ID: 916753131

View in Genome Browser
Species Human (GRCh38)
Location 1:167741735-167741757
Sequence AAAACCCTTTAGTCTTGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 224}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916753131 Original CRISPR AAAACCCTTTAGTCTTGGCT GGG Intronic
901761922 1:11477416-11477438 AAAACCCTTTGCTCTCAGCTGGG + Intergenic
903194639 1:21676120-21676142 AAAACCCTGTACTCTGGGGTGGG + Intergenic
903972129 1:27125884-27125906 AAAAAGCTTCACTCTTGGCTGGG - Intronic
905303942 1:37004868-37004890 AAGTCCCTTTTTTCTTGGCTGGG - Intronic
906470679 1:46127856-46127878 AAAACTTTTTATTTTTGGCTAGG - Intronic
907509128 1:54945553-54945575 GAGACCCTTAGGTCTTGGCTGGG + Intergenic
907608964 1:55848386-55848408 CAAACCCTTAATTCTTGGCATGG + Intergenic
907645796 1:56242177-56242199 AAAAACCCTTTCTCTTGGCTGGG - Intergenic
908934778 1:69362057-69362079 AAGACCATTTTGTTTTGGCTGGG + Intergenic
909955306 1:81771952-81771974 AAAACATTTTATCCTTGGCTGGG + Intronic
910153904 1:84191223-84191245 AAATTCCTTTAGTGTTTGCTTGG + Intronic
910980158 1:92952322-92952344 TAAAGGCTTTAGTTTTGGCTGGG + Intronic
911412253 1:97524435-97524457 TAAACTCTGAAGTCTTGGCTGGG + Intronic
911456409 1:98129698-98129720 ATAAGCCATTAGTCTTGGCTAGG + Intergenic
912474257 1:109925569-109925591 CAAGCCCTATATTCTTGGCTTGG + Intronic
916086419 1:161273320-161273342 AGAAACATTTAGTCCTGGCTGGG + Intronic
916560829 1:165933056-165933078 AAAATCAATCAGTCTTGGCTGGG - Intergenic
916688145 1:167166432-167166454 AACACCCTTTCGTCTTAGCCTGG - Intergenic
916753131 1:167741735-167741757 AAAACCCTTTAGTCTTGGCTGGG + Intronic
920131343 1:203734411-203734433 AAAATCAGTTAATCTTGGCTGGG + Intronic
921541869 1:216425799-216425821 AAAACCCTTGAATCTGTGCTAGG - Intergenic
923200822 1:231709661-231709683 AAAATTCTTTTGGCTTGGCTTGG - Intronic
923937188 1:238776378-238776400 CCAACCCTTTAGTCATGCCTTGG - Intergenic
924326052 1:242894822-242894844 AAAAGCCATTAGTCTTGGCCAGG - Intergenic
924326091 1:242895110-242895132 AAAAACCATCAGTCTAGGCTGGG - Intergenic
1063108759 10:3017111-3017133 AAAACCCTTGAGAGTAGGCTGGG + Intergenic
1064056694 10:12103804-12103826 AAAACCCTCTAGGCTGGGCACGG - Intronic
1064443403 10:15372397-15372419 AAAAACCTCCAGACTTGGCTGGG + Intergenic
1064877830 10:20015259-20015281 AAAATCCTTATGTCTTGGCAAGG + Intronic
1064978342 10:21142026-21142048 AAAACCCTTTAATCCCGGCCAGG - Intronic
1066504269 10:36025352-36025374 CCAACCCTTTAATCTTGCCTTGG + Intergenic
1072440417 10:95449121-95449143 AAAAACCTTTAGTTTTTGTTGGG - Intronic
1078084887 11:8227962-8227984 AAAACACTTTAATTTTGGCAAGG - Intronic
1078144947 11:8716190-8716212 GAAACCTTTTAGGATTGGCTCGG - Intronic
1078210959 11:9269061-9269083 AAAAACATTAAATCTTGGCTTGG - Intergenic
1078547174 11:12254813-12254835 AAAGCCTTTTAGTCCTGGGTGGG - Intronic
1078820352 11:14873890-14873912 AAAATTCCTTATTCTTGGCTGGG + Intergenic
1080072301 11:28104407-28104429 AAAACACTTCAGTCTTGTTTTGG + Intronic
1080485174 11:32698317-32698339 AAAAAACTTCAGTGTTGGCTGGG - Intronic
1080656901 11:34265363-34265385 AAAACCCATCAGAATTGGCTGGG + Intronic
1080881645 11:36326881-36326903 AAAACCCTTTTGTCTGCACTGGG + Intronic
1081901403 11:46631566-46631588 AAAAACATTTAGTCTGGTCTGGG + Intronic
1088082329 11:105933634-105933656 AAAACGCTTTATTCTTATCTTGG + Intronic
1088665645 11:112090984-112091006 AAACCCCTTTAGGCTGGGCACGG - Intronic
1089446047 11:118553149-118553171 AATACCATTTAGGCTGGGCTTGG + Intronic
1089840159 11:121410275-121410297 AAAAACCTTTATTCTTTGATGGG + Intergenic
1089840300 11:121411557-121411579 AAAAACCTTTATTCTTTGATGGG + Intergenic
1093027362 12:14257339-14257361 AAAGCCCTTCAGTCTTTGATGGG + Intergenic
1095338253 12:41056036-41056058 AATGCCCTTTAGTCTGGGCCTGG + Intronic
1097396689 12:59083674-59083696 AAAACCCTTTCATCTCAGCTGGG - Intergenic
1097858302 12:64491323-64491345 AAAATACTGTACTCTTGGCTGGG + Intronic
1098329648 12:69339796-69339818 AAAGACATTTAGACTTGGCTGGG - Intergenic
1099076919 12:78121335-78121357 AAAACCCTTTGGCCTCTGCTGGG + Intronic
1099434275 12:82624967-82624989 AAAATCCTTTGGTCTTAGATGGG + Intergenic
1101356006 12:103978214-103978236 GAAACCCATTAGCCATGGCTAGG - Intronic
1102409976 12:112709252-112709274 AAAAATATTTACTCTTGGCTGGG + Intronic
1103116834 12:118341723-118341745 AAAACCCTTCTGTGTTGGCTAGG + Intronic
1104408829 12:128541439-128541461 CAAACCCTCTATTCTTGCCTTGG + Intronic
1105935457 13:25094551-25094573 GAAACCCTCTACTCTAGGCTAGG + Intergenic
1106272963 13:28172158-28172180 ACAATTATTTAGTCTTGGCTGGG + Intronic
1106294561 13:28399365-28399387 AAAACCCATTTCTGTTGGCTTGG + Intronic
1107384244 13:39890656-39890678 AAAACACTGTAGTCCTGGCCAGG - Intergenic
1108846781 13:54687795-54687817 AAGATCATTTAGTTTTGGCTGGG - Intergenic
1108971947 13:56387806-56387828 AAAACCCTTTATTTCTTGCTTGG - Intergenic
1109559339 13:64026126-64026148 TAAACCCTATAGTGTTGGCAGGG - Intergenic
1111133007 13:84000229-84000251 AAAAAACTTTACCCTTGGCTGGG - Intergenic
1114073623 14:19135884-19135906 AAAGCCCTTTTGTAATGGCTGGG + Intergenic
1114088641 14:19264101-19264123 AAAGCCCTTTTGTAATGGCTGGG - Intergenic
1115340635 14:32290291-32290313 AAAAGCATTCAGTTTTGGCTGGG + Intergenic
1116514598 14:45789556-45789578 AAAACCCAGAAGTTTTGGCTGGG - Intergenic
1116964137 14:50997371-50997393 CAGTCCCTTCAGTCTTGGCTAGG - Intronic
1117298872 14:54404262-54404284 AAGTCCCTTTAGTCTTGGGAGGG + Intronic
1117676810 14:58163691-58163713 AAAACCCTCTTGGCTGGGCTTGG - Intronic
1117774325 14:59166858-59166880 AAAATTTTTTAGTCTGGGCTTGG - Intergenic
1118386144 14:65257076-65257098 AAAACACTTGGGACTTGGCTGGG + Intergenic
1118718640 14:68578248-68578270 AAACCCCTTTTCTATTGGCTGGG + Intronic
1119124042 14:72107705-72107727 AAAACCCTGTAGTCCTGAATTGG - Intronic
1121044977 14:90781271-90781293 AAAACAGATTAGTCTTGGCTAGG + Intronic
1121128714 14:91426452-91426474 AAAAGCATTCAGTCTTGGCTAGG + Intergenic
1121485300 14:94310119-94310141 AAAACCCTTGAGGCTTGAATGGG - Intronic
1127943803 15:63729089-63729111 AGATTCCTTTAGTCTTGGTTTGG - Intronic
1128979504 15:72176086-72176108 CAGACCCTTTATTCTTTGCTTGG - Intronic
1130152396 15:81321314-81321336 AAAAACAATTAGTCTTGGCCAGG + Intronic
1131045060 15:89307811-89307833 AAAGCCCTCAAGCCTTGGCTTGG - Intronic
1135395620 16:22129625-22129647 AAACCCCTTATTTCTTGGCTAGG - Intronic
1136612169 16:31372773-31372795 AAAACCCAGGTGTCTTGGCTGGG + Intronic
1137984493 16:53096216-53096238 TAAATCCTTACGTCTTGGCTGGG - Intronic
1138588975 16:57989139-57989161 AAAGCTCTTTAGTGTTCGCTGGG - Intergenic
1140131730 16:72167759-72167781 AATACCCTATACTCTTGCCTTGG + Intronic
1141156699 16:81601901-81601923 AAAGCCCCTTAGCCTTGGCCAGG + Intronic
1142137958 16:88460195-88460217 AAAACCCCTCTGGCTTGGCTTGG - Intronic
1143026838 17:3945950-3945972 AAAACTCTTTATTATTAGCTGGG + Intronic
1143588845 17:7867625-7867647 AAAACCCTTAACTCTGGGCCAGG - Intronic
1144361567 17:14499740-14499762 AGACCCCTTTAGTCTTGCCTTGG - Intergenic
1144568127 17:16377017-16377039 AAAAACCTTTATTTTTGGCCGGG - Intergenic
1144640952 17:16936160-16936182 AGAACCCTTGAGACTAGGCTGGG + Intronic
1144874131 17:18388358-18388380 AGAACCCTTGAGACTAGGCTGGG - Intronic
1144932529 17:18871308-18871330 AAGACCCTTTAGGCTGGGCACGG - Intronic
1145158092 17:20556058-20556080 AGAACCCTTGAGACTAGGCTGGG + Intergenic
1147777398 17:42912125-42912147 AAAGCCATTTAGACATGGCTTGG - Exonic
1150178595 17:63090104-63090126 AAAACACTTAAGTCGTTGCTAGG - Intronic
1153982684 18:10324249-10324271 AAAACCCCTTAGTTTTAGCATGG + Intergenic
1154978135 18:21479175-21479197 AAAATTAATTAGTCTTGGCTGGG - Intronic
1158903726 18:61990322-61990344 AAATCCCTTTAGCATTAGCTAGG + Intergenic
1162247549 19:9414997-9415019 AAAACACCTAAGTGTTGGCTGGG + Intronic
1164089813 19:21939528-21939550 AAAAAATTTTTGTCTTGGCTGGG - Intronic
1164194132 19:22939438-22939460 AAAAAATTTTTGTCTTGGCTGGG - Intergenic
1166515762 19:43445629-43445651 AAAACAATTGAGTTTTGGCTTGG - Intergenic
1166707946 19:44918951-44918973 TAAACACTTTACCCTTGGCTGGG - Intronic
1166709998 19:44930778-44930800 TAAACACTTTACCCTTGGCTGGG - Intergenic
1166967219 19:46536360-46536382 ATAAACCTTTAGGCTTGGCATGG - Intronic
1167860811 19:52282338-52282360 GAAACCCTGTTGACTTGGCTGGG + Intronic
1168632980 19:57971764-57971786 AAAAGCCTTTATTCTGGGCCGGG - Intronic
926288970 2:11513572-11513594 GAAACTCTATAGTCCTGGCTTGG + Intergenic
927418776 2:22907532-22907554 AACACCCTTCAGTGTTGGCAAGG + Intergenic
930375252 2:50557567-50557589 AAAACTCTTGAGACTTGGCAAGG - Intronic
930796144 2:55393587-55393609 AAAACTCTATAGTTTTGGCTGGG - Intronic
938967803 2:136404084-136404106 TAACTCCTTAAGTCTTGGCTAGG + Intergenic
939241367 2:139564488-139564510 AAAAACTTTTTGGCTTGGCTGGG - Intergenic
940144489 2:150532019-150532041 AAAACCCCTTACTAGTGGCTGGG + Intronic
940355746 2:152739278-152739300 AAAAGCATTCAGTTTTGGCTGGG - Intronic
941545118 2:166840635-166840657 AAAAACCTTTAATCTTTGTTTGG - Intergenic
945450524 2:209989664-209989686 AAAACCCCTTAGTCTTCTCCTGG + Intronic
946848586 2:223883017-223883039 AAAACCCTTTAGGCTGGGCATGG - Intronic
947100620 2:226617328-226617350 AAAACACTTAAGTCTAGGCCTGG - Intergenic
948816994 2:240516122-240516144 AAAAACCTTTACTCTTTGATTGG - Intronic
1173212076 20:41042203-41042225 AATATCCTGTAATCTTGGCTGGG - Intronic
1174990728 20:55506399-55506421 TAAAACCTTCAATCTTGGCTGGG + Intergenic
1176819122 21:13639382-13639404 GAAACCCCTTTGTCTTGTCTTGG + Intronic
1177531096 21:22359154-22359176 AAAACCCTTGTGTATTTGCTAGG - Intergenic
1179139221 21:38709569-38709591 AGAAACCTCTAGTTTTGGCTAGG + Intergenic
1180492069 22:15858236-15858258 AAAGCCCTTTTGTAATGGCTGGG + Intergenic
1181044799 22:20209473-20209495 AAACCCCTTGAGTGATGGCTGGG + Intergenic
1182373630 22:29829946-29829968 TTGTCCCTTTAGTCTTGGCTTGG - Intronic
1182987849 22:34737944-34737966 AAAATCCTCTCTTCTTGGCTTGG + Intergenic
1183876878 22:40790047-40790069 AAAACACTTTAGGCTGGGCGCGG + Intronic
1185073848 22:48672157-48672179 AACAGCCTTTGTTCTTGGCTTGG + Intronic
1185137716 22:49082130-49082152 AAAACCCTTTTTTTTTGGCTGGG - Intergenic
951476339 3:23110497-23110519 AAAAAGGTTTAGTCTTGGCCAGG + Intergenic
953919355 3:46941265-46941287 AAAATCCATAACTCTTGGCTGGG + Intronic
955340583 3:58122195-58122217 AAAAAACATTATTCTTGGCTGGG + Intronic
955736052 3:62039228-62039250 AAAAACCATAACTCTTGGCTAGG - Intronic
955982406 3:64540143-64540165 AGAACCCTTGGGTCTTAGCTGGG + Intronic
956205311 3:66749180-66749202 AAAAACCCTTTCTCTTGGCTGGG + Intergenic
957316042 3:78578181-78578203 AAAACCCTTTATTCTGGGGCTGG - Intergenic
957714811 3:83913341-83913363 AAAAACCTTTATTCTTTGATGGG + Intergenic
958737202 3:98023270-98023292 AAAACCCTTTCCTCTAGGATAGG + Intronic
961018377 3:123484251-123484273 AAAACACTTTAGGCCAGGCTCGG - Intergenic
967705697 3:192647919-192647941 AAAACACTTTAGTATTTGATAGG + Intronic
969853028 4:9977086-9977108 CAACCCCTTCAGTCCTGGCTGGG + Intronic
970484657 4:16512873-16512895 AAAACCATTTAGGATTGCCTTGG + Intronic
976660298 4:87533750-87533772 AAAATCCACTAGTCCTGGCTGGG - Intergenic
977033207 4:91914803-91914825 TAAACCCTTTAATTTTAGCTGGG - Intergenic
977774184 4:100897731-100897753 AAAATCCTTTAGTCTTAAATAGG + Intergenic
978034105 4:103973300-103973322 AAGACCATTTTGTTTTGGCTGGG - Intergenic
978234541 4:106442997-106443019 AAATCCCTCTATTCTTGACTTGG + Intergenic
978666038 4:111183091-111183113 AGCCCCCTTTAGCCTTGGCTGGG + Intergenic
980058933 4:128107704-128107726 AATACGCTTTAATCTTGTCTTGG + Intronic
981784381 4:148461358-148461380 AAAATCCTTTAGTCATGGGATGG + Intergenic
982236774 4:153258410-153258432 AAAACCCTTGGGTTTTGGGTTGG + Intronic
983929874 4:173441712-173441734 AAAAGTCTGTAGTCTAGGCTGGG + Intergenic
986432669 5:7697013-7697035 GAAACGTTTCAGTCTTGGCTGGG + Intronic
986768280 5:10948094-10948116 AAGACCCTTTATTCTTGACGAGG - Intergenic
994236479 5:97369136-97369158 CAAACCCTGTATTCTTGGCATGG + Intergenic
994513843 5:100744174-100744196 AGAAACCTTTAGCCTTGGCCAGG - Intergenic
996415801 5:123208931-123208953 AAAGGCCTATAGTCTTGGCAAGG + Intergenic
996784547 5:127224292-127224314 AAAACCATTTAGTCATGTGTTGG - Intergenic
998642410 5:144026278-144026300 AAAACAAGATAGTCTTGGCTTGG - Intergenic
1000770868 5:165352006-165352028 TAAGCCATTTAGTTTTGGCTTGG - Intergenic
1001317599 5:170655468-170655490 TAAACTCTTTGGTCTTGGTTTGG - Intronic
1001755305 5:174164003-174164025 CCAACCCTCTAGTCTTGCCTTGG + Intronic
1002491490 5:179581113-179581135 ATGACCCTTTTGTCTTGGTTTGG - Intronic
1003246694 6:4387920-4387942 AAACCACTTTAGCCTTAGCTTGG - Intergenic
1003326480 6:5095680-5095702 AAAAACCCTGAGTATTGGCTGGG + Intergenic
1003523546 6:6879628-6879650 AAAACCCTATAGTTTTGGAGAGG + Intergenic
1005000174 6:21232300-21232322 AAAAACATTTAATCTGGGCTGGG - Exonic
1005031481 6:21512886-21512908 AAAACCCTTCAGTCCAAGCTGGG - Intergenic
1006998611 6:38286784-38286806 AAAAAAATTTAGTGTTGGCTGGG + Intronic
1009748918 6:67857762-67857784 AAAAACCTTTATTCTTTGATAGG + Intergenic
1010989436 6:82463146-82463168 AAAATCATTTTGTTTTGGCTGGG - Intergenic
1014844022 6:126253815-126253837 AAAACCCTTGAGTCTCCACTTGG + Intergenic
1015961405 6:138653258-138653280 AAAAAGCCTTAGTCTTGGCCAGG + Intronic
1016732633 6:147443017-147443039 AAAAGCCTATAGACTTGGCCAGG - Intergenic
1017670559 6:156765825-156765847 AAAACCCTCTTGTCTTTTCTTGG - Intergenic
1017985562 6:159440430-159440452 AAAACCTTTTACTCCTAGCTTGG - Intergenic
1018072041 6:160173489-160173511 AAAACGTTTTAGTTTAGGCTGGG + Intronic
1020885575 7:13815657-13815679 AAAACCCTTTAGGCCGGGCGCGG + Intergenic
1020973487 7:14977591-14977613 AAAACCCTTAATCCTTTGCTAGG - Intergenic
1021880817 7:25093734-25093756 AAAATCCTCTGGTCTTGTCTAGG + Intergenic
1022160645 7:27707723-27707745 AAAGACATTTAGTCTTGACTGGG + Intergenic
1022376566 7:29817915-29817937 AACACACTATAGTCTTGGGTAGG - Intronic
1023254310 7:38297992-38298014 AAAAACGTTTAATCATGGCTGGG - Intergenic
1023939585 7:44761144-44761166 AAACACCTTTTGTCTGGGCTGGG + Intronic
1024279051 7:47703359-47703381 ATAACCCTTTAATTTTGGGTGGG + Intronic
1026656860 7:72264083-72264105 TAAACCAATTAGTTTTGGCTCGG - Intronic
1028716306 7:93974145-93974167 TAAACCCTGTAGTATTGGATTGG + Intronic
1029917632 7:104228416-104228438 AAAAGCCCTTTGTCTGGGCTGGG - Intergenic
1034366698 7:150555973-150555995 AAAAACCTTTACTCTTTGATAGG + Intergenic
1034598493 7:152223496-152223518 AAAAATCTTTAGTCTTGGGCGGG + Intronic
1035222175 7:157412589-157412611 AAAACCCATGACTCTTGGCCAGG + Intronic
1039598907 8:38816916-38816938 GCAACCCTCTAATCTTGGCTTGG + Intronic
1040932241 8:52747398-52747420 AAAAACCTTTAGACATGGGTGGG - Intergenic
1043546526 8:81321667-81321689 AAAACCCAGTAGGCTTGTCTAGG + Intergenic
1043637607 8:82405894-82405916 AAAAATCATTAGTCTTGGCCAGG - Intergenic
1043676665 8:82964907-82964929 TAAACATTTTAGTGTTGGCTTGG + Intergenic
1044290226 8:90459596-90459618 AAAGCCCTTTAGTGTAGTCTGGG - Intergenic
1045248892 8:100466862-100466884 AGTAGCCTGTAGTCTTGGCTGGG + Intergenic
1045871728 8:106934896-106934918 AGAACCCTGAAGTCTTGGCATGG - Intergenic
1047671066 8:127147949-127147971 AAGACTATTTAGTTTTGGCTGGG + Intergenic
1047739983 8:127798561-127798583 CAGAACCCTTAGTCTTGGCTGGG + Intergenic
1047811965 8:128420532-128420554 AATAACCCTTAGTTTTGGCTGGG + Intergenic
1052283610 9:26759776-26759798 AAAACATTTTTGTGTTGGCTCGG + Intergenic
1052285827 9:26784479-26784501 AAAATCCTTTAGGCTGGGCGTGG - Intergenic
1055266444 9:74499394-74499416 CAAACCCTTGAGTCCAGGCTCGG - Intronic
1055570859 9:77615596-77615618 AAAAGCTTTTGGTCTTGGGTGGG - Intronic
1056118904 9:83467650-83467672 AAATCCTTTTTGTCTTGGCAAGG - Intronic
1058022569 9:100104358-100104380 AAAAATCTATAGTCCTGGCTGGG - Intronic
1059255420 9:112926419-112926441 AAATCCTTTTAGTGTTGCCTGGG - Intergenic
1059995799 9:119907710-119907732 CAATTCCTTTGGTCTTGGCTTGG + Intergenic
1060725678 9:126004145-126004167 AAAGCTCTTGAGTTTTGGCTGGG - Intergenic
1060801181 9:126546758-126546780 AAAACCATCAGGTCTTGGCTGGG + Intergenic
1061886638 9:133594331-133594353 AATGCCCTTTAGACTTGTCTGGG + Intergenic
1186525085 X:10241080-10241102 AAACCCCTTTAGTCAGGGCTTGG + Intergenic
1186719953 X:12292876-12292898 AAAACCCTTTATCTTTGGATTGG - Intronic
1187878391 X:23823466-23823488 AAAACCCTTTGGTGCCGGCTGGG - Intergenic
1188189949 X:27160573-27160595 AAAACAATTTAGGATTGGCTGGG - Intergenic
1189350678 X:40273379-40273401 AAGACCCTGGAGACTTGGCTAGG + Intergenic
1189519545 X:41751654-41751676 AACACCCTTTGCTCCTGGCTGGG + Intronic
1192749218 X:73970847-73970869 AAAACCTTTTAGGCTGGGCACGG - Intergenic
1194633849 X:96320057-96320079 AAAACCCTAAAGGCTTGGCCGGG - Intergenic
1198587474 X:138138799-138138821 AAAAACCTTTAGGTATGGCTGGG + Intergenic
1199756308 X:150868230-150868252 AAAACCATATATTCTTGGCTGGG + Intronic
1200313129 X:155100375-155100397 AAAAACCTTTAGTCTGGTCCTGG + Intronic
1200946034 Y:8839002-8839024 AGAGCCCTTAAGTCATGGCTGGG - Intergenic
1201223499 Y:11793380-11793402 AAAAGCCATCAGTCTTGGCCAGG - Intergenic
1201223538 Y:11793668-11793690 AAAAACCATCAGTCTAGGCTGGG - Intergenic