ID: 916751715

View in Genome Browser
Species Human (GRCh38)
Location 1:167728973-167728995
Sequence ATGCTGTTATCGGCCGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 667
Summary {0: 1, 1: 0, 2: 8, 3: 87, 4: 571}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916751707_916751715 29 Left 916751707 1:167728921-167728943 CCCTGATATTCTACTTTAGGATC 0: 1
1: 0
2: 1
3: 8
4: 112
Right 916751715 1:167728973-167728995 ATGCTGTTATCGGCCGGGCATGG 0: 1
1: 0
2: 8
3: 87
4: 571
916751708_916751715 28 Left 916751708 1:167728922-167728944 CCTGATATTCTACTTTAGGATCT 0: 1
1: 0
2: 4
3: 16
4: 181
Right 916751715 1:167728973-167728995 ATGCTGTTATCGGCCGGGCATGG 0: 1
1: 0
2: 8
3: 87
4: 571

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916751715 Original CRISPR ATGCTGTTATCGGCCGGGCA TGG Intronic
900282524 1:1880221-1880243 ATACTGTTCTTGGCTGGGCATGG - Intronic
900317431 1:2065386-2065408 GTGGTGTGATCGGCCGGGCGCGG + Intronic
900692501 1:3989077-3989099 ATGCTGTTTTTGGCCAGGCGGGG - Intergenic
902205289 1:14864023-14864045 AGGCTGTTATGAGCCAGGCATGG + Intronic
902294234 1:15455497-15455519 ATGCACTTTACGGCCGGGCACGG - Intergenic
902329464 1:15724192-15724214 ATGGAGTTCTCGGCCGGGCACGG + Intronic
902422874 1:16295681-16295703 ATTCATTTATTGGCCGGGCATGG - Intronic
902900187 1:19509664-19509686 ATGATCTTGTGGGCCGGGCATGG + Intergenic
902956109 1:19924955-19924977 AACCTTTTATCGGCCGGGCACGG + Intergenic
902967741 1:20021914-20021936 ATGTTGTCACCTGCCGGGCACGG + Intergenic
903249226 1:22040410-22040432 ATCCTGTTCTTGGCCAGGCATGG + Intergenic
903908498 1:26704565-26704587 ATACTGTTTTTGGCCGGGCGCGG + Intronic
904017320 1:27432356-27432378 AGGCAGTTATAGGCCGGGCGCGG + Intronic
904107913 1:28101350-28101372 AAGCTGCTATGGGCCGGACATGG + Intergenic
904116780 1:28168259-28168281 ATCCTGTTTTCTGCCGGGCGCGG - Intronic
904138620 1:28333953-28333975 ATAGTGTTATTGGCTGGGCATGG + Intronic
904318787 1:29683127-29683149 ATCCTGTTATGGGCCTGGCTGGG + Intergenic
904545769 1:31270147-31270169 ATAGTGTTATTGGCTGGGCAGGG - Intronic
904730517 1:32587488-32587510 ATGCTGTGATTGGCTGGGCGTGG + Intronic
905222517 1:36458517-36458539 ATGCTATTTGCGGCCAGGCACGG - Intronic
905245716 1:36611964-36611986 ATGCTGTTACGGGCAGGGTATGG + Intergenic
905431637 1:37928780-37928802 ATGCTGTTTTTGGCTGGGCGCGG - Intronic
907294465 1:53440706-53440728 ATTCTGTTATAGGCTGGGCACGG - Intergenic
908201678 1:61802381-61802403 ATGTTGATATTGGCTGGGCACGG - Intronic
908623880 1:66018125-66018147 ATGTGGTTTTAGGCCGGGCACGG + Intronic
910477345 1:87621412-87621434 AAGCAGTTATCGGCCGGGCGTGG + Intergenic
910684552 1:89902812-89902834 ATCCTTTTATTGGCTGGGCACGG - Intronic
910972250 1:92867794-92867816 AAGCAGTTTACGGCCGGGCACGG - Intronic
910980378 1:92954663-92954685 AAGGTGTTGTCGGCTGGGCACGG - Intronic
911086793 1:93985504-93985526 ATGATTTACTCGGCCGGGCATGG - Intergenic
911324300 1:96451467-96451489 ATTGTGGTATTGGCCGGGCATGG + Intergenic
911956123 1:104237274-104237296 ATGCATTTATAGGCTGGGCACGG + Intergenic
912368648 1:109155466-109155488 ATGATGTTCACGGCCGGGCTTGG - Intronic
912395920 1:109343938-109343960 ATTCTGTTTTGGGCCGAGCATGG - Intronic
914822190 1:151113176-151113198 ATGCTGTGATTGGCCGGGTGCGG + Intronic
915728196 1:158033688-158033710 ATGAAGTTTTCGGCCGGGCATGG + Intronic
915975156 1:160380882-160380904 ATGCTCATATAGGCCGGGCGCGG - Intergenic
916099085 1:161378388-161378410 ATGCTGTTAATGGCCGGACGCGG + Intergenic
916684247 1:167130308-167130330 ATGGTGTTATTAGCCTGGCATGG + Intergenic
916751715 1:167728973-167728995 ATGCTGTTATCGGCCGGGCATGG + Intronic
917165436 1:172107148-172107170 ATAATGTTACCGGCCGGGCGCGG - Intronic
917440969 1:175068614-175068636 ATGATGTGGTTGGCCGGGCATGG + Intronic
917646755 1:177036335-177036357 AAGCTGAGGTCGGCCGGGCACGG - Intronic
918102507 1:181388596-181388618 ATGGTATTATAAGCCGGGCACGG + Intergenic
918271096 1:182900719-182900741 ATTTTGTTATTGGCTGGGCATGG - Intronic
918280614 1:183001348-183001370 ATACTGTTCCTGGCCGGGCATGG + Intergenic
919305076 1:195822064-195822086 ATGCTTTTTTAGGTCGGGCACGG + Intergenic
919407245 1:197200978-197201000 ATGCTTTCCTCGGGCGGGCAAGG + Intergenic
919918198 1:202152199-202152221 ATCCTATTATTGGCCGGGCACGG - Intronic
920237467 1:204517690-204517712 CTGTGGTTTTCGGCCGGGCACGG - Intronic
920547100 1:206827398-206827420 ACGCTTCTCTCGGCCGGGCACGG + Intronic
921204325 1:212835231-212835253 ATCCTATCATAGGCCGGGCACGG + Intronic
921377841 1:214492615-214492637 AATGTGTTGTCGGCCGGGCATGG + Intronic
921537448 1:216369620-216369642 AAGCTAGTATGGGCCGGGCATGG + Intronic
921922336 1:220683855-220683877 GTGCTGTGCTTGGCCGGGCACGG + Intergenic
922168989 1:223139411-223139433 ATGCTGTTAGAGGCTGTGCAGGG + Intronic
923093600 1:230757765-230757787 ATGCTGTTATCTGCAGGGGGTGG + Intronic
1064333390 10:14415650-14415672 GTGCTATTATTGGCTGGGCATGG - Intronic
1064577558 10:16761564-16761586 ATGCCATTCTCAGCCGGGCACGG + Intronic
1064592560 10:16909366-16909388 ATACTGTTATCTGCCTGGGAGGG - Intronic
1064708049 10:18093277-18093299 ATCCTGTTATTGGCCTGGCACGG - Intergenic
1065354573 10:24827368-24827390 ACGCTTTTCTTGGCCGGGCATGG - Intergenic
1066483751 10:35823953-35823975 ATGCTACTGTAGGCCGGGCATGG + Intergenic
1066552337 10:36572664-36572686 ATGATGTTTTTGGCCGGGCACGG - Intergenic
1068694301 10:59949335-59949357 AGTCTGGTTTCGGCCGGGCACGG - Intergenic
1069229851 10:65995949-65995971 AGGCTGTGATCGGCAGGCCAGGG + Intronic
1069372773 10:67765084-67765106 ATGATGTTAATGGCCGGGCGCGG + Intergenic
1069426765 10:68295200-68295222 AAGCTCTTATTGGCCGGGCGTGG + Intronic
1069499056 10:68933358-68933380 ATGCTGCAATGGGCCGGGCATGG - Intronic
1070063528 10:73010256-73010278 CTGCTGAAAACGGCCGGGCACGG - Intronic
1070912240 10:80128691-80128713 ATGCCATTATTGGCCAGGCATGG - Intergenic
1071514302 10:86286986-86287008 ATGCTCTTATAGGCTGGTCAGGG + Intronic
1072088186 10:92100879-92100901 AAACTGTTCTTGGCCGGGCACGG - Intronic
1072119924 10:92397133-92397155 ATGCTAATATTGGCTGGGCATGG + Intergenic
1072213192 10:93265487-93265509 TTGCCGTTATAGGCCAGGCACGG - Intergenic
1072698074 10:97619032-97619054 AGGCTGGCATGGGCCGGGCATGG + Intronic
1072702087 10:97649912-97649934 AAGGTATTATGGGCCGGGCATGG - Intronic
1072707186 10:97689124-97689146 AACCTTTTAGCGGCCGGGCATGG - Intergenic
1073280176 10:102348225-102348247 AGGCAGTTATGGGCTGGGCACGG - Intronic
1073360668 10:102896064-102896086 GTGCTGGGATTGGCCGGGCACGG - Intronic
1075037582 10:119082034-119082056 ATGAGGAAATCGGCCGGGCATGG + Intergenic
1075053951 10:119204489-119204511 AAGGTTTTATAGGCCGGGCACGG - Intergenic
1075308721 10:121392487-121392509 ATGCTATTATAGGCTGGGCGTGG - Intergenic
1075309320 10:121398869-121398891 ATGGTTGTATGGGCCGGGCATGG - Intergenic
1075428360 10:122360229-122360251 AAGCTATTATGGGCCTGGCACGG - Intergenic
1077656259 11:4022039-4022061 ATCATGTTATTGGCTGGGCATGG + Intronic
1077840844 11:5972885-5972907 ATCCTGTTCCCTGCCGGGCACGG - Intergenic
1077955449 11:7014674-7014696 ATGCTGATTTAGGCTGGGCATGG + Intronic
1078114627 11:8433932-8433954 AGAATATTATCGGCCGGGCATGG + Intronic
1078853983 11:15191267-15191289 ATGCAGACACCGGCCGGGCACGG - Intronic
1079220937 11:18560718-18560740 ATGCAGATTTTGGCCGGGCATGG + Intronic
1080527908 11:33145517-33145539 ATGCAAATATTGGCCGGGCACGG + Intronic
1083054283 11:59804905-59804927 AAACTGTTATAGGCCGGGCACGG + Intergenic
1083336093 11:61922712-61922734 ATACTGTTATCCGCTGGGCGGGG - Intergenic
1083389978 11:62341487-62341509 ATCCTGTTTTCAGCCGGGCGTGG - Intronic
1083605433 11:63975868-63975890 AAGCTGGTCTGGGCCGGGCATGG - Intronic
1083810272 11:65100834-65100856 GTGCTGCTATTGGCCAGGCATGG - Intronic
1083845559 11:65330573-65330595 ATGCTGTTACGGGCTGGGCGTGG - Intergenic
1083956292 11:65984884-65984906 ATGATGATATTGGCTGGGCATGG + Intergenic
1084007152 11:66329324-66329346 CATCTGTTATAGGCCGGGCAAGG - Intergenic
1084035358 11:66506543-66506565 ATGCTTTTTCCGGCTGGGCATGG - Intronic
1084116939 11:67048079-67048101 ATGGGGGTTTCGGCCGGGCACGG - Intronic
1084513884 11:69624950-69624972 ATGCCTTTCTCGGCTGGGCATGG - Intergenic
1084751086 11:71204860-71204882 ATGCTGACCACGGCCGGGCAGGG + Intronic
1085356693 11:75844513-75844535 AAGCTGCTTTAGGCCGGGCACGG - Intronic
1085668655 11:78440352-78440374 ATGCTTGGCTCGGCCGGGCATGG - Intronic
1086245251 11:84744012-84744034 CTTCTGTTTCCGGCCGGGCACGG - Intronic
1086491428 11:87360746-87360768 AGGCAGTTAACGGCAGGGCAAGG + Intergenic
1086664785 11:89467056-89467078 ATGTCTTTATCGGCCGGGCACGG + Intronic
1087270060 11:96101984-96102006 ATACTGTTTTCAGCCAGGCATGG + Intronic
1088820778 11:113455056-113455078 ATGTTGATCTGGGCCGGGCACGG + Intronic
1089070716 11:115697500-115697522 TTGCTGTCATAGGCCAGGCACGG - Intergenic
1089176082 11:116549839-116549861 TTGGGCTTATCGGCCGGGCACGG + Intergenic
1089280807 11:117373076-117373098 GAGCTTTTATCGGCCGGGCACGG + Intronic
1089393125 11:118115527-118115549 ATGATGTTACTGGCCTGGCATGG + Intronic
1089873084 11:121694221-121694243 ATGATAATATTGGCCGGGCACGG - Intergenic
1090804041 11:130191397-130191419 AGCCTTTTATGGGCCGGGCATGG + Intronic
1090815790 11:130294116-130294138 ATCCAGTTATAGGCCGGGCACGG + Intronic
1091615003 12:2043943-2043965 ATTCTGTTTTTGGCCGGGCGCGG - Intronic
1092157986 12:6296922-6296944 ATAACATTATCGGCCGGGCAAGG + Intergenic
1092650215 12:10626714-10626736 AAGTTGTTTTAGGCCGGGCACGG + Intronic
1092801368 12:12171224-12171246 ATGCTATTATTGGCCGAGCGCGG + Intronic
1092823784 12:12378079-12378101 AGTCTATTATAGGCCGGGCACGG + Intronic
1093914909 12:24790510-24790532 AAGTTGTTATTGGCCGGGCACGG - Intergenic
1094148157 12:27252267-27252289 GTGCTTTTGTAGGCCGGGCATGG - Intronic
1094336504 12:29362283-29362305 ATCCACTTTTCGGCCGGGCATGG + Intronic
1094587024 12:31786954-31786976 ATTCTGTTTAAGGCCGGGCATGG - Intergenic
1094613430 12:32015427-32015449 AAGGTTTTATGGGCCGGGCATGG + Intergenic
1094635304 12:32221391-32221413 ATAATTTTATAGGCCGGGCATGG + Intronic
1095120658 12:38414343-38414365 ACATTGTTATTGGCCGGGCACGG - Intergenic
1095558766 12:43540158-43540180 ATTCTGTGGTTGGCCGGGCATGG - Intronic
1095928330 12:47601987-47602009 ATACTGAAATCTGCCGGGCATGG + Intergenic
1095941276 12:47728742-47728764 ATGCTGTTATTGGACTGGCAGGG + Intergenic
1096043629 12:48542834-48542856 GATTTGTTATCGGCCGGGCATGG + Intergenic
1096308518 12:50500025-50500047 AAGGTGAAATCGGCCGGGCATGG - Intergenic
1096348936 12:50877898-50877920 ATGCTATTATGGGCCGGGCATGG - Intronic
1097981213 12:65739957-65739979 AAGATGTTCTTGGCCGGGCACGG + Intergenic
1098706539 12:73698254-73698276 ATGATATTATTGGCCGGGCGTGG - Intergenic
1098721485 12:73904276-73904298 AAGCTGTCATGGGCCAGGCATGG - Intergenic
1098826154 12:75300264-75300286 TTGCTCTTAGCGGCCGGGCGCGG + Intronic
1098948440 12:76614118-76614140 ATGCTGTGCACGGCAGGGCAAGG - Intergenic
1099050683 12:77778320-77778342 ATGCATTTATAGGCCGGGCGCGG + Intergenic
1099979464 12:89582086-89582108 ATCCTTTTATTGGCCGGGCGCGG + Intergenic
1100355288 12:93823002-93823024 ATGCTCGCATTGGCCGGGCACGG + Intronic
1100480375 12:94972216-94972238 ATACAGTAATGGGCCGGGCATGG - Intronic
1100973810 12:100100004-100100026 ATGCTATTCTCAGCCAGGCATGG + Intronic
1101017454 12:100516654-100516676 AGCATGTCATCGGCCGGGCACGG - Intronic
1101073997 12:101109270-101109292 ATTATGTTTTCGGCTGGGCACGG + Intronic
1101143031 12:101815327-101815349 GAGCTGTTATGGGCCGGGCATGG - Intronic
1102130208 12:110521844-110521866 ATCATGTTTTCGGCCGGGCACGG - Intronic
1102257958 12:111427093-111427115 ATCCGGGGATCGGCCGGGCACGG + Intronic
1103070257 12:117935467-117935489 AAGCTCTCATGGGCCGGGCATGG + Intronic
1103109702 12:118265098-118265120 AAGCTATTCTGGGCCGGGCATGG + Intronic
1103384093 12:120518126-120518148 ATGCTGTTTCCGGCTGGGCTCGG + Intronic
1103580955 12:121915031-121915053 AAAATATTATCGGCCGGGCACGG + Intronic
1104023623 12:125010486-125010508 ATGCTGTAGCCGGCCAGGCATGG + Intronic
1104419905 12:128626733-128626755 ATGCAGTTACTGGCCGGGCATGG - Intronic
1104573671 12:129947042-129947064 ATGTTGTGATTGGCTGGGCATGG - Intergenic
1105033925 12:132904710-132904732 ATGTTTTTATAGGCCGGGCGCGG - Intronic
1105223573 13:18357266-18357288 AGACTGTTATCGGCCAGGCACGG - Intergenic
1105646957 13:22330978-22331000 ATGCTGCTATGTGCCGGGCTGGG + Intergenic
1105868901 13:24486969-24486991 AGAAAGTTATCGGCCGGGCATGG + Intronic
1106627977 13:31440793-31440815 AAGATTTCATCGGCCGGGCATGG - Intergenic
1107080939 13:36374086-36374108 AAGCTGTTATCCGCTGGGCACGG - Intergenic
1107383229 13:39878710-39878732 TTACTATTATCGGCTGGGCATGG - Intergenic
1108044903 13:46374365-46374387 ACGGTGTTACTGGCCGGGCACGG - Intronic
1109740982 13:66554877-66554899 ATGCTTCTTGCGGCCGGGCATGG + Intronic
1110162793 13:72399690-72399712 ATAGAGTTATAGGCCGGGCACGG + Intergenic
1110454490 13:75675362-75675384 ATGTTGTAACAGGCCGGGCACGG - Intronic
1110949634 13:81469141-81469163 AAGTTGTTATAGGCCGGGCGCGG - Intergenic
1111263766 13:85778708-85778730 ATTCTGAAATCGGCCGGGCACGG - Intergenic
1111937967 13:94576810-94576832 ATGTTATTATTGGCCAGGCAAGG + Intronic
1112126827 13:96477576-96477598 ACTGTGTTACCGGCCGGGCACGG + Intronic
1112191294 13:97180444-97180466 ATGGTGTGATCGGCCAGGCATGG + Intergenic
1112866526 13:103907591-103907613 ATGCCATTATAGGCCGGGCGCGG - Intergenic
1113700467 13:112382386-112382408 AAGGTGTTATTGGCCAGGCACGG - Intronic
1114295859 14:21328730-21328752 AAGCACTAATCGGCCGGGCATGG + Intronic
1114565395 14:23628300-23628322 ATGCTTATGTTGGCCGGGCACGG + Intergenic
1115121934 14:29947378-29947400 GTGCTGTTTTAGGCCAGGCATGG - Intronic
1115223244 14:31078022-31078044 AGGCTGATAAAGGCCGGGCACGG - Intronic
1115565924 14:34625440-34625462 AAGCAGTTATCGGCCGGGCGCGG + Intronic
1115613398 14:35070312-35070334 ATATTGTTATAGGCCGGACACGG - Intronic
1115990461 14:39144779-39144801 ATGATGCTAACGGCCAGGCACGG - Intergenic
1116596774 14:46858715-46858737 AAGGTATTATAGGCCGGGCACGG - Intronic
1116798953 14:49422842-49422864 ATTCTGTTTCCGGCCAGGCATGG + Intergenic
1116821601 14:49633208-49633230 TTGCTATTACCGGCCGGGCGCGG - Intronic
1117550373 14:56830257-56830279 ATACTGTAATTGGCCGGGCGCGG + Intergenic
1117763340 14:59056148-59056170 TTGCAGTTATTGGCCAGGCACGG + Intergenic
1118053242 14:62051746-62051768 ATGCAGTTTTTGGCTGGGCATGG + Intronic
1118200520 14:63667569-63667591 ATGCTGCTGTTGGCCAGGCACGG - Intergenic
1118207204 14:63733714-63733736 ATTCTATAATGGGCCGGGCACGG - Intergenic
1118405439 14:65418936-65418958 ATGATTTTATAGGCCGGGCGCGG + Intronic
1119743932 14:77031018-77031040 ATACTGTAATAGGCCGGTCACGG - Intergenic
1120051370 14:79870671-79870693 AAGCTATTGCCGGCCGGGCACGG - Intergenic
1120973024 14:90225022-90225044 GTGCTTTTTTTGGCCGGGCATGG + Intergenic
1122336694 14:100994392-100994414 ATTCAGTTATCGGCTGGGCACGG + Intergenic
1122936620 14:104961222-104961244 TTGCTGTTGTGGGCCGGGCACGG + Intronic
1123463755 15:20498135-20498157 ATCCTATTAACAGCCGGGCACGG + Intergenic
1123654307 15:22502294-22502316 ATCCTATTAACAGCCGGGCACGG - Intergenic
1123778687 15:23604690-23604712 ATGCTCTAATAAGCCGGGCACGG + Intronic
1123905381 15:24915414-24915436 ACTCTCTTCTCGGCCGGGCAAGG - Intronic
1123975598 15:25551531-25551553 ATACTCTTAGCAGCCGGGCACGG + Intergenic
1124274605 15:28315505-28315527 ATCCTATTAACAGCCGGGCACGG + Intronic
1124308215 15:28597488-28597510 ATCCTATTAACAGCCGGGCACGG - Intergenic
1124584115 15:30989873-30989895 AACCTGAAATCGGCCGGGCACGG - Intronic
1124830023 15:33139304-33139326 TAGCTGTTGTTGGCCGGGCACGG + Intronic
1124872119 15:33553518-33553540 CTGCAGTTATTGGCCGGGCCTGG + Intronic
1125858282 15:42972659-42972681 AATGAGTTATCGGCCGGGCACGG - Intronic
1126083173 15:44985507-44985529 ATTCTGTTTTTGGCTGGGCACGG - Intergenic
1126791828 15:52228430-52228452 ATATTGTTACCTGCCGGGCACGG - Intronic
1127244022 15:57151474-57151496 ATGCTGCTTTTGGCCAGGCACGG + Intronic
1128290082 15:66471787-66471809 ATGCTGTTAGTGGCCGGGCATGG + Intronic
1128569523 15:68723739-68723761 AAGAAGGTATCGGCCGGGCACGG - Intronic
1128634094 15:69291842-69291864 TAGCTGTCACCGGCCGGGCATGG + Intergenic
1129146110 15:73648931-73648953 ATGAGGTTATTGGCTGGGCAAGG + Intergenic
1130523447 15:84682737-84682759 ATGCTGTTCCTGGCTGGGCACGG - Intronic
1130560861 15:84957555-84957577 ATAGTGTTGTCGGCCAGGCATGG - Intergenic
1130674403 15:85939277-85939299 ATGGTGGGATCGGCCGGGCGTGG + Intergenic
1131211754 15:90503690-90503712 AAGTGCTTATCGGCCGGGCACGG + Intergenic
1131226826 15:90631065-90631087 ATGCTGTAATAGGCCGGGCGCGG - Intronic
1131479720 15:92770386-92770408 AAGATGTTTTCGGCCGGGCGCGG - Intronic
1131594104 15:93779343-93779365 ATGTTGTTGACAGCCGGGCACGG - Intergenic
1132771991 16:1568589-1568611 ATGCTGTTCTAGGCCAGGCGTGG + Intronic
1132952738 16:2573529-2573551 ATAGAGTTATTGGCCGGGCACGG + Intronic
1132961613 16:2626641-2626663 ATAGAGTTATTGGCCGGGCACGG - Intergenic
1133153209 16:3852459-3852481 ATAATGTAATCGGCCGGGCACGG - Intronic
1133316394 16:4886907-4886929 ATGCTATTTTCAGCTGGGCATGG - Intronic
1133479261 16:6153824-6153846 ATGATATAATGGGCCGGGCATGG - Intronic
1133597695 16:7309237-7309259 AGGCTGTTATCAGCCAGGTAAGG + Intronic
1133785778 16:8972094-8972116 AAACTGTTATTGGCCTGGCACGG + Intergenic
1133821835 16:9243988-9244010 ATGCATTTATGGGCCGGGCGCGG - Intergenic
1134444067 16:14317527-14317549 AAGCTATTTTCAGCCGGGCATGG - Intergenic
1134668257 16:16035783-16035805 AGGCTGATATGGGCCAGGCACGG - Intronic
1135102419 16:19617704-19617726 AGACTGTGATAGGCCGGGCACGG + Intronic
1135574495 16:23574946-23574968 ATACAGATATCGGCCAGGCACGG + Intergenic
1136407953 16:30059855-30059877 GAGCTGTTCTTGGCCGGGCATGG - Intronic
1136736009 16:32468526-32468548 ATGATGTGATTGGCCAGGCACGG - Intergenic
1137990108 16:53145439-53145461 GTGCTGGGATTGGCCGGGCATGG - Intronic
1138044300 16:53704647-53704669 AAACTGTTATCAGCCGGTCACGG - Intronic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1139726870 16:68907235-68907257 AGGCTGTTATGGGCCAGGCGCGG - Intronic
1141496315 16:84412803-84412825 ATCCTGTGATCAGCCGGGCGCGG + Intronic
1142428709 16:90014413-90014435 ATGCAGGTATTGGCCCGGCACGG - Intronic
1203017066 16_KI270728v1_random:361048-361070 ATGATGTGATTGGCCAGGCACGG + Intergenic
1203035401 16_KI270728v1_random:634206-634228 ATGATGTGATTGGCCAGGCACGG + Intergenic
1143041406 17:4039932-4039954 AAGATGTTCTCGGCTGGGCACGG - Intronic
1143358103 17:6345853-6345875 ATGCTTTTATTGGTCGGGCGCGG - Intergenic
1143837721 17:9705462-9705484 ATGTTGCTGTCGGCCGGGCGTGG + Intronic
1144349798 17:14384174-14384196 ATGCACATATCGGCCAGGCACGG - Intergenic
1144507706 17:15846782-15846804 ATGCTATTAGTGGCTGGGCATGG - Intergenic
1145180219 17:20743403-20743425 ATGCTGTAATGGGCTGGGCGCGG + Intergenic
1145816896 17:27801554-27801576 ATGAAATTATAGGCCGGGCATGG - Intronic
1145949530 17:28805254-28805276 AGGCTGAGATGGGCCGGGCATGG + Intronic
1145983703 17:29030105-29030127 TTTCTGTTTTTGGCCGGGCACGG - Intronic
1146137437 17:30335419-30335441 AAGGTGATCTCGGCCGGGCACGG + Intergenic
1146173391 17:30649755-30649777 ATGGTGATAACAGCCGGGCACGG - Intergenic
1146246662 17:31290713-31290735 AAGCTAATATCGGCCGGGCACGG + Intronic
1146292131 17:31616200-31616222 CTACTGTAATTGGCCGGGCACGG + Intergenic
1146346848 17:32065785-32065807 ATGGTGATAACAGCCGGGCACGG - Intergenic
1146733720 17:35218403-35218425 ATGCAAGTATAGGCCGGGCATGG - Intergenic
1148488560 17:48007683-48007705 AAGCTACTATGGGCCGGGCATGG - Intergenic
1148721202 17:49754592-49754614 TTGCTGTGCTTGGCCGGGCACGG - Intronic
1148961851 17:51399941-51399963 ATCCTGCTATCAGCTGGGCATGG - Intergenic
1149722625 17:58861633-58861655 ATGCTGTTTCTGGCTGGGCACGG + Intronic
1149884174 17:60324710-60324732 AAACTGTTATAGGCCAGGCATGG + Intronic
1149893889 17:60414070-60414092 AAGATGTTATCGGCTGGGCGTGG + Intronic
1149979807 17:61301341-61301363 AGACTGATTTCGGCCGGGCACGG + Intronic
1150451918 17:65276296-65276318 ATGCTGCTATAGGCCGGGTGCGG - Intergenic
1151041399 17:70864829-70864851 AAGGAGTTATCGGCCGGGCGTGG + Intergenic
1151907826 17:77060557-77060579 AGACTGTTATTGGCTGGGCACGG + Intergenic
1153249675 18:3108827-3108849 ATGCTGTCATTGGCCGGACACGG - Intronic
1153304350 18:3618646-3618668 AGGCAGTTCTGGGCCGGGCAGGG + Intronic
1153913388 18:9723336-9723358 ATGCTTTTACAGGCCAGGCACGG - Intronic
1154377068 18:13819412-13819434 AGGATGTTAGGGGCCGGGCACGG - Intergenic
1155084023 18:22438630-22438652 ATGCTGTTTTTGGCCGGGCGCGG - Intergenic
1156060941 18:33075674-33075696 ATGTAGTTATTGGCCAGGCACGG + Intronic
1157674051 18:49555205-49555227 ATACTGTGATTGGCCAGGCACGG + Intergenic
1158429759 18:57374943-57374965 AGCCTGTTATGGGCCGGGCACGG + Intergenic
1159169509 18:64746829-64746851 ATAATGTAATAGGCCGGGCACGG - Intergenic
1159779296 18:72642691-72642713 AAGCAGATGTCGGCCGGGCACGG - Intergenic
1160477562 18:79206228-79206250 ATGCTATTATTGGCCGGGCGCGG - Intronic
1161232735 19:3182979-3183001 ATGGGGAAATCGGCCGGGCACGG - Intergenic
1161868459 19:6852429-6852451 AACCTGTTTTTGGCCGGGCACGG + Intronic
1162591694 19:11596516-11596538 ATGCAAATATTGGCCGGGCACGG + Intronic
1162731914 19:12723424-12723446 ACTTTGTTATCGGCAGGGCAGGG - Intronic
1162950873 19:14071797-14071819 ATACAGTTACCGGCCGGGCATGG - Intergenic
1162989031 19:14290306-14290328 ATGGTGATAACAGCCGGGCATGG + Intergenic
1162997023 19:14342672-14342694 ATGGGGCTATCGACCGGGCACGG - Intergenic
1163998699 19:21077171-21077193 TTGCTGTTCTCTGCCAGGCACGG - Intergenic
1164244409 19:23417775-23417797 ATAATGGTATTGGCCGGGCACGG - Intergenic
1164886937 19:31786552-31786574 ATGCTGATCTTGGCCGGGCATGG + Intergenic
1165017235 19:32890114-32890136 AAACTGTTTTCAGCCGGGCACGG + Intronic
1166282497 19:41803754-41803776 TTGCTGTTTCAGGCCGGGCATGG - Intronic
1166598694 19:44074061-44074083 TTCCTGATATTGGCCGGGCATGG + Intronic
1166692165 19:44828979-44829001 AAGCAGTTATAGGCAGGGCATGG - Intergenic
1167091990 19:47350708-47350730 ATGCTTTTTCAGGCCGGGCATGG - Intronic
1167600099 19:50449863-50449885 ATGATGATAATGGCCGGGCATGG + Intronic
1167607726 19:50490402-50490424 ATGCTTTTAAGGGCCGGCCACGG - Exonic
1167858947 19:52267725-52267747 ATGCTGATATGGGCCGGGTGCGG + Intergenic
1168608936 19:57783499-57783521 TTGTTGTTGTTGGCCGGGCATGG + Intronic
925964944 2:9055988-9056010 ATTCCGTTATTGGCTGGGCATGG + Intergenic
926304845 2:11630431-11630453 CTCCTGTTATCTTCCGGGCACGG - Intronic
926738542 2:16092573-16092595 ATGTTGTTCTAGGCCTGGCATGG - Intergenic
927406361 2:22773860-22773882 ATGCCGATCTGGGCCGGGCACGG - Intergenic
927540204 2:23902944-23902966 AGGATGTTTTTGGCCGGGCATGG + Intronic
927692402 2:25217263-25217285 ATGGTGTTTTCGGCCGGGCATGG + Intergenic
927738982 2:25550099-25550121 ATGCTATTGTTGGCCGGGCGCGG + Intronic
927933785 2:27063300-27063322 ATGCTTGTCTCGGCCGGGCGTGG + Intronic
928144674 2:28761991-28762013 TTTCTGTTCTCGGCCGGGCATGG + Intronic
928223631 2:29426747-29426769 AAGCAGTTATAGGCCGGGCACGG + Intronic
928521281 2:32091540-32091562 GTGCTGGGATAGGCCGGGCACGG + Intronic
929436049 2:41929190-41929212 ATCCTGTTCTCAGCAGGGCACGG + Intergenic
929497592 2:42459684-42459706 AAGATGTTATCGGCCGGGCGTGG + Intronic
929520826 2:42649102-42649124 TAGCTGTTATCGGCCGGGTGTGG + Intronic
929722128 2:44380869-44380891 ATAATGCTTTCGGCCGGGCATGG + Intronic
929783319 2:44971809-44971831 ATGCAGCTCTCGGCCGGGCGTGG + Intergenic
930109243 2:47664579-47664601 AGGCTCTTTTGGGCCGGGCATGG - Intergenic
930126850 2:47805466-47805488 ATGCAATTATTGGCCGGGCACGG - Intronic
930242513 2:48950803-48950825 ATGCGCTTATCGGCTGGGCACGG - Intergenic
930565937 2:53020591-53020613 ATATTGTTCTCGGCCGGGCGTGG - Intergenic
930703407 2:54482222-54482244 ATGCAGGTGTCAGCCGGGCATGG + Intronic
930704290 2:54489028-54489050 ATGCTGTAATTGGCCAGACATGG + Intronic
930708057 2:54523907-54523929 ATGTTGATAACAGCCGGGCATGG + Intronic
931082665 2:58792697-58792719 AAGCAGATATCGGCCGGGCGCGG - Intergenic
931320307 2:61169145-61169167 AAGTTGTTTTAGGCCGGGCACGG - Intergenic
932140175 2:69269676-69269698 TTTCTGTTATTGGCCAGGCACGG + Intergenic
932223480 2:70020450-70020472 AAGATGTTGTGGGCCGGGCACGG + Intergenic
932334862 2:70924484-70924506 ATACTCTTATTGGCTGGGCATGG - Intronic
932671782 2:73743539-73743561 ATGCTCTTCTAGGCTGGGCATGG - Intergenic
932762668 2:74449272-74449294 ATGTTTTTGTGGGCCGGGCATGG + Intergenic
932784320 2:74586708-74586730 AAGTTGTTAGCAGCCGGGCACGG + Intronic
934068644 2:88363507-88363529 ATACTGCTATTGGCTGGGCACGG - Intergenic
934537568 2:95148306-95148328 ATGCTGTTACTGACGGGGCAGGG - Exonic
934667612 2:96183892-96183914 AAAATGTTATAGGCCGGGCACGG + Intergenic
935214938 2:100968563-100968585 GTGCTGTTAACGGCAGGGGATGG - Intronic
935289777 2:101600341-101600363 ATATTATTTTCGGCCGGGCATGG + Intergenic
935813488 2:106824340-106824362 ATGCTGGAATAGGCCAGGCAAGG + Intronic
936048000 2:109201602-109201624 ATGCTGTGAGAGGCCCGGCATGG - Intronic
936598834 2:113875796-113875818 AAGGTGTTATGGGCCAGGCATGG - Intergenic
937665783 2:124485321-124485343 GTGCAGTTACCGGCCGGGCACGG + Intronic
938037087 2:128043873-128043895 ATGTGGTTATGGGCTGGGCACGG + Intergenic
938148043 2:128854472-128854494 ATGCACTCATCGGCCGGGCGCGG + Intergenic
938230958 2:129658709-129658731 TTGTTGTTCTTGGCCGGGCATGG + Intergenic
938295638 2:130177405-130177427 ATGCTGTTCTCAGCCGGGCATGG + Intronic
938460984 2:131496420-131496442 ATGCTGTTCTCAACTGGGCACGG - Intergenic
938506784 2:131892773-131892795 ATGTAGATATCGGCCAGGCACGG - Intergenic
938540674 2:132281325-132281347 CTGCTGTCAACGGCCGGGTATGG + Intergenic
939275734 2:139993723-139993745 ATCCTGTGCTAGGCCGGGCACGG + Intergenic
939504779 2:143031985-143032007 CTGCTGTTTTTGGCCGGGCGTGG + Intronic
939969932 2:148646819-148646841 AATCTGTTCTAGGCCGGGCACGG + Intronic
940896205 2:159083959-159083981 ATGCAGTCATCAGCTGGGCATGG + Intronic
940933966 2:159469729-159469751 ATGTAGGTATAGGCCGGGCATGG - Intronic
940998806 2:160179680-160179702 ATGCTGGAATGGGCCGGGCATGG - Intronic
941833653 2:169991870-169991892 ATGTTGTTTTAGGCCAGGCACGG - Intronic
941886828 2:170536909-170536931 ATGCTGGTCTCGGCTGGGCGTGG + Intronic
942119379 2:172761831-172761853 ATGCTGCTTTCGGCCTGGCATGG + Intronic
942713955 2:178869939-178869961 ATGCTACTATAGGCTGGGCATGG + Intronic
943561244 2:189465543-189465565 ATGCTGTTAACGGAAGAGCAAGG - Intronic
943698698 2:190965329-190965351 ATGCTGTTGTCTGTCTGGCAGGG + Exonic
944216942 2:197265535-197265557 AAGCTGTTACTGGCCGGGCATGG - Intronic
944565201 2:200983046-200983068 ATTCTGTTGTTGGCCGGGCGCGG - Intronic
944950724 2:204745691-204745713 ATGGTAGTATCGGCCAGGCATGG - Intronic
945268660 2:207916447-207916469 ATGATTTTAGAGGCCGGGCACGG + Intronic
946061637 2:216946716-216946738 AAGATGTTACTGGCCGGGCACGG - Intergenic
946148871 2:217750833-217750855 ATGCTGTTCTCGGCTGGGCGCGG - Intronic
947662548 2:231880538-231880560 ACAGTGTTATAGGCCGGGCACGG - Intergenic
947859992 2:233352090-233352112 ATGCTGTTGCCGGCCGGGCGCGG - Intergenic
948085507 2:235243471-235243493 ATGATTTTATGGGCTGGGCATGG + Intergenic
948313344 2:237007167-237007189 AAGCTATAATTGGCCGGGCATGG + Intergenic
948499372 2:238380538-238380560 ATGCTGTGAGTGGCCGGGCTGGG - Intronic
1168980579 20:2000151-2000173 ATGCTGGTATAGGCTGGGCATGG - Intergenic
1168996724 20:2138724-2138746 ATGATGTTTTAGGCCAGGCATGG + Intronic
1169270802 20:4198072-4198094 ATGCATATATAGGCCGGGCACGG - Intergenic
1169757800 20:9062041-9062063 AAGCTGGTCTTGGCCGGGCACGG - Intergenic
1170986246 20:21261815-21261837 ATGCTATTAATGGCCAGGCATGG - Intergenic
1172137791 20:32699136-32699158 ATGTTAGTGTCGGCCGGGCAAGG - Intergenic
1172395444 20:34600742-34600764 AAGCAGTTATTGGCCGGGCACGG + Intronic
1172471409 20:35199591-35199613 ATGCAGAAATTGGCCGGGCATGG + Intergenic
1172685080 20:36747309-36747331 ATGCTTTTAGTGGCCGGGCGTGG - Intergenic
1172712146 20:36933754-36933776 GTGCTGAGATTGGCCGGGCACGG + Intronic
1173514963 20:43658605-43658627 ATAGTCTTATAGGCCGGGCATGG + Intergenic
1173668818 20:44783330-44783352 ATGCAGTACTGGGCCGGGCATGG + Intronic
1173705708 20:45108912-45108934 ATGCAAACATCGGCCGGGCACGG - Intergenic
1174241366 20:49137992-49138014 AAGCTGTAATTGGCTGGGCATGG + Intronic
1174357403 20:50007889-50007911 ATCCTTTTCTTGGCCGGGCACGG - Intergenic
1174824467 20:53756909-53756931 ATGTGATTATCAGCCGGGCATGG + Intergenic
1175143912 20:56881580-56881602 AAGCTGGTGTCTGCCGGGCACGG - Intergenic
1176732115 21:10509646-10509668 AGACTGTTATCGGCCAGGCACGG - Intergenic
1176786852 21:13267532-13267554 ATGTAGATATCGGCCAGGCACGG + Intergenic
1177677886 21:24325560-24325582 ATGCTGTATTGGGCCGGGCACGG - Intergenic
1177826066 21:26084526-26084548 ATGGTGTCTTCGGCCGGGCGCGG - Intronic
1178080918 21:29064047-29064069 AAGCACTTCTCGGCCGGGCACGG - Intronic
1178235289 21:30834510-30834532 AAGCTACCATCGGCCGGGCACGG - Intergenic
1178323543 21:31624762-31624784 ATGCTATTGATGGCCGGGCACGG + Intergenic
1178564939 21:33675271-33675293 ATCTTGATATGGGCCGGGCACGG + Intronic
1178862174 21:36298661-36298683 ATGCAGCTGTCGGCCGGGCATGG + Intergenic
1179012699 21:37568283-37568305 ATGCTGTCATCGGCTGAGCGCGG - Intergenic
1180853198 22:19031684-19031706 AGGCTGCTGTGGGCCGGGCACGG + Intergenic
1181302682 22:21892679-21892701 ATGCCAATATTGGCCGGGCATGG + Intergenic
1181303573 22:21900885-21900907 AATATGTTCTCGGCCGGGCACGG + Intergenic
1181756875 22:25030244-25030266 ATGATGTTCTAGGCCGGGCGCGG + Intronic
1182205273 22:28617980-28618002 TGGCTGTTGTTGGCCGGGCATGG + Intronic
1182466228 22:30518312-30518334 CTGATGATATCGGCCAGGCATGG - Intergenic
1182677097 22:32047868-32047890 ATGCAGACATCGGCCGGGCATGG + Intronic
1182705709 22:32278984-32279006 TTGCTGCTATAGGCCGGGCGCGG + Intergenic
1183224578 22:36540684-36540706 AAGCATTTATCGGCCAGGCACGG - Intergenic
1184001590 22:41678263-41678285 ATGCTGTAAGAGGCCGGGCGCGG - Intronic
1184266658 22:43350727-43350749 ATGCTCCTATTGGCCAGGCATGG + Intergenic
1185259250 22:49852789-49852811 ATTCAAATATCGGCCGGGCACGG - Intergenic
949699073 3:6735114-6735136 AAGCTGCTATAGGCCGGGCGCGG + Intergenic
949968425 3:9379978-9380000 ATGCTATTTCCGGCCGGGCATGG - Intronic
950027737 3:9832375-9832397 ATACAGCTATTGGCCGGGCATGG - Intronic
950805080 3:15594837-15594859 ATGAACTTTTCGGCCGGGCATGG + Intronic
951222734 3:20085978-20086000 ATGCTGTTTTGAGCTGGGCATGG + Intronic
951909372 3:27732853-27732875 AAGCAATTATTGGCCGGGCATGG - Intergenic
952053920 3:29420812-29420834 AGGCTATTATCGGCCAGGCACGG + Intronic
952826784 3:37531039-37531061 AAGCTGGTAGCGGCCGGGCGCGG - Intronic
953739944 3:45529157-45529179 ATGATGTTGTAGGCCGGGCGCGG - Intronic
954071800 3:48148434-48148456 ATGCCTTTCTTGGCCGGGCATGG + Intergenic
954080351 3:48210012-48210034 TTGGTGCTCTCGGCCGGGCACGG - Intergenic
954683261 3:52357342-52357364 ATGCTAATATGGGCCGGGCATGG - Intronic
955166615 3:56521115-56521137 ATCTGATTATCGGCCGGGCACGG + Intergenic
955643020 3:61106947-61106969 ATGATGTGATGGGCCAGGCATGG - Intronic
956824731 3:72987282-72987304 ACGCTACTATCGGCCGGGCGCGG - Intronic
956840717 3:73137413-73137435 ATGGTGTTTGGGGCCGGGCACGG + Intergenic
956847629 3:73197786-73197808 AACCTGTTGTCAGCCGGGCATGG + Intergenic
957343532 3:78931534-78931556 ATGTTGTTTTTGGCTGGGCACGG - Intronic
957883754 3:86255926-86255948 ATTCTATTTTCGGCCGGGCGCGG - Intergenic
959391552 3:105780949-105780971 ATGCTTTTATTGGCCAGGCGTGG - Intronic
960138049 3:114125342-114125364 ATGCTGGCATTGGCCGGGCATGG + Intergenic
961005188 3:123400654-123400676 AAGCTGATATGGGCCAGGCACGG + Intronic
961006423 3:123408684-123408706 TAGCTGTACTCGGCCGGGCATGG + Intronic
961220935 3:125199066-125199088 ATCCTATTGTCAGCCGGGCATGG - Intronic
961252856 3:125521365-125521387 AATCTGTTATGGGCTGGGCACGG + Intergenic
962217321 3:133533938-133533960 TTACTGTTACCGGCCGGGCGTGG + Intergenic
962528268 3:136255162-136255184 ATGCTTCTTTGGGCCGGGCACGG - Intronic
962681689 3:137807216-137807238 ATGCTGCTCTGGGCCGGGCGCGG - Intergenic
963053404 3:141162022-141162044 AAACTTTTATTGGCCGGGCACGG - Intergenic
963935822 3:151052107-151052129 AGTGTGTTTTCGGCCGGGCATGG - Intergenic
964049962 3:152378870-152378892 ATGCAATTATCAGCCAGGCATGG - Intronic
965593808 3:170387631-170387653 ATGCTGCTATAGGCCGGGCGCGG + Intronic
966575052 3:181491812-181491834 AGTCTGGTATCGGCCGGGCGCGG + Intergenic
966745947 3:183277179-183277201 AAGCAGGTATCGGCCGGGCGTGG + Intronic
966902330 3:184495635-184495657 GTGAAGTTATTGGCCGGGCACGG + Intronic
967016985 3:185491284-185491306 ATGCTGTTTGTGGCCGGGCGCGG - Exonic
967022641 3:185535891-185535913 ATGATTTTGTTGGCCGGGCACGG - Intronic
967473807 3:189892500-189892522 ATGCTTATTTAGGCCGGGCATGG + Intronic
968185305 3:196629223-196629245 ATACAATTATCGGCCAGGCATGG - Intergenic
968338267 3:197932342-197932364 ATTCTATTTTCAGCCGGGCATGG + Intronic
970343361 4:15129855-15129877 ATCCTGTAATCAGCTGGGCATGG - Intergenic
971020419 4:22529695-22529717 ATGATGTTTTTGGCCAGGCATGG + Intergenic
971434370 4:26604578-26604600 ATGCTACTATGGGCCGGGCATGG + Intronic
972090133 4:35271081-35271103 ATGAAGTTTTCGGCCGGGCACGG + Intergenic
972243800 4:37223430-37223452 ATGTTGTTTTCGGCCGGGCGCGG - Intergenic
972507712 4:39736170-39736192 ATGAAGATATAGGCCGGGCACGG + Intronic
972612255 4:40666788-40666810 ATGATGTAATGGGCCAGGCATGG - Intergenic
973767654 4:54178565-54178587 ATGGAGTTTTTGGCCGGGCATGG + Intronic
974608263 4:64181847-64181869 GTTATGTTATTGGCCGGGCACGG + Intergenic
974909384 4:68098012-68098034 ATGCAGAAATCGGCGGGGCATGG + Intronic
975436618 4:74361093-74361115 ATGCTATTACAGGCCGGGCATGG + Intergenic
975603945 4:76133595-76133617 ATTATCTTATTGGCCGGGCACGG - Intronic
976173098 4:82324940-82324962 CTGATGTGTTCGGCCGGGCACGG - Intergenic
976243398 4:82983301-82983323 ATGCAGTGATCGGCGGGGCGTGG - Intronic
976622501 4:87143312-87143334 AAACTTTTATCGGCCGGGCACGG + Intergenic
978069402 4:104448270-104448292 AAGATGTCATTGGCCGGGCACGG + Intergenic
978359119 4:107909399-107909421 TAGCTGCTATCGGCTGGGCACGG - Intronic
978487984 4:109277843-109277865 GTGCTATTATTGGCCGGACATGG + Intronic
978705742 4:111708291-111708313 ATACAGTTTTTGGCCGGGCATGG - Intergenic
978823645 4:112993996-112994018 ATGCAGTTGCCGGCCGGGCATGG - Intronic
978952290 4:114575461-114575483 ATGCTGTTATAGGCAGGGCATGG - Intergenic
979712889 4:123801770-123801792 CTTCTGTTATGGGCTGGGCATGG + Intergenic
980431224 4:132699016-132699038 ATGCAAGTATCGGCCGGGCGCGG - Intergenic
981874056 4:149519712-149519734 ATCCTGTTTTGGGCTGGGCATGG + Intergenic
982875356 4:160641111-160641133 ATGCTATTTTTGGCTGGGCATGG - Intergenic
982909982 4:161127857-161127879 AAGCTGCCATTGGCCGGGCACGG - Intergenic
982920508 4:161267819-161267841 ATCCCATTTTCGGCCGGGCACGG - Intergenic
983430960 4:167650741-167650763 ATCCAATTATAGGCCGGGCATGG + Intergenic
984462429 4:180055239-180055261 AAGGTGTTCTTGGCCGGGCATGG - Intergenic
984733840 4:183092405-183092427 TTGTAGTTATAGGCCGGGCACGG + Intergenic
984903860 4:184609133-184609155 GTGATGTTATCGGCCGGGCTCGG - Intergenic
985091661 4:186369495-186369517 ATAATGTATTCGGCCGGGCACGG + Intergenic
985252347 4:188036688-188036710 TAGTTGTTATCGGCCGGGCACGG + Intergenic
985534440 5:455892-455914 AAGTTATTATCAGCCGGGCATGG - Intronic
986719878 5:10553384-10553406 ATGCGGGTGTCGGCCGGGCATGG - Intergenic
987627220 5:20418103-20418125 TTGCTGTTGTCGGCCGGGGCTGG + Intronic
987710346 5:21496043-21496065 ATGCTAGTATCAGCCAGGCACGG - Intergenic
988834052 5:35014161-35014183 ATGCTGTTTTCGACAGGGCGCGG + Intronic
989597629 5:43171424-43171446 ATCCTGTTATTGGCTGGGCACGG + Intronic
990258182 5:53993317-53993339 ATGCAGTTTTGGGCTGGGCATGG + Intronic
990302846 5:54466095-54466117 ATCCTACTATTGGCCGGGCATGG + Intergenic
991014716 5:61918464-61918486 ATGTTGTTTGAGGCCGGGCATGG - Intergenic
991080352 5:62592138-62592160 AAGCTGATACCAGCCGGGCATGG - Intronic
991737518 5:69641326-69641348 ATGCTAGTATCAGCCAGGCACGG + Intergenic
991760674 5:69915099-69915121 ATGCTAGTATCAGCCAGGCACGG - Intergenic
991786656 5:70203002-70203024 ATGCTAGTATCAGCCAGGCACGG + Intergenic
991789094 5:70221052-70221074 ATGCTAGTATCAGCCAGGCACGG + Intergenic
991813844 5:70496158-70496180 ATGCTAGTATCAGCCAGGCACGG + Intergenic
991816975 5:70517442-70517464 ATGCTAGTATCAGCCAGGCACGG + Intergenic
991879101 5:71203387-71203409 ATGCTAGTATCAGCCAGGCACGG + Intergenic
991881541 5:71221416-71221438 ATGCTAGTATCAGCCAGGCACGG + Intergenic
992129674 5:73679274-73679296 ATGTTGTTACTGGCTGGGCATGG + Intronic
992768891 5:80028747-80028769 ATGGTTTTGTGGGCCGGGCATGG - Intronic
993363025 5:87001627-87001649 ATGGTGTCATAGGCCGGGCGTGG + Intergenic
993728178 5:91392023-91392045 ATGTTACAATCGGCCGGGCATGG - Intergenic
994065502 5:95535598-95535620 ATGCTGTTACTGGCCGGGCGCGG - Intronic
994422298 5:99536144-99536166 ATGCTAGTATCAGCCAGGCACGG - Intergenic
994460074 5:100061387-100061409 ATGCTAGTATCAGCCAGGCACGG + Intergenic
994501725 5:100587833-100587855 ATGTTATTAGCGGCCGGGCGCGG + Intergenic
996006920 5:118432295-118432317 ATAGTGTTACTGGCCGGGCACGG - Intergenic
998004051 5:138645626-138645648 AAGCTGTTAAAGGCTGGGCATGG - Intronic
999187175 5:149720351-149720373 ATGCCATTCTCGGCCGGGCGCGG + Intergenic
1000002512 5:157152438-157152460 ATGTTTTTATTGGCTGGGCATGG - Intronic
1000314253 5:160073515-160073537 AAGATGTTTTTGGCCGGGCATGG - Intronic
1000619029 5:163461502-163461524 ATGCTGTATGCGGCCGGGCGCGG + Intronic
1000732668 5:164855821-164855843 ATGCTGTTTTTGGCCAGGCGCGG + Intergenic
1001510700 5:172319256-172319278 CTGTTGCTATAGGCCGGGCACGG - Intergenic
1001628811 5:173159327-173159349 TTGATATTTTCGGCCGGGCATGG - Intronic
1002028517 5:176411884-176411906 ATGCTTTTTTGGGCCGGGCGTGG + Intronic
1003040813 6:2685778-2685800 AAGCAGGTCTCGGCCGGGCACGG + Intronic
1003052426 6:2792235-2792257 ATCCAGTTCTAGGCCGGGCACGG - Intergenic
1003283712 6:4715956-4715978 ATGATTTTACTGGCCGGGCACGG + Intronic
1004101467 6:12616494-12616516 ATGCCTTTATGGGCCTGGCACGG - Intergenic
1004130182 6:12912288-12912310 ATGCTGTTTTGGGCCAAGCACGG - Intronic
1004384739 6:15162992-15163014 ATGCTCTTATTGGCCGGGCATGG + Intergenic
1004492262 6:16128628-16128650 AAACTGTTCTCGTCCGGGCATGG - Intergenic
1005270181 6:24155321-24155343 ATGCACACATCGGCCGGGCACGG - Intergenic
1005391432 6:25337884-25337906 AAGGTGTTAGTGGCCGGGCATGG + Intronic
1005618640 6:27599975-27599997 ATGCTGTGTTTGGCCGGGCGCGG + Intergenic
1006235366 6:32626228-32626250 ATGCTGTAATAGGCCGGGCGCGG - Intergenic
1006366141 6:33616655-33616677 ATGCTGATCTTGGCCGGGCACGG + Intergenic
1006678139 6:35778244-35778266 AAGCATTTATTGGCCGGGCACGG - Intronic
1007042314 6:38733991-38734013 ATGCAATTATTGGCCAGGCATGG + Intronic
1007173095 6:39878307-39878329 ATGGAGTTATGGGCTGGGCAGGG - Intronic
1007558806 6:42788510-42788532 ATGCTGCTCCCGGCCAGGCATGG - Intronic
1008762002 6:54862584-54862606 AACCTGTCATTGGCCGGGCACGG + Intronic
1009018104 6:57925539-57925561 ATGCTAGTATCAGCCAGGCACGG + Intergenic
1009444906 6:63730729-63730751 ATTTTGTTATCGTCTGGGCATGG + Intronic
1009546476 6:65026625-65026647 ATTCAGATATTGGCCGGGCATGG + Intronic
1009886933 6:69634978-69635000 ATGTTATTGTCGGCCGGGCTCGG + Intergenic
1010225065 6:73481242-73481264 ATCCTATTATTGGCTGGGCAAGG - Intronic
1011604721 6:89091915-89091937 AAACTGTAATGGGCCGGGCACGG + Intergenic
1011677847 6:89752832-89752854 ATATTCTTATGGGCCGGGCACGG + Intronic
1012742920 6:103043106-103043128 ATCACCTTATCGGCCGGGCATGG + Intergenic
1012766322 6:103370838-103370860 AAGTTTTTAGCGGCCGGGCACGG - Intergenic
1013329539 6:109086066-109086088 ATCCTGTATTAGGCCGGGCACGG + Intronic
1013722981 6:113053821-113053843 ATCCTGTTTTCGGCCGGGTGCGG + Intergenic
1014135527 6:117884523-117884545 ATGCTGATATGGGCTGGGCATGG - Intergenic
1014213698 6:118732930-118732952 ATGCAGTTCTTGGCTGGGCATGG + Intergenic
1015614048 6:135056361-135056383 ATTGTGTTATTGGCCGGGCGCGG + Intronic
1015971218 6:138744393-138744415 ATGTTCTTTTCGGCCGGGCGTGG + Intergenic
1017886161 6:158601256-158601278 ATGCTATGATAGGCCAGGCATGG + Intronic
1018257501 6:161936497-161936519 AAACTGTTACCAGCCGGGCATGG - Intronic
1018978096 6:168580820-168580842 ATGGTGTTTTAGGCCAGGCATGG - Intronic
1019090267 6:169525244-169525266 ATGCTTTTATCGGCCAGGCGTGG + Intronic
1020001824 7:4760558-4760580 ATACTGTTCTAGGCCGGGCGCGG + Intronic
1021552734 7:21888776-21888798 ATGATATTTTCGGCCAGGCATGG - Intronic
1022175736 7:27870213-27870235 ATGCAGTTAGGGGCCAGGCATGG - Intronic
1023176957 7:37444802-37444824 ATGCTACTATTGGCCGGGCGCGG - Intronic
1023928382 7:44688078-44688100 ATGCTGCTGTGGGCTGGGCATGG + Intronic
1025069560 7:55887095-55887117 ATGATGTTATTGGCCGGGCGCGG - Intergenic
1025938969 7:66059901-66059923 ATGCTATTGTAGGCCGGGCGTGG - Intergenic
1026238377 7:68549320-68549342 GTGCAGTTTTGGGCCGGGCACGG - Intergenic
1026267897 7:68811213-68811235 TTGATGTTACCGGCCAGGCATGG + Intergenic
1026897891 7:74021100-74021122 ATCCTGTTCCTGGCCGGGCACGG + Intergenic
1027590206 7:80110175-80110197 ATTGCATTATCGGCCGGGCACGG + Intergenic
1029195826 7:98804604-98804626 GAGCTGATTTCGGCCGGGCACGG + Intergenic
1029980921 7:104878123-104878145 ATGGTGCTATAGGCCAGGCACGG - Intronic
1030237685 7:107284212-107284234 ATGTTAATATAGGCCGGGCACGG - Intronic
1031209632 7:118805964-118805986 ATTATGTTATGGGCCGGGCACGG + Intergenic
1031210705 7:118822968-118822990 ATCCTGTTTTCAGCCAGGCATGG - Intergenic
1031926811 7:127646646-127646668 ATGCAATTTTCAGCCGGGCACGG - Intergenic
1031981219 7:128126665-128126687 ATGCTGTGCCCGGCCGGGCGCGG - Intergenic
1032001538 7:128268466-128268488 ATGCTGTAATTGGCAGGGAAGGG + Intergenic
1032180633 7:129673847-129673869 AAGCTGTTTTTGGCTGGGCATGG + Intronic
1032217290 7:129967503-129967525 AAGCTGTTCTAGGCCAGGCACGG + Intergenic
1032336771 7:131032432-131032454 ATGATGTTAGGGGCCGGGCGTGG + Intergenic
1032384197 7:131510203-131510225 AAACAGGTATCGGCCGGGCATGG + Intronic
1033536185 7:142313944-142313966 ATCATGTAATAGGCCGGGCATGG + Intergenic
1034171481 7:149066201-149066223 ACTGTGTTATCGGCCGGGCGCGG + Intergenic
1035214036 7:157351336-157351358 AAACTGTTGTGGGCCGGGCACGG + Intronic
1035312753 7:157980459-157980481 ACCCTGTGATTGGCCGGGCACGG + Intronic
1035787305 8:2271866-2271888 ATTCTGTTATGGGCGGGGCAGGG + Intergenic
1035805502 8:2449850-2449872 ATTCTGTTATGGGCGGGGCAGGG - Intergenic
1035878498 8:3218269-3218291 ATGAAGTTATTGGCCGGGCGCGG + Intronic
1036156810 8:6349724-6349746 AAGATATTATCGGCCGGGCGCGG - Intergenic
1038205630 8:25462334-25462356 ATGCAGTTAGCGGCCGGGCGCGG + Intronic
1038807317 8:30806342-30806364 ATCATATTAACGGCCGGGCATGG - Intronic
1038816952 8:30913683-30913705 ATGCAGTATTCGGCCGGGCGCGG + Intergenic
1039011515 8:33098755-33098777 ATGCTATTTTGGGCCAGGCACGG + Intergenic
1039199799 8:35077832-35077854 ATGCTGCTACAGGCCGGGCACGG - Intergenic
1040484181 8:47854627-47854649 ATTCTGTATTTGGCCGGGCACGG - Intronic
1040934414 8:52767615-52767637 ATGCCAATATCGGCCAGGCACGG - Intergenic
1041253461 8:55957650-55957672 ATGCAGTTGTTGGCAGGGCACGG + Intronic
1041284761 8:56249043-56249065 ATACCATTCTCGGCCGGGCATGG + Intergenic
1041492937 8:58454757-58454779 AACCTGTTATAGGCCGGGCGCGG + Intergenic
1041898738 8:62957422-62957444 AAGCTGCTATAGGCCGGGCGCGG - Intronic
1042219236 8:66457186-66457208 ATTCTGTGACCGGCCAGGCACGG + Intronic
1042251690 8:66762257-66762279 AGTCTGTTATAGGCCGGGCGCGG - Intronic
1042526205 8:69767599-69767621 AAGCTGTTTTAGGCCAGGCATGG + Intronic
1042559154 8:70059558-70059580 ATTCTCTTGGCGGCCGGGCATGG - Intronic
1043744061 8:83851319-83851341 ATGCTCTGACTGGCCGGGCACGG - Intergenic
1045008799 8:97939165-97939187 ACGATGTTTTCGGCCAGGCATGG - Intronic
1045338434 8:101230484-101230506 ATGCTGTTGTGGGCCGGGCGCGG + Intergenic
1045424422 8:102049870-102049892 GAGCTGTTTTCGGCCGGGCGCGG + Intronic
1045631982 8:104135304-104135326 ATGCTGATATGGGCCAGGCATGG + Intronic
1047107030 8:121743958-121743980 ATGCTGAGATTGGCCGGGCACGG + Intergenic
1047282238 8:123455713-123455735 ATGCTGATTTCGGCTGGGCGCGG - Intronic
1047610540 8:126516399-126516421 CTGCTATTATGGGCTGGGCACGG - Intergenic
1048085411 8:131172650-131172672 ATGATTTTATAGGCCAGGCATGG + Intergenic
1049209656 8:141379778-141379800 ATGCTGTGACCGGCCGGGCACGG - Intergenic
1050476803 9:6048943-6048965 AAGCTGTTCCAGGCCGGGCACGG - Intergenic
1050702153 9:8352820-8352842 ATGCTATTATTGCCCAGGCATGG + Intronic
1051459796 9:17298951-17298973 ATACCTTTATTGGCCGGGCATGG + Intronic
1051747095 9:20305393-20305415 ATGGTATTATCGGCTGGGCGCGG - Intergenic
1051945376 9:22563124-22563146 ATGCTGTAATAGGCCGGGCGCGG - Intergenic
1052495989 9:29225002-29225024 ATCCTGTGTTCGGCCAGGCATGG + Intergenic
1052870379 9:33500503-33500525 ATCCTGGTAAGGGCCGGGCATGG + Intergenic
1052926173 9:34018571-34018593 GTGCCATTATTGGCCGGGCACGG + Intronic
1053360335 9:37482092-37482114 AAGCTATTCTCGGCCGGGCGCGG + Intergenic
1055597662 9:77881845-77881867 ATGGCATTATGGGCCGGGCATGG + Intronic
1055646247 9:78364175-78364197 ATGGTATTATGGGCCGGGCGTGG + Intergenic
1056250526 9:84743089-84743111 AAGCTAATATAGGCCGGGCATGG - Intronic
1057108637 9:92445591-92445613 AAGCTGTTATTGGCCGGGCGTGG + Intronic
1057688084 9:97254225-97254247 ATCCTGATAAGGGCCGGGCATGG - Intergenic
1057920320 9:99091835-99091857 ATGTTGTTTTCAGCCGGGCATGG + Intergenic
1058071479 9:100604991-100605013 ATACTGTAATAGGCCAGGCACGG - Intergenic
1058919422 9:109598908-109598930 ATACTTTTATTGGCCCGGCACGG + Intergenic
1060274508 9:122172249-122172271 AAGATGTAAGCGGCCGGGCATGG - Intronic
1060672308 9:125480680-125480702 ATGCTTCTATGGGCCGGGCGCGG + Intronic
1060802967 9:126556486-126556508 ATCCTATTATAGGCCGGGCGCGG - Intergenic
1060967329 9:127718920-127718942 ATTCAGTTCTTGGCCGGGCACGG + Intronic
1061319803 9:129821601-129821623 AAGCTGTTTGCGGCTGGGCAAGG + Intronic
1061530546 9:131208725-131208747 ATGAAGTTCTCGGCTGGGCATGG + Intronic
1062298235 9:135847055-135847077 ATCCTACTATAGGCCGGGCACGG + Intronic
1062620558 9:137419377-137419399 ATGCAGTTTAAGGCCGGGCACGG + Intronic
1185493159 X:534536-534558 AACCTGTTTTTGGCCGGGCACGG - Intergenic
1186252438 X:7682824-7682846 ATAACTTTATCGGCCGGGCACGG + Intergenic
1187059349 X:15771056-15771078 AAGATGTTTTTGGCCGGGCACGG - Intronic
1187477134 X:19621377-19621399 ATGGTGTTGGCGACCGGGCATGG - Intronic
1187868872 X:23748143-23748165 ATGCTTTTCCAGGCCGGGCACGG + Intronic
1188359300 X:29233087-29233109 ATGCTTCTTTCGGCCAGGCACGG - Intronic
1188430356 X:30099769-30099791 AGTCTGTTGTCGGCCGGGCACGG - Intergenic
1188686802 X:33079300-33079322 ATGGTTTTATAGGCCGGGCATGG - Intronic
1189270505 X:39748206-39748228 ATGCTGATGGAGGCCGGGCATGG - Intergenic
1189786634 X:44564756-44564778 ATGTTGTTATAGGCCAGGCATGG + Intergenic
1190777646 X:53565880-53565902 AAACTGTTATCAGCCGGGCGAGG - Intronic
1190868058 X:54401251-54401273 AAGTTATTATTGGCCGGGCACGG + Intergenic
1192122102 X:68465959-68465981 ATGCTGACTTAGGCCGGGCACGG - Intergenic
1192481719 X:71491953-71491975 ATGTTGTTAGAGGCCGGGCGCGG - Intronic
1192625258 X:72720297-72720319 ATGGTGTTAGCGGCCGGGCACGG - Intergenic
1193184362 X:78494909-78494931 AGGGTTTTATCGGCCGGGCACGG + Intergenic
1193322404 X:80138271-80138293 ATTTTGTTTTTGGCCGGGCACGG + Intergenic
1194317336 X:92396551-92396573 ATCCTGCTTTTGGCCGGGCACGG + Intronic
1194666060 X:96678776-96678798 ATCCTGTACTCGGCCGGGCGCGG + Intergenic
1194718993 X:97318773-97318795 AAACTGTAATCGGCCGGGCGTGG - Intronic
1195322896 X:103735093-103735115 ATCCTGGTGTAGGCCGGGCACGG + Intergenic
1195645733 X:107228909-107228931 ATCCTGTAATCAGCTGGGCATGG - Intronic
1196667328 X:118330395-118330417 ATGCTGATTTTGGCCGAGCACGG + Intergenic
1196703251 X:118694397-118694419 AAGATATTATGGGCCGGGCATGG + Intergenic
1198026758 X:132714607-132714629 AGAATGTTATTGGCCGGGCACGG - Intronic
1199971153 X:152862869-152862891 ATACTGTGAGAGGCCGGGCACGG + Intronic
1200174479 X:154103615-154103637 ATACTATAATCGGCTGGGCATGG + Intergenic
1200255118 X:154577099-154577121 TTGCTGCAATTGGCCGGGCATGG - Intergenic
1200262651 X:154627305-154627327 TTGCTGCAATTGGCCGGGCATGG + Intergenic
1200383090 X:155860359-155860381 ATGCTATTGGCGGCCGGGCGCGG + Intergenic
1200625511 Y:5509858-5509880 ATCCTGCTTTTGGCCGGGCACGG + Intronic
1201932751 Y:19371647-19371669 ATGCTGTTTTTGGCCAGGCTTGG + Intergenic