:119483239-119483261 CTACCAAAAGGCACCAGGGCTGG + Intronic
1106467430 13:30025349-30025371 CAACCTACATGCAGCAGGGCTGG + Intergenic
1112505959 13:99975674-99975696 CTACTAAAATACAGCTGTGCCGG - Intergenic
1116358428 14:43961424-43961446 CTTCCAATATGCAGCTAGGATGG - Intergenic
1120542510 14:85767510-85767532 CTACAAAGATGCAACTGAGCTGG - Intergenic
1121337282 14:93085096-93085118 AAACCAAGATGCCGCAGGGCAGG - Intronic
1121505714 14:94474993-94475015 CCTCAAAGATGCAGCTGGGGAGG - Intronic
1121525142 14:94614323-94614345 CTAGCAAGAGGCAGCAGGACAGG + Exonic
1122211102 14:100174722-100174744 CTAGCCAGATGCAGCCGTGCAGG - Intergenic
1127303865 15:57683205-57683227 CTACCAAGCTGCAGCCTGGCTGG + Intronic
1128449038 15:67791070-67791092 CATCCGAGCTGCAGCTGGGCAGG + Intronic
1133212321 16:4270634-4270656 CTACCAAGATCCAGCTACCCTGG + Intronic
1134091926 16:11396195-11396217 GTACCAGGAGGCAGCTAGGCTGG + Intronic
1136246450 16:28979062-28979084 CTCCCAAGAGGCAGCAGGGATGG - Intronic
1139640086 16:68285309-68285331 TTCCCAAGAAGGAGCTGGGCAGG + Intronic
1139847717 16:69932539-69932561 CTGCCCAGATGCTGCTGGCCTGG - Intronic
1141234418 16:82202144-82202166 CCACCAAGCAGCAGCTGAGCAGG + Intergenic
1142294383 16:89210856-89210878 CTGCCAAGATGATGCAGGGCAGG - Intergenic
1144061156 17:11583928-11583950 CTGCCATGATGGGGCTGGGCTGG - Intergenic
1146660454 17:34662169-34662191 CTACCTAGAAGCAGCAGTGCTGG - Intergenic
1146892641 17:36515925-36515947 CTCCCAAGATGCAGGTGAGGTGG + Exonic
1148693087 17:49544325-49544347 CTGCCAGGATGCAGGAGGGCAGG + Intergenic
1150521148 17:65867169-65867191 CTGCAAAGTTGCAGCTGGACTGG - Intronic
1151385624 17:73753597-73753619 CTACCTAGATGAGGCTGGGTGGG + Intergenic
1151829301 17:76540279-76540301 CCACCAAGCTGAAGGTGGGCAGG + Intronic
1152236034 17:79139377-79139399 GGGCCAAGATGCGGCTGGGCAGG - Intronic
1152363962 17:79844671-79844693 CTACCAGGATTCAGGAGGGCGGG - Intergenic
1152586920 17:81193322-81193344 CTCCCCAGATGCAGCTTGGCTGG - Intronic
1152701440 17:81821812-81821834 CTGCCAGGCGGCAGCTGGGCTGG + Intergenic
1152783305 17:82235921-82235943 CTGCCAGGCTGCAGCTGGGATGG + Exonic
1152994598 18:394808-394830 CTACCAAGAGGCAGCTGGCATGG - Intronic
1156458479 18:37307911-37307933 CCAACAACATGGAGCTGGGCAGG + Intronic
1157338479 18:46757772-46757794 CTGCCGAGTTGCAGCTGGGGAGG - Intronic
1157726488 18:49968256-49968278 ATAACAAGATGCAGATGAGCTGG + Intronic
1158266905 18:55669284-55669306 GTACCAAGTTTCAGTTGGGCAGG + Intergenic
1159287344 18:66371868-66371890 CTACCCAGATTAAGCTGGGGGGG - Intergenic
1162801446 19:13112911-13112933 CTTCCTGGATGCAGCTGTGCAGG - Exonic
1163697560 19:18771703-18771725 CTACCAGGCTGCACCAGGGCAGG + Intronic
1166006881 19:39914209-39914231 CTTCCAAGCAGCAGATGGGCAGG - Exonic
1166043568 19:40217057-40217079 CTACCTAGAAGCAGCTCCGCGGG + Intronic
1166554230 19:43687702-43687724 TTAGCCAGATGCAGCTGGGTGGG + Intergenic
1167117478 19:47496673-47496695 CTACCAAGAAGCGCCGGGGCTGG + Intronic
1167797140 19:51716856-51716878 GAACAAAGATGCAGCAGGGCAGG - Intronic
925476284 2:4220053-4220075 CTTCCATGATGAGGCTGGGCAGG - Intergenic
930019783 2:46994525-46994547 CTGGCAAGGTGCAGCAGGGCAGG - Intronic
930818538 2:55622487-55622509 GTACTAAGATGCAGCTGGAGAGG - Intergenic
934577660 2:95413234-95413256 CCAAAAAGATGCTGCTGGGCTGG + Exonic
934639952 2:96021937-96021959 CCAAAAAGATGCTGCTGGGCTGG + Exonic
934793695 2:97083459-97083481 CCAAAAAGATGCTGCTGGGCTGG - Intergenic
936482964 2:112902138-112902160 ATAACAAGATGCAGATGAGCTGG - Intergenic
936696701 2:114958417-114958439 GTACAAAGTTTCAGCTGGGCAGG + Intronic
937960342 2:127453466-127453488 TTACCAGGATGCCGCTGGACAGG + Intronic
944333074 2:198495223-198495245 CAAGCAAGATGCATCTGGTCAGG + Intronic
946412291 2:219521431-219521453 CTCCCAAGAAGCAGAAGGGCAGG - Intronic
947645181 2:231733668-231733690 CTTGGAAGATGCAGATGGGCAGG - Intronic
948470408 2:238173854-238173876 CCACCCATGTGCAGCTGGGCAGG - Intronic
948685748 2:239668606-239668628 CTTCCAAGGTGCACGTGGGCAGG - Intergenic
948804568 2:240447902-240447924 CAACCAGGAAGCAGCTGCGCCGG - Intronic
1180791561 22:18577935-18577957 CTTCCAAGATGGCGCTGGGCGGG - Intergenic
1181059362 22:20274498-20274520 CTACCAAGGTGCATGTGTGCAGG + Intronic
1181230179 22:21417376-21417398 CTTCCAAGATGGCGCTGGGCGGG + Intergenic
1181248470 22:21517487-21517509 CTTCCAAGATGGCGCTGGGCGGG - Intergenic
1182627741 22:31660499-31660521 CAAAAAAAATGCAGCTGGGCGGG + Intronic
1183261914 22:36800637-36800659 CTTTCCAGATGCATCTGGGCAGG - Intergenic
1183545822 22:38454578-38454600 CAACGAGGATGCAGCTGGGGAGG + Intronic
1184413507 22:44339009-44339031 TGACCAAGAGGCAGGTGGGCAGG - Intergenic
1184878567 22:47290830-47290852 CTACCTGGCTGCAGCTGTGCTGG - Intergenic
1185245827 22:49772243-49772265 TTAACAATATGCAGCTGGCCAGG + Intergenic
951283041 3:20776218-20776240 TGACCAAGATGCAGGTGGCCTGG - Intergenic
951478059 3:23129684-23129706 ATACCAGGATGCTGTTGGGCAGG + Intergenic
953504681 3:43473407-43473429 CTACCATGATAAAGCTGGTCTGG + Intronic
956435562 3:69231582-69231604 TTAGAAGGATGCAGCTGGGCCGG - Intronic
958027058 3:88060013-88060035 CTCACAAGATCCCGCTGGGCCGG + Intronic
958173928 3:89971420-89971442 CTCCCAATATGCAGCAGGGGTGG + Intergenic
959774011 3:110134957-110134979 GTACCAAGAGGCAACTGAGCTGG + Intergenic
961113242 3:124303723-124303745 ATAACAATGTGCAGCTGGGCGGG + Intronic
961550384 3:127667538-127667560 CTTCCTAGATGGGGCTGGGCAGG + Intronic
964871263 3:161316086-161316108 CTTCCAACAAGCAGCAGGGCTGG + Intergenic
970321265 4:14877796-14877818 CCACAAAGATCCGGCTGGGCAGG + Intergenic
972843686 4:42961777-42961799 CTGCCAAGATGCACGTGGACAGG - Intronic
972987106 4:44778080-44778102 CTACGAACATGCAGCTGGTAAGG + Intergenic
973730416 4:53817169-53817191 ATAGCAAAATGCAGCTGGGTGGG - Intronic
979355377 4:119697412-119697434 CTTCCCAGATGCAGATGGCCTGG - Intergenic
980825050 4:138063104-138063126 CTAGCCAGTTGCAGCTGAGCAGG - Intergenic
981062560 4:140441044-140441066 TTACCAAGATAAATCTGGGCAGG - Intergenic
984765091 4:183394253-183394275 CTACCGAGGGGCAGCTGTGCTGG + Intergenic
984765479 4:183397665-183397687 CTAGAAAGATTCAGCGGGGCAGG + Intergenic
985723218 5:1501532-1501554 CTGCCATGATGCTGCTGGCCTGG - Exonic
986720549 5:10558064-10558086 TTTCCAAGATGCAGCAGAGCTGG + Intergenic
988519292 5:31931504-31931526 ACACCCAGCTGCAGCTGGGCAGG + Intronic
992762094 5:79959609-79959631 CTTCCAACACGCAGCTGTGCTGG + Intergenic
995321228 5:110836575-110836597 ATAACAAGATGCAGATGGACTGG + Intergenic
1002135429 5:177104754-177104776 CTACCCAGATGCTGCTGATCTGG + Intergenic
1002395217 5:178947154-178947176 CTACCAACATGTAGCAGGCCTGG + Intronic
1003298074 6:4851989-4852011 CCACCAAGAAGCAACTGGCCTGG - Intronic
1006298391 6:33180176-33180198 TTACCAAGAACCAGATGGGCAGG - Intronic
1006543457 6:34759293-34759315 CATCAAAGAGGCAGCTGGGCTGG + Intronic
1009686633 6:66966698-66966720 ATAACAAGATGCAGATGGACTGG - Intergenic
1017019507 6:150129032-150129054 CTACCTAGCTACAGCTGGGGAGG + Intergenic
1018758787 6:166872409-166872431 GGGCCAAGAAGCAGCTGGGCTGG + Intronic
1019076972 6:169395526-169395548 CTACCAAGAAGCCCTTGGGCTGG - Intergenic
1019161845 6:170074150-170074172 GTTCCCAGATGCAGCTGAGCAGG + Intergenic
1024261789 7:47578924-47578946 CCACCAAAATGCTGCTGAGCAGG - Intronic
1024348801 7:48341299-48341321 CTACCATGCTCCACCTGGGCAGG + Intronic
1031998303 7:128247293-128247315 ATTCCAAGCGGCAGCTGGGCAGG + Intronic
1032513389 7:132489742-132489764 CTCCCAAGATGGCGCTGGGAGGG - Intronic
1034110137 7:148529021-148529043 TTAGCAAGAGCCAGCTGGGCTGG - Intergenic
1034860570 7:154591616-154591638 CTCCCAGCATGCAGCTGGGCGGG - Intronic
1038865261 8:31432687-31432709 TTACAAAGATACAGCTGGGTAGG - Intergenic
1040865808 8:52047935-52047957 CTAAAAAGATGGAGCTGAGCTGG - Intergenic
1044194603 8:89359276-89359298 CTGTCAAAATCCAGCTGGGCTGG + Intergenic
1044598567 8:93981455-93981477 CTACAAAGATACAACTGGGATGG + Intergenic
1052395467 9:27933115-27933137 CTACCAAGGAGCAGCTCTGCTGG - Intergenic
1056293518 9:85168336-85168358 CTACCCTAATGCATCTGGGCAGG + Intergenic
1057169793 9:92954816-92954838 CTAGCAAGATGCAGCTGAGGTGG - Intronic
1060222533 9:121772324-121772346 GTCCCAAGATGCAGCTGAACAGG + Intronic
1061416244 9:130448524-130448546 CTGCCAGGTTGTAGCTGGGCAGG - Intronic
1061873878 9:133534536-133534558 CAGCCAACAGGCAGCTGGGCCGG + Intronic
1061923469 9:133794724-133794746 CCACCCAGATGCAGCTGGAGGGG + Intronic
1062050949 9:134446767-134446789 CAAAGAAGATGCTGCTGGGCAGG - Intergenic
1062340670 9:136092662-136092684 CTACCAAGGTGAAGGTGGACTGG + Intronic
1187622944 X:21078885-21078907 CTCCCAAGCAGCTGCTGGGCTGG + Intergenic
1188327422 X:28822738-28822760 GTAGCAAGATGCAGTTGGACAGG - Intronic
1188742963 X:33809033-33809055 CTACCATCCTGCAGCTGAGCTGG + Intergenic
1199248142 X:145630856-145630878 CTTCCTGGATGCAGCTGTGCTGG + Intergenic
1202042006 Y:20695612-20695634 CTGCAAAGCAGCAGCTGGGCAGG - Intergenic