ID: 916752394

View in Genome Browser
Species Human (GRCh38)
Location 1:167734895-167734917
Sequence AGGGATCCTGAATATTGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 235}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916752394_916752403 30 Left 916752394 1:167734895-167734917 CCATTCCAATATTCAGGATCCCT 0: 1
1: 0
2: 3
3: 20
4: 235
Right 916752403 1:167734948-167734970 AGCAGACACCCTGCAGACGTTGG 0: 1
1: 0
2: 1
3: 11
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916752394 Original CRISPR AGGGATCCTGAATATTGGAA TGG (reversed) Intronic
901706973 1:11081328-11081350 AAGGATCTTTCATATTGGAAGGG - Intronic
902997923 1:20241818-20241840 AGTGATGATGGATATTGGAAAGG + Intergenic
904406081 1:30288979-30289001 TGGGATCCTGAGACTTGGAATGG + Intergenic
905464848 1:38145415-38145437 TGGGACCCTGAAACTTGGAATGG + Intergenic
906244502 1:44263433-44263455 AGGGTTCCAGAAACTTGGAATGG + Intronic
906347311 1:45025778-45025800 AGGGATTGTACATATTGGAAAGG - Intronic
906930912 1:50168312-50168334 TGGGACCCTGAAACTTGGAATGG - Intronic
907074471 1:51565893-51565915 AGGGATTCTGAATATAGTAAGGG - Intergenic
908603744 1:65770554-65770576 AGGGAAGCTGAATCCTGGAAAGG - Intergenic
909233123 1:73117451-73117473 AAGGATACTAAAAATTGGAATGG + Intergenic
911109378 1:94166200-94166222 TGGGACCCTGAAACTTGGAATGG - Intronic
912051028 1:105527631-105527653 TGGGAGCCTGAAACTTGGAATGG - Intergenic
912066673 1:105753914-105753936 TGGGATCCTGCAACTTGGAATGG + Intergenic
912733689 1:112131507-112131529 TGGGACCCTGAAACTTGGAATGG - Intergenic
913273383 1:117116022-117116044 AGGGAGACTGAATTTTGAAAAGG + Intronic
914703971 1:150156667-150156689 AAGGATACTGAATATTAGTATGG - Intronic
915668026 1:157462339-157462361 TGGGACCCTGAAACTTGGAATGG - Intergenic
916752394 1:167734895-167734917 AGGGATCCTGAATATTGGAATGG - Intronic
916895607 1:169158942-169158964 AGGGAGAATGAATGTTGGAAAGG - Intronic
917078024 1:171226284-171226306 AGGTATCCAGAATGGTGGAATGG - Intergenic
917142227 1:171847493-171847515 AGAGATACTGTATATTGGAGAGG + Intronic
917242615 1:172965346-172965368 ATGGATACAGAATATAGGAAAGG + Intergenic
919230371 1:194765245-194765267 TGGGACCCTGAAACTTGGAATGG - Intergenic
920710322 1:208288497-208288519 AGGGATCCAGAACAGTGGCAAGG - Intergenic
922741634 1:228017299-228017321 AGCGATGCTGGGTATTGGAAGGG + Intronic
924847546 1:247788217-247788239 TGGGATCCTGCAACTTGGAATGG - Intergenic
1063109032 10:3019012-3019034 AAGGGTCCTAAAAATTGGAATGG - Intergenic
1063394025 10:5669936-5669958 TGGGATGCTGAAGAATGGAATGG + Intergenic
1064783174 10:18865018-18865040 AGGGAACCTGAATCTTTTAATGG + Intergenic
1065606672 10:27425402-27425424 TGGGATCCTGAAAATTCGAATGG + Intergenic
1067570106 10:47365311-47365333 AGGGATGCTGAATAAATGAATGG + Intergenic
1069968829 10:72147077-72147099 AGGCATCCTAGATTTTGGAAGGG + Intronic
1070390869 10:75969326-75969348 AGGGATTCTCATTATTGGTAAGG - Intronic
1070822530 10:79369326-79369348 TGAGATCCTGAAATTTGGAATGG - Intergenic
1071820016 10:89270522-89270544 ATGTATCCTTCATATTGGAAAGG - Intronic
1072595185 10:96865283-96865305 AGGGAAACTGAAAATTGGAAGGG + Intronic
1073556965 10:104463219-104463241 TGGGACCCTGAAACTTGGAATGG + Intergenic
1075606505 10:123815430-123815452 TGGGATCCTGCAACTTGGAATGG + Intronic
1075721630 10:124590914-124590936 AGGGATCCTGTTTCCTGGAAAGG - Intronic
1077669104 11:4141602-4141624 TGGGATCCTGAAAATTGGAATGG + Intergenic
1079298495 11:19256323-19256345 AGAGTTCCTGAAGATGGGAAAGG + Intergenic
1081042013 11:38224763-38224785 AGGGAACCTGAACATAGGAAGGG - Intergenic
1081072430 11:38628406-38628428 TGGGATCCTGCAACTTGGAATGG + Intergenic
1081957724 11:47108049-47108071 AGGCATCCAGTATATTGCAAAGG + Intronic
1084914409 11:72417736-72417758 TGGGGACCTGAATACTGGAAAGG + Intronic
1085427445 11:76417182-76417204 TGGGATCCTGAAATATGGAATGG + Intergenic
1085826693 11:79855563-79855585 AAGGATCCTGCATTGTGGAAGGG - Intergenic
1088036114 11:105318255-105318277 AGGGGCCCTGCACATTGGAATGG + Intergenic
1088784119 11:113165182-113165204 GAGGGTCCTGAATAATGGAAAGG - Intronic
1091412394 12:252765-252787 AGGAAGCATGAATATGGGAAGGG - Intronic
1092532883 12:9360076-9360098 AGGGAACCTCCATCTTGGAACGG - Intergenic
1093050012 12:14493659-14493681 TGGGACCCTGAAACTTGGAATGG - Intronic
1093858620 12:24136087-24136109 TAGGATCCTGAAAATGGGAATGG + Intergenic
1094240141 12:28213006-28213028 TGGGATCTTGAAAATTGGAATGG + Intronic
1095603714 12:44043399-44043421 CGGGACCCTGAAACTTGGAATGG + Intronic
1095844841 12:46733192-46733214 TGGGACCCTGAAACTTGGAATGG - Intergenic
1095856589 12:46866372-46866394 TGGGACCCTGAAACTTGGAATGG - Intergenic
1096027036 12:48375528-48375550 TGGAATCCTGAAACTTGGAAGGG + Intergenic
1096591028 12:52659389-52659411 AGGGATCCTGGGTATAGGCAGGG - Intergenic
1097843746 12:64345485-64345507 AGGGACCCTGCAACTTGGAATGG - Intronic
1098855437 12:75647684-75647706 AGGGTGCCTGAATATAGCAAGGG - Intergenic
1099434443 12:82627015-82627037 AGGCAGCCTGAATATAGCAATGG + Intergenic
1099444240 12:82733169-82733191 AGGAAAGCTGAATATTGGAAAGG + Intronic
1099859759 12:88211309-88211331 TGGGACCCTGAAACTTGGAATGG - Intergenic
1104046307 12:125165537-125165559 AGGGATGCTGAAGCTTAGAATGG - Intergenic
1107640311 13:42435791-42435813 ATGCATCCTAAATAATGGAAAGG - Intergenic
1107983941 13:45758668-45758690 TGGGATCCTGCAACTTGGAATGG - Intergenic
1108766489 13:53636994-53637016 AAGAATCCTGAATATAAGAATGG + Intergenic
1109477068 13:62894020-62894042 AGGAATGTTGAACATTGGAAAGG + Intergenic
1111016545 13:82388531-82388553 TGGGACCCTGAAACTTGGAATGG - Intergenic
1114809299 14:25878062-25878084 AGGGAGCCTGATTATTAGAGGGG - Intergenic
1114996529 14:28359623-28359645 AGAGATCCTGAAAACTGTAAAGG + Intergenic
1115176406 14:30566223-30566245 AGGGATCCTGAATAGTCAAAAGG - Intronic
1116720423 14:48488835-48488857 AGGGATTCTGAATAAGTGAAAGG + Intergenic
1120056551 14:79930757-79930779 TGGGGTCCTGAAAATTGGAATGG - Intergenic
1120082392 14:80230244-80230266 TGGGACCCTGAAATTTGGAATGG - Intronic
1121939948 14:98060822-98060844 TGGGATTCTGCACATTGGAATGG - Intergenic
1123877674 15:24640089-24640111 TGGGATCTTGTAAATTGGAATGG - Intergenic
1123903591 15:24900341-24900363 TGAGATCCTGAAACTTGGAATGG + Intronic
1124530185 15:30499013-30499035 TGGGATCCTGTAAATTGGGATGG + Intergenic
1124768474 15:32508675-32508697 TGGGATCCTGTAAATTGGGATGG - Intergenic
1134024832 16:10945643-10945665 GGGGATCGTGAACATTGTAATGG + Intronic
1137337311 16:47562688-47562710 ATGGTTGCTGAAGATTGGAATGG + Intronic
1143957737 17:10686279-10686301 AGGAATTTTGAATATTTGAAAGG - Intronic
1147122549 17:38344072-38344094 AGGGAGCCTGAATACTGGATAGG - Intergenic
1148963417 17:51412927-51412949 AGGCATCATGAATATTTGGATGG + Intergenic
1151184376 17:72352375-72352397 AGGAGTCCTGCAAATTGGAAAGG + Intergenic
1152819301 17:82428398-82428420 AGGTATCCTGATTTCTGGAAAGG - Intronic
1153048696 18:880975-880997 TGGGATCCTGGAAATGGGAATGG + Intergenic
1153130813 18:1853843-1853865 AGGAATCCTGACTATTTAAAAGG + Intergenic
1153131637 18:1860391-1860413 AGGGACCCTGCAACTTGGAATGG - Intergenic
1157904810 18:51560381-51560403 ATGGGTCCTGAAGAATGGAAAGG - Intergenic
1159198811 18:65155895-65155917 TGGGAAACTGAATGTTGGAAAGG + Intergenic
1165337395 19:35181012-35181034 TGGGATCCTGAAAATTGGGATGG + Intergenic
1166635231 19:44445421-44445443 TGGGAAACTGAATATTGGGAAGG - Intronic
925043554 2:752906-752928 CTGTTTCCTGAATATTGGAACGG - Intergenic
925536150 2:4919039-4919061 ATGGGTGCTGACTATTGGAATGG - Intergenic
925595982 2:5555882-5555904 AGAGATCCTCACTTTTGGAAAGG + Intergenic
928285714 2:29988380-29988402 AGGGATTCTGTGTACTGGAAGGG + Intergenic
928472036 2:31584395-31584417 AGGAATGCTGGATATTGTAAAGG - Intergenic
929934747 2:46286480-46286502 AGGGATCCTGGACCCTGGAAGGG - Intergenic
931091833 2:58894463-58894485 AGATATCCTGAATATAGGGAGGG - Intergenic
933150846 2:78913008-78913030 AGGGATAGTGAATATTTGAGAGG + Intergenic
933534443 2:83554521-83554543 AGGGATGTTGAATATTGTCAAGG + Intergenic
933821355 2:86115143-86115165 TGGGAACCTGGATATTGGAAGGG - Intronic
937091514 2:119209462-119209484 TGGGATCCCGAATAAGGGAAAGG + Intergenic
937548016 2:123048580-123048602 TGGGATCCAGAATGTTGTAATGG - Intergenic
939789039 2:146548785-146548807 TGGGACCCTGAAACTTGGAATGG - Intergenic
939876861 2:147587384-147587406 AGGGATGGGGAATATTGGCAGGG + Intergenic
941293052 2:163700017-163700039 AGAGATACAGAAAATTGGAAAGG + Intronic
942447363 2:176086824-176086846 AGGGACATTAAATATTGGAATGG - Intergenic
942534392 2:176948209-176948231 TGGGAACCTCAAAATTGGAACGG + Intergenic
944103230 2:196052098-196052120 TGGGATCCTGAAAGTTTGAAAGG - Intronic
946528221 2:220542667-220542689 TGGGACCCTGAAACTTGGAATGG - Intergenic
946790561 2:223297045-223297067 TGGGATCCTGCAACTTGGAATGG + Intergenic
948124797 2:235556607-235556629 AGGGAACCAGAGTATTGGAAAGG - Intronic
1169018045 20:2307610-2307632 AGTGATCATGAATGGTGGAATGG - Intronic
1169349763 20:4858746-4858768 AGGGATCATGGGTATTGGAGAGG + Intronic
1169615236 20:7435811-7435833 TGGGATCCTAAAGATTGGAATGG - Intergenic
1170990696 20:21299347-21299369 TTGGATCCTGAAAGTTGGAATGG - Intergenic
1171847861 20:30288648-30288670 AGGGATCCCACATATGGGAATGG - Intergenic
1175063610 20:56266488-56266510 AGGGATGCAGAATTTTGGTAAGG - Intergenic
1175555022 20:59845562-59845584 AGGAATTCTGAATATTAGAGGGG - Intronic
1177257766 21:18688719-18688741 TGGGATCCTCAAAATTTGAATGG + Intergenic
1177404935 21:20654343-20654365 AAGGATGCTGAACATTGGCAAGG - Intergenic
1177700467 21:24632793-24632815 TGGGATCCTAAAAGTTGGAATGG - Intergenic
1179037302 21:37769654-37769676 TGGGATCCTGACATTTGGAATGG + Intronic
1179244832 21:39623893-39623915 AGGGTTCCTGAAGAAAGGAATGG - Intronic
1179414172 21:41185092-41185114 AGAGATCCTTAATATAGGCATGG - Intronic
1182717068 22:32365489-32365511 AGGGATCCTAAATACAGAAATGG + Intronic
1184306275 22:43604574-43604596 AGGGAGCCTCAAGATGGGAAAGG - Intronic
951713715 3:25613885-25613907 AAGGATCCTGAAGCTTGGAGAGG - Intronic
951792458 3:26501409-26501431 TGGGATCCGGAAAAGTGGAATGG + Intergenic
952085975 3:29821626-29821648 ATGAAGCCAGAATATTGGAATGG + Intronic
958936268 3:100259567-100259589 GGAGGTCCTGAATATTAGAATGG + Intergenic
960721354 3:120627421-120627443 AGGGATGCTGACCATAGGAAGGG + Intergenic
962683794 3:137826863-137826885 TGGAATCCTGAGAATTGGAATGG + Intergenic
964512083 3:157463783-157463805 AGGTATCCTGAAAATGTGAAAGG - Intronic
967831402 3:193923267-193923289 TGGGACCCTGAAACTTGGAATGG + Intergenic
970086092 4:12347833-12347855 AAGGATCCTGAAGACTGGAGTGG - Intergenic
971059645 4:22953295-22953317 AAGGAGCCTGAGTGTTGGAATGG + Intergenic
971120271 4:23696696-23696718 AGGGACCTTGAATACTTGAAGGG + Intergenic
972373112 4:38445001-38445023 AGGGCTGCTGAATTTTGAAAAGG + Intergenic
973638168 4:52878933-52878955 AGGGACCCTGAAAAGGGGAAAGG - Intronic
975761601 4:77625563-77625585 TGGGACCCTGAAAATTGGGATGG + Intergenic
975807939 4:78132773-78132795 AGGGTTACTGAAGATGGGAAGGG + Intronic
977337711 4:95719091-95719113 TGGAATCCTATATATTGGAATGG - Intergenic
980386602 4:132093195-132093217 TGGGACCCTGAATCTTGGAATGG - Intergenic
980691935 4:136306420-136306442 TGGGAGCCTGATAATTGGAATGG - Intergenic
981226013 4:142295068-142295090 AGGGTACCTGAATGTAGGAAGGG + Intronic
982878035 4:160671868-160671890 TTGGATACTGAAAATTGGAATGG - Intergenic
983387071 4:167078376-167078398 AGGGATCTGGAATGTTGGGAAGG + Intronic
984256856 4:177399869-177399891 TGCAATCCTGAATATTGGAGTGG - Intergenic
984680425 4:182602048-182602070 GGAGATCCTGAATAATGAAATGG - Intronic
986524977 5:8664087-8664109 TAGGATCCTGTATGTTGGAATGG + Intergenic
986828731 5:11551298-11551320 AGGGATGCAAAATATTGGCAGGG - Intronic
987152804 5:15058968-15058990 GGGGACCCTGAAACTTGGAATGG + Intergenic
987491156 5:18581836-18581858 TGGGATCCTGAAACTTGAAATGG - Intergenic
987578719 5:19761041-19761063 GGGGACCCTGAAACTTGGAATGG - Intronic
987788144 5:22528387-22528409 TGTGATCCTGAAAGTTGGAATGG - Intronic
987901582 5:24018761-24018783 TGAGATTCTGAATGTTGGAATGG - Intronic
988763205 5:34339635-34339657 AGGAGTCATGAATATTTGAAAGG + Intergenic
990338906 5:54802856-54802878 ATGGATCCTGAATTTTGGATGGG - Intergenic
990938181 5:61172994-61173016 TGGGATCCTGAACATGGGATGGG + Intergenic
991055594 5:62316456-62316478 AGAGATTCTGAATACTGAAATGG - Intronic
993360495 5:86969019-86969041 AGTGATACTGAATTTTAGAATGG - Intergenic
993791422 5:92216200-92216222 TGGGACCCTGAAACTTGGAATGG + Intergenic
993925014 5:93855767-93855789 AAGAATGTTGAATATTGGAAAGG + Intronic
996825203 5:127675108-127675130 TGGGACCCTGAAACTTGGAATGG + Intergenic
998290702 5:140911302-140911324 TGGGATCCTGAAACTTGGAATGG - Intronic
998518438 5:142777841-142777863 AGGGATCTTGAATTCTAGAAAGG + Intronic
1000416615 5:160991219-160991241 TGGGACCCTGAAACTTGGAATGG + Intergenic
1000645953 5:163760475-163760497 AAGGACCCTGAATACAGGAATGG + Intergenic
1003696267 6:8408808-8408830 TGGGATCCTGCAACTTGGAATGG - Intergenic
1004922747 6:20392095-20392117 AGGGCTCCAGGATTTTGGAATGG + Intergenic
1005187315 6:23177488-23177510 AGGTTTCCTGAATGTTGCAAGGG + Intergenic
1005589570 6:27310454-27310476 AGGTACCCTGAATTGTGGAAAGG + Exonic
1005697231 6:28363045-28363067 AGGGACCAGGAATTTTGGAAAGG + Intronic
1006054839 6:31376591-31376613 TGGGATCCTGAAAATCAGAATGG - Intergenic
1007252585 6:40505977-40505999 CAGGATCCTGAATATTGAGATGG - Intronic
1007367194 6:41403130-41403152 GAGCATCCTGAATACTGGAATGG + Intergenic
1009308284 6:62119592-62119614 TGGGACCCTGCATCTTGGAATGG + Intronic
1009626005 6:66139470-66139492 AGGGAACCTGAAAATGGGATGGG + Intergenic
1012342220 6:98141923-98141945 AGAGATTCTTAAAATTGGAAGGG - Intergenic
1014539027 6:122651596-122651618 TGGGATCTTGAAAATTAGAATGG - Intronic
1014980961 6:127946040-127946062 GGGGACCCTGAAACTTGGAATGG + Intergenic
1015240636 6:131019386-131019408 AATGATCATAAATATTGGAAAGG - Intronic
1017082917 6:150685639-150685661 AGGTTTTCTGAATTTTGGAAAGG + Intronic
1018003776 6:159602144-159602166 AGGGACCATGAATTATGGAAAGG - Intergenic
1019574023 7:1727588-1727610 AGGCAGACAGAATATTGGAAGGG - Intronic
1020673784 7:11154366-11154388 AGAAATACTGACTATTGGAATGG - Intronic
1021300024 7:18961164-18961186 AGGTATTCCCAATATTGGAAAGG + Intronic
1022864172 7:34400050-34400072 AGGGATCCAGAATTTGGGCAGGG + Intergenic
1024958626 7:54951791-54951813 TGGGATCCTGCAACTTGGAATGG - Intergenic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1030277088 7:107733399-107733421 TGGGACCCTGAAACTTGGAATGG + Intergenic
1030507500 7:110443398-110443420 TGTGAACCTGAAAATTGGAAGGG + Intergenic
1031650745 7:124286581-124286603 AGGGATCCTGAAAATCAGCATGG + Intergenic
1031897505 7:127368332-127368354 AGGGATCCTTGGTATTGAAAAGG - Intronic
1031969172 7:128051623-128051645 AGGGATCCTGATAAATGGAGGGG + Intronic
1032104028 7:129009933-129009955 TGGGATTCTGAAACTTGGAAAGG + Intronic
1032153483 7:129449648-129449670 TGGGACCCTGAAACTTGGAATGG - Intronic
1033107955 7:138547237-138547259 AGGGATTCAGGGTATTGGAAGGG + Intronic
1033554419 7:142476269-142476291 TGTGATCCTGGATCTTGGAATGG - Intergenic
1033556692 7:142494370-142494392 TGTGATCCTGAATCTTGGAATGG - Intergenic
1034544265 7:151779547-151779569 AGGGAACCTGATGATCGGAAGGG - Intronic
1034734572 7:153416552-153416574 CTGGATCCTGAATATTGGAATGG - Intergenic
1037101041 8:15046606-15046628 AGGGATCATGACTCTTGGACTGG - Intronic
1038016032 8:23515898-23515920 AGCTATACTGTATATTGGAAAGG + Intergenic
1038723832 8:30061441-30061463 TGGGATCCTGAAAAGTGGAATGG - Intergenic
1038790824 8:30666699-30666721 TGAGATACTGAAAATTGGAATGG - Intergenic
1039687467 8:39820436-39820458 TGGGATCCTGAAAATTGGAATGG + Intronic
1040406214 8:47105751-47105773 AGGGATACTGATAATGGGAAAGG + Intergenic
1041803373 8:61823644-61823666 GGGGATCCTGAAAGTTTGAAGGG - Intergenic
1043274082 8:78371671-78371693 AGGGATCCTGTGTAATGGAGAGG + Intergenic
1048436261 8:134421128-134421150 TGGGATCCTGAAATTTTGAATGG - Intergenic
1049966949 9:788506-788528 TGGGGTTGTGAATATTGGAAGGG + Intergenic
1050794664 9:9523351-9523373 AGGTCTCCTGTATATTGGAGGGG + Intronic
1050937367 9:11414679-11414701 TGGGATCCTGATAACTGGAATGG + Intergenic
1051437178 9:17045115-17045137 AGGGATCCTGTATCTGGGGAAGG + Intergenic
1052151796 9:25126234-25126256 TGGGACCCTGAACCTTGGAATGG - Intergenic
1053182132 9:35981758-35981780 TGGGATCCTGAATTTGGAAATGG - Intergenic
1053610392 9:39707589-39707611 ATGGAATCTGAATATTGGAGTGG + Intergenic
1053785995 9:41653294-41653316 AGGGATCCCACATATGGGAATGG - Intergenic
1053868429 9:42465619-42465641 ATGGAATCTGAATATTGGAGTGG + Intergenic
1054087860 9:60763567-60763589 ATGGAATCTGAATATTGGAGTGG - Intergenic
1054159056 9:61660903-61660925 AGGGATCCCACATATGGGAATGG + Intronic
1054174710 9:61867227-61867249 AGGGATCCCACATATGGGAATGG - Intergenic
1054243131 9:62634806-62634828 ATGGAATCTGAATATTGGAGTGG - Intergenic
1054449568 9:65396287-65396309 AGGGATCCCACATATGGGAATGG - Intergenic
1054478830 9:65591908-65591930 AGGGATCCCACATATGGGAATGG + Intergenic
1054557256 9:66669324-66669346 ATGGAATCTGAATATTGGAGTGG - Intergenic
1054662828 9:67713566-67713588 AGGGATCCCACATATGGGAATGG + Intergenic
1055747821 9:79470081-79470103 AGTGATCCTGAAAGTTGAAATGG - Intergenic
1055825787 9:80322839-80322861 AGGGAATATTAATATTGGAATGG - Intergenic
1055994989 9:82147545-82147567 AGAGATCTTGAATATTGAATTGG + Intergenic
1056134783 9:83621383-83621405 AGGGAGCCTTTATATGGGAAGGG - Intergenic
1056437743 9:86589648-86589670 AGGGACCCTCAAAATAGGAAGGG + Intergenic
1056644606 9:88399944-88399966 TGGAATCCTGAAAATTGGATTGG + Intronic
1057149141 9:92780810-92780832 TGGGATCCTGAAAATTGAGATGG + Intergenic
1057316214 9:93970420-93970442 TGGGATCCTGCAACTTGGAATGG + Intergenic
1057714024 9:97474475-97474497 AGGGATGCAGAAAATTGGTAAGG - Intronic
1058188847 9:101888968-101888990 TGGGATTCTGAACATTGGGAAGG + Intergenic
1060434221 9:123579870-123579892 AAGGATTCTGAAGATTGTAATGG - Intronic
1060612046 9:124975936-124975958 AGGGATCCTGGTTGTTGGCAAGG + Intronic
1061439288 9:130589020-130589042 AGGGATCCTGTTGATTGGCATGG - Intronic
1061753663 9:132798070-132798092 AGGGATCCTGGATCCTGGTAGGG + Intronic
1186625364 X:11287583-11287605 AGAGACCCTGAATGTTGGACAGG - Intronic
1187209256 X:17212666-17212688 AGAGAGGCAGAATATTGGAAGGG - Intergenic
1187385402 X:18844035-18844057 TGGCAGCCTGAAAATTGGAATGG + Intergenic
1188028498 X:25236729-25236751 AGGGATTTTGAAGATTGGAATGG + Intergenic
1189372186 X:40437653-40437675 TGGGATCCTGAAAGTTGGAATGG + Intergenic
1193574038 X:83177685-83177707 TGGGACCCTGTATCTTGGAATGG - Intergenic
1193739974 X:85205022-85205044 AAGGATCCTGGATAGTGGATTGG + Intergenic
1194209921 X:91059661-91059683 TGGGACCCTGCATCTTGGAATGG + Intergenic
1194933750 X:99921620-99921642 AGGGAACCTGAATCTTATAATGG - Intergenic
1196372682 X:114996857-114996879 TGGGACCCTGCATCTTGGAATGG - Intergenic
1198776970 X:140190247-140190269 ATGGATCCTAAATACTGCAAGGG - Intergenic
1201707496 Y:16953465-16953487 AGGGATGCTGAATTTTGTCAAGG - Intergenic