ID: 916749768

View in Genome Browser
Species Human (GRCh38)
Location 1:167713767-167713789
Sequence TGCGGGGTCTCCCGCCGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916749768_916749778 15 Left 916749768 1:167713767-167713789 CCACACCGGCGGGAGACCCCGCA No data
Right 916749778 1:167713805-167713827 CTCTGAGCAGAAGAGCAGTAGGG No data
916749768_916749779 19 Left 916749768 1:167713767-167713789 CCACACCGGCGGGAGACCCCGCA No data
Right 916749779 1:167713809-167713831 GAGCAGAAGAGCAGTAGGGCAGG No data
916749768_916749777 14 Left 916749768 1:167713767-167713789 CCACACCGGCGGGAGACCCCGCA No data
Right 916749777 1:167713804-167713826 CCTCTGAGCAGAAGAGCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916749768 Original CRISPR TGCGGGGTCTCCCGCCGGTG TGG (reversed) Intergenic
No off target data available for this crispr