ID: 916748255

View in Genome Browser
Species Human (GRCh38)
Location 1:167701048-167701070
Sequence TTGGGAATACGGAAGTGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916748255_916748263 -5 Left 916748255 1:167701048-167701070 CCTTGCCACTTCCGTATTCCCAA 0: 1
1: 0
2: 0
3: 10
4: 121
Right 916748263 1:167701066-167701088 CCCAACAGAGCCTTGGGCAGGGG 0: 1
1: 0
2: 0
3: 19
4: 255
916748255_916748261 -6 Left 916748255 1:167701048-167701070 CCTTGCCACTTCCGTATTCCCAA 0: 1
1: 0
2: 0
3: 10
4: 121
Right 916748261 1:167701065-167701087 TCCCAACAGAGCCTTGGGCAGGG 0: 1
1: 0
2: 3
3: 23
4: 185
916748255_916748260 -7 Left 916748255 1:167701048-167701070 CCTTGCCACTTCCGTATTCCCAA 0: 1
1: 0
2: 0
3: 10
4: 121
Right 916748260 1:167701064-167701086 TTCCCAACAGAGCCTTGGGCAGG 0: 1
1: 0
2: 4
3: 18
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916748255 Original CRISPR TTGGGAATACGGAAGTGGCA AGG (reversed) Intronic
900806774 1:4772675-4772697 TTGGCAAAACGAAAGAGGCAGGG + Intronic
901153226 1:7118237-7118259 TTGGGAGTACAGGAGTGGCAGGG + Intronic
901853825 1:12031694-12031716 TGGGGAATAGGGAAGTCTCAGGG - Intronic
902910583 1:19594057-19594079 TTAGGGATACAGAAATGGCACGG + Intergenic
903049086 1:20587658-20587680 TGGGGAATGGGGAAGGGGCAGGG - Intergenic
904823787 1:33261777-33261799 TTGGGGAAACTGAAGTGGGAAGG + Intronic
909981863 1:82112651-82112673 ATGGGGACACGGAAGTGTCAGGG + Intergenic
915434424 1:155892897-155892919 TTTGGAATGCTGAAGTGGTACGG - Intergenic
916078050 1:161214543-161214565 TGGGGAATAGAGAAGTGGAAAGG - Intergenic
916737046 1:167617414-167617436 TTGGTAAGAAGGAAGTGGGATGG - Intergenic
916748255 1:167701048-167701070 TTGGGAATACGGAAGTGGCAAGG - Intronic
917098645 1:171424555-171424577 TTGGGAATGGGGAATAGGCAAGG - Intergenic
919339688 1:196288515-196288537 TTGTGAATGAGGAGGTGGCATGG + Intronic
921294363 1:213688231-213688253 TTGGGGAGAAGGAAGTGGGAGGG - Intergenic
921891690 1:220360178-220360200 ATGAGAATAGGGGAGTGGCATGG - Intergenic
922025652 1:221746237-221746259 TGAGGAATAGGAAAGTGGCATGG + Intergenic
922816310 1:228452313-228452335 ATGGGAAAAAGGAAGTGTCAGGG + Intergenic
923082003 1:230666583-230666605 TGAAGAATACAGAAGTGGCAAGG - Intronic
1064215050 10:13393334-13393356 TTGGGGAGACGGGAGGGGCACGG + Intergenic
1066070368 10:31802602-31802624 TTATGAATATAGAAGTGGCAGGG - Intergenic
1073877912 10:107947091-107947113 TTAGGAATAAGGAATTGGAATGG + Intergenic
1077264158 11:1640805-1640827 GTGGGAAGATGGAAGTGGCCCGG - Intergenic
1080368841 11:31610511-31610533 TGGGGAATACGGAGGGGGGAAGG - Intronic
1082226067 11:49708635-49708657 TTGGGAATACGTGACTTGCATGG + Intergenic
1084657403 11:70527464-70527486 TGGGGAATCCTAAAGTGGCATGG + Intronic
1085205119 11:74727025-74727047 TTTGGAATAGGGATGTGGGAGGG - Intronic
1085640841 11:78191679-78191701 CTGGGAACACCGAAGTGGCAGGG + Intronic
1088155957 11:106803849-106803871 TTGGAGATAAGGAAGAGGCAAGG - Intronic
1089528206 11:119110458-119110480 TTAGGAAAACGGAAGTGGGGAGG + Intronic
1092153401 12:6266706-6266728 CTGGGAATAGGGAGGTGGCTGGG + Intergenic
1096912479 12:54998204-54998226 TTGGGAGTAAGGAAGAGGAAAGG - Intergenic
1097832495 12:64240391-64240413 TTGGGTATAAGGTAGAGGCAGGG - Intergenic
1102740672 12:115204804-115204826 TTGGGAATTTGGAAATGGCCTGG + Intergenic
1105607665 13:21940133-21940155 TTGGGGATACAGAGGGGGCATGG + Intergenic
1109872471 13:68351993-68352015 TTGGAAATAAGGAAGGGGCTTGG - Intergenic
1119494281 14:75065089-75065111 TTGGGAACAGGGAATTGTCAAGG + Intronic
1120019362 14:79510897-79510919 ATGGGAATACAGATGAGGCAGGG - Intronic
1120501184 14:85299148-85299170 TTTGGAAAACGAAAGAGGCATGG - Intergenic
1124556377 15:30729509-30729531 TTGGCAATAAGGAAGGGGAATGG + Intronic
1124674896 15:31676261-31676283 TTGGCAATAAGGAAGGGGAATGG - Intronic
1127204443 15:56698776-56698798 TTGGGAAGACCTACGTGGCAAGG + Intronic
1130829375 15:87583967-87583989 CTGTGAATACGGAAGAAGCAAGG + Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1133630606 16:7616772-7616794 TTTGGAATACCGAGGTGGGAGGG - Intronic
1135861082 16:26056663-26056685 TTGGGAGCAGGGCAGTGGCAGGG - Intronic
1146723125 17:35137246-35137268 TTGGGAATGGGGAGGTGCCATGG - Intronic
1149439530 17:56663036-56663058 CTGAGGATACGGAAGAGGCAGGG + Intergenic
1150479673 17:65499527-65499549 TTGGGAATATGGGAGTGGGAAGG + Intergenic
1153468211 18:5413506-5413528 TTGGCAAAACGAAAGTGACAAGG + Intronic
1155895131 18:31315803-31315825 TTGTGAATACGGAAATGAAATGG + Intergenic
1158892697 18:61887868-61887890 GTGGGAATGCGATAGTGGCAGGG + Intronic
1163430165 19:17262693-17262715 TTGGGAAGCAGGAAGGGGCAGGG - Exonic
1166510840 19:43407835-43407857 TTGGGAAACCGGCAGTGGGAAGG + Intronic
1166945418 19:46393339-46393361 TCGGGAAAACGGAAGGGCCATGG + Intergenic
925491420 2:4399518-4399540 TTCCGAATACAAAAGTGGCAGGG - Intergenic
939779780 2:146431627-146431649 TTGGGAAGAAGGGAGAGGCAGGG + Intergenic
941267409 2:163379622-163379644 TTAAGAATACGGAATTGGCAAGG - Intergenic
942042759 2:172081766-172081788 TTGGGCTTTCGGAAGCGGCAAGG + Exonic
943209125 2:184940075-184940097 TTGAGAATCTGGAAGTGGGATGG + Intergenic
944545063 2:200790939-200790961 TTGGGAGTAGGGATGTGGCTAGG - Intergenic
945528065 2:210913560-210913582 TTGGGAAGATGGAAGTGGTGAGG + Intergenic
1172843882 20:37918175-37918197 ATTGGGATAGGGAAGTGGCAGGG + Intronic
1174295307 20:49541276-49541298 TTGGGAGTACCGCAGTGGCCTGG - Intronic
1175407348 20:58743862-58743884 TTGGGAATAAGAAAGTGCAATGG + Intergenic
1176412424 21:6456301-6456323 TTGGGAATCCGGTGTTGGCATGG - Intergenic
1177917439 21:27107150-27107172 ATGGAAATACTGAAGTGACAGGG - Intergenic
1178822313 21:35986662-35986684 TGGGGAATACAGAAGTGACTGGG + Intronic
1179227605 21:39468816-39468838 TTGGGAATAAGGAATTGCAATGG - Intronic
1179349830 21:40597882-40597904 TTGAGTATAGGGGAGTGGCAGGG - Intronic
1179687918 21:43064623-43064645 TTGGGAATCCGGTGTTGGCATGG - Intronic
1184729694 22:46365772-46365794 TTGGGAACACAGAAGGGGTAGGG - Intronic
950352703 3:12372702-12372724 TTGGGAGTATGGAAGTGGGTTGG - Intronic
951062063 3:18220756-18220778 ATGGGAAGAAGGAAGTGGTAAGG + Intronic
958832829 3:99110338-99110360 TATGGAATAAGGAAGGGGCATGG - Intergenic
963242851 3:143026944-143026966 GTGGGAGTAGGGAAGTGGGAGGG - Intronic
964237512 3:154550134-154550156 CTGGGAATATGGATTTGGCAGGG + Intergenic
968174241 3:196535411-196535433 TGGGTAATACGGTAGTAGCATGG + Intergenic
973253862 4:48088955-48088977 GTGAGAATACGTAAGTGCCAGGG - Intronic
973755202 4:54067230-54067252 CTGGGTATACGGTAGAGGCAGGG + Intronic
975684202 4:76903626-76903648 TTTGGAAGAAGGAAGTGGTATGG + Intergenic
976810089 4:89091271-89091293 TTGGGAGAACGGAAGAGGAAGGG - Intronic
977247903 4:94655607-94655629 TTGGGAACAAAGAAGTGGAATGG + Intronic
978158797 4:105520855-105520877 TTGGGAATACAGCAGTATCAAGG + Intergenic
978190735 4:105908233-105908255 TTGAGAATAAGGATTTGGCATGG + Intronic
981285294 4:143010472-143010494 TTGGGAATACTGGAGTGAGAAGG + Intergenic
981452043 4:144909826-144909848 TAGGAAATATGGAAGGGGCAGGG + Intergenic
990824822 5:59887015-59887037 CTGGAACTAGGGAAGTGGCAAGG + Intronic
992458276 5:76936819-76936841 ATGGGAAGAGGGAAGAGGCAAGG + Intergenic
992701965 5:79349909-79349931 TTGGGAATAGGGCAGTGCAATGG + Intergenic
993390645 5:87316620-87316642 GTGGGAGTAAGGAAGTTGCATGG + Intronic
994009310 5:94881646-94881668 TTTGGAAAACTGAAGAGGCATGG - Intronic
994517498 5:100789189-100789211 TTTTGAATACGGAATTGGTATGG + Intergenic
999177248 5:149640099-149640121 TTGGGAAATGGGAAGTGGGATGG + Intergenic
1000645327 5:163754591-163754613 TTTGGAATGCAGAAGAGGCAAGG - Intergenic
1001427471 5:171632958-171632980 TTAGGAATAAGGAAATGGAAGGG - Intergenic
1008356158 6:50555901-50555923 TTAGGAAAAGGGAAGTTGCATGG + Intergenic
1008566058 6:52769649-52769671 TTGGGATTATGTAAATGGCAGGG - Intergenic
1008570252 6:52809979-52810001 TTGGGATTATGTAAATGGCAGGG - Intergenic
1009670283 6:66740229-66740251 TTAGGAAGAAGGACGTGGCAGGG - Intergenic
1010476204 6:76291273-76291295 TTGGGAAGATAGAATTGGCAGGG - Intergenic
1016240575 6:141924910-141924932 TTGGGAATATGGAAATGGAGAGG - Intergenic
1017789727 6:157786471-157786493 TTGGGAAAAGGAAAGTGGAATGG + Intronic
1020303530 7:6814781-6814803 TTGGGAAAAGGGAGGTGGTAAGG + Exonic
1023224335 7:37953142-37953164 CTGGCAATTTGGAAGTGGCAAGG - Intronic
1023695373 7:42840545-42840567 TTGGGAAATGGGAAGTGGAAAGG + Intergenic
1024313720 7:47993871-47993893 TTGGGAAGATGGAAGTGCCATGG + Intronic
1024361836 7:48476491-48476513 TTTGGAATGCAGAAGAGGCAGGG + Intronic
1030803049 7:113878017-113878039 TTGAGAATATGGAAGAAGCAAGG - Exonic
1030874599 7:114797645-114797667 TTTTGAAGACGGAAGTAGCATGG + Intergenic
1033760148 7:144428751-144428773 TTGAGAATAAGGAAGTGACATGG - Intergenic
1035134178 7:156684539-156684561 TTGGGACAACGGAAGAGGAAGGG - Intronic
1035409384 7:158626796-158626818 TTTGGAATGCGGAAGAGGCAAGG - Intergenic
1038010356 8:23471054-23471076 TCTGGAATTTGGAAGTGGCAAGG - Intergenic
1038865620 8:31436080-31436102 TTTGGAATGCAGAAGAGGCAGGG - Intergenic
1039044068 8:33434399-33434421 TTGGGAATATGGGAGTGGGAGGG - Intronic
1044113213 8:88302647-88302669 TTGGAAATGCAGAAGTGGAAGGG + Intronic
1044932281 8:97261585-97261607 TTGTTAATAAGGAAGTGGGAGGG - Intergenic
1057955380 9:99403199-99403221 TTGGGTATATGGAGGAGGCAGGG + Intergenic
1060459236 9:123833491-123833513 TTGGGAATTAGGAATTGGCAGGG - Intronic
1060872247 9:127051924-127051946 TTGGAAATACTTAAGTGACAGGG + Intronic
1061728502 9:132595036-132595058 TTCGGAATACTCAAGCGGCATGG - Exonic
1061910081 9:133717695-133717717 TTGTGAGTAGGGAAGGGGCATGG - Intronic
1062246940 9:135573947-135573969 TGGGGAATAGAGAAATGGCAGGG + Intergenic
1185609154 X:1384263-1384285 TGGGGAATTCGGTAGTGGCGGGG - Intergenic
1186054672 X:5636652-5636674 TTGGCAATAGGTGAGTGGCAGGG - Intergenic
1186513996 X:10152513-10152535 TGGGGAATAAGTAAGTGACATGG - Intergenic
1191689527 X:63925732-63925754 TTTGGAATGCAGAAGAGGCAGGG - Intergenic
1192556777 X:72096300-72096322 TTGGGAGTGAGGAAGAGGCAAGG + Intergenic
1196539852 X:116894996-116895018 ATGGGAGAATGGAAGTGGCAAGG - Intergenic
1198521801 X:137460607-137460629 TTGGGAATAGGGGAGGAGCAGGG + Intergenic
1198851107 X:140966256-140966278 TTTGGAATGCAGAAGAGGCAAGG - Intergenic
1198886269 X:141342109-141342131 TTGGGATTACAGAAGTTGCATGG + Intergenic