ID: 916754506

View in Genome Browser
Species Human (GRCh38)
Location 1:167756115-167756137
Sequence CAAGATTACCAAATCCCTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916754506_916754507 -2 Left 916754506 1:167756115-167756137 CCGAGAGGGATTTGGTAATCTTG 0: 1
1: 0
2: 2
3: 5
4: 101
Right 916754507 1:167756136-167756158 TGTGTGTTAGTAAAAGTACATGG 0: 1
1: 0
2: 0
3: 25
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916754506 Original CRISPR CAAGATTACCAAATCCCTCT CGG (reversed) Intronic
902135780 1:14303731-14303753 CAAGATTACCTTATCTCTCATGG + Intergenic
903093900 1:20950480-20950502 GAAGTTGACCAAATCCTTCTTGG - Intronic
905398256 1:37682259-37682281 CAAGATTCCCACAACACTCTGGG + Exonic
910892948 1:92036505-92036527 CACAATGACCAAATCCCTTTTGG - Intronic
912928391 1:113933340-113933362 CAATACTACCAAGTCTCTCTGGG - Intronic
916754506 1:167756115-167756137 CAAGATTACCAAATCCCTCTCGG - Intronic
917186279 1:172360148-172360170 CAATATTACCATATCCCTCTGGG + Intronic
923206208 1:231761250-231761272 CAAAATGAGCAAATCCCTCAGGG - Intronic
1065192245 10:23223496-23223518 CCAGAATACCAAATACCTCAGGG + Intronic
1080815050 11:35747570-35747592 TAAAAGTACCAAATCCCTGTTGG - Intronic
1083847581 11:65345029-65345051 CAAGATGACAAAATGCCTCATGG + Intronic
1090141590 11:124270616-124270638 CAAAATTACCAAATATGTCTAGG + Intergenic
1093181120 12:15967916-15967938 CAGGATTAGCATATCCCCCTGGG + Intronic
1093245195 12:16728045-16728067 CAACATTACCATATACATCTTGG + Intergenic
1095702198 12:45201961-45201983 CAGAATTACCTAAGCCCTCTTGG - Intergenic
1096751561 12:53762151-53762173 AAAGATTACCAAATTCCGTTGGG + Intergenic
1100982035 12:100169537-100169559 CAATATTACGTAATCCCTCTGGG - Intergenic
1101527742 12:105547154-105547176 CAAGATCAGGAAAGCCCTCTTGG - Intergenic
1102517898 12:113462756-113462778 TAAGATTACAAAATGCCACTCGG + Exonic
1105822184 13:24089521-24089543 CAATATTACAAAACCCCTCTGGG + Intronic
1107563490 13:41578503-41578525 CAGGATTAGCAAATCACTGTTGG - Intronic
1107937512 13:45357478-45357500 CAGGGTTAACAAATGCCTCTTGG + Intergenic
1108467423 13:50730756-50730778 CAAGATTACCAAAATTCTGTTGG + Intronic
1110405713 13:75148219-75148241 CAAGAGTACAAAATGCCTTTAGG - Intergenic
1112529790 13:100189951-100189973 GAAAAGTACCAAATCCCTTTAGG + Intronic
1117608702 14:57460470-57460492 CAAGAATTCCAAATTCATCTAGG - Intergenic
1117693450 14:58334497-58334519 TATGATTACCAAATTCCACTGGG + Intronic
1123469165 15:20537429-20537451 CAATATTACCTGATCGCTCTGGG - Intronic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1128295573 15:66516087-66516109 CTATATTTCCAATTCCCTCTGGG - Intronic
1130358084 15:83153515-83153537 CAAGATTACCAAATAGAGCTTGG - Intronic
1139947697 16:70652483-70652505 CATGACTACCAAATCTCTATGGG - Intronic
1142022616 16:87793409-87793431 CAAAATTACCACATCACCCTGGG + Intergenic
1146317734 17:31821518-31821540 CACGATTGCCAAATCGCTCTTGG - Intergenic
1149012108 17:51867758-51867780 CCAGATTACCAATTCCCTCTAGG - Intronic
1151269582 17:72983922-72983944 TTAGATTCCCAAATCCATCTGGG - Intronic
1151536897 17:74744336-74744358 CATGATCACCACGTCCCTCTGGG - Exonic
1158103157 18:53853946-53853968 CAAGGTTTCAAATTCCCTCTTGG - Intergenic
1160048168 18:75406945-75406967 CAAAATTACCAAAGCCTTCCGGG + Intergenic
929872074 2:45767568-45767590 CTAGATTACAAAATTCTTCTGGG - Intronic
932021645 2:68093869-68093891 CCAGATTGTCAAAACCCTCTGGG + Intronic
932399262 2:71468467-71468489 GAAGATGACCAAATCCCTTGAGG + Intronic
936654433 2:114468280-114468302 CAAGAGGTCCAGATCCCTCTAGG + Intronic
940645277 2:156385938-156385960 TAAGGTTACCAAACCTCTCTGGG + Intergenic
940770408 2:157833719-157833741 GAAGATTATCATTTCCCTCTTGG - Intronic
941704208 2:168640663-168640685 CTAGATTACAAAATCCCTGAAGG - Intronic
946654046 2:221925907-221925929 CAAGATTCTCCAATGCCTCTTGG + Intergenic
948562518 2:238864119-238864141 CCAGATGACCAAATCCTTTTCGG + Intronic
1168985458 20:2044649-2044671 CAAGATTATCAACTTCATCTAGG - Intergenic
1171945699 20:31375441-31375463 CAAGAATATCAAAACCGTCTGGG - Intergenic
1173179226 20:40789767-40789789 AAAGCTTCCCCAATCCCTCTTGG - Intergenic
1173305987 20:41850191-41850213 CAACAATAACAAATCCCTTTTGG + Intergenic
1177590314 21:23155652-23155674 CATCATTACCAAATCGCTCTAGG - Intergenic
1182417714 22:30232205-30232227 CAAGACAACCAAAACCGTCTCGG + Intergenic
1183246187 22:36695408-36695430 CAAGACTAACAAAGCCCTTTGGG + Intronic
1184871712 22:47244911-47244933 GAAGAAAACCAAATCCTTCTTGG + Intergenic
953468838 3:43149599-43149621 CGAGATCACAAAATCACTCTAGG + Intergenic
953735132 3:45487601-45487623 CAAAATTGCCAAATGTCTCTTGG - Intronic
958116065 3:89219669-89219691 AAACATTGCCAAATGCCTCTTGG - Intronic
959884928 3:111488357-111488379 CAAGACTACTAAATCCCCTTTGG + Intronic
960875044 3:122287583-122287605 CAACATTACAAAAGCCCTCCTGG - Intergenic
965601666 3:170460868-170460890 CAGAATTACAAAATCCCTATAGG - Exonic
966769809 3:183493655-183493677 TAACATGACCAAATCACTCTGGG + Intronic
969740113 4:9018405-9018427 CAAGCAAACCAAAACCCTCTTGG - Intergenic
972382905 4:38535955-38535977 CAAGATGACTATGTCCCTCTGGG + Intergenic
978236151 4:106463385-106463407 CAAGTTTATCCAATCCCTCTTGG - Intergenic
982932721 4:161429036-161429058 CAAGCTTACTGAAGCCCTCTTGG + Intronic
986966336 5:13276482-13276504 AAAGCTTTCCAAATCCCACTAGG + Intergenic
990868407 5:60404794-60404816 CAACATGGCCCAATCCCTCTTGG - Intronic
993482526 5:88441965-88441987 CAATATTTTCAAATCTCTCTGGG - Intergenic
994191708 5:96876077-96876099 CAAGCTTACCAAACACCTCCCGG - Exonic
996093875 5:119377943-119377965 CCAGCTTACCACATCCCTCCTGG - Intronic
998783710 5:145686224-145686246 CAAGATTATAAACTCCCTGTAGG + Intronic
1000055574 5:157603157-157603179 CTAGACTACCAACTCCATCTTGG + Intergenic
1001208366 5:169786314-169786336 CAAGCTTCCCAAATTCCTCAGGG - Intronic
1008024792 6:46623068-46623090 CAAGATCACCATTTCCTTCTTGG - Intronic
1010689483 6:78891760-78891782 CAGGATTAAAAAATTCCTCTAGG - Intronic
1014770060 6:125450261-125450283 CAAAATTACCATATGCCCCTAGG - Intergenic
1016093674 6:140010378-140010400 CAAGGTTACTATATTCCTCTAGG - Intergenic
1017457797 6:154618120-154618142 CATGATTACTTAATCTCTCTAGG + Intergenic
1019943321 7:4308160-4308182 CAAGTTGACCAACTCCATCTAGG + Intergenic
1020837401 7:13170347-13170369 CAAGGTTACAATATCCCTCCTGG - Intergenic
1022270021 7:28797817-28797839 AATGATTACCAACTTCCTCTAGG - Intronic
1022591002 7:31662819-31662841 GATGATTTCCAAATTCCTCTAGG + Intergenic
1029205779 7:98868849-98868871 CAAGATTACCTATTTCCTCCTGG - Intronic
1030891726 7:115007025-115007047 CAAGGTTACTAATTCTCTCTGGG + Intronic
1030929106 7:115500081-115500103 CAGGAATAACAAATTCCTCTTGG + Intergenic
1037171194 8:15894393-15894415 CTACTTTTCCAAATCCCTCTAGG + Intergenic
1042101338 8:65278640-65278662 CTAGAGTTCCAAATCCTTCTTGG - Intergenic
1043571902 8:81613808-81613830 AGATATTACCAAATCACTCTTGG - Intergenic
1043577133 8:81671027-81671049 AGATATTACCAAATCTCTCTTGG - Exonic
1045556678 8:103221123-103221145 CAAGATAAACAAGTCCATCTGGG + Intronic
1046988007 8:120412126-120412148 AAAGAGTACCACACCCCTCTTGG + Intronic
1047739180 8:127793729-127793751 CAAGATAACCACATCCCACATGG + Intergenic
1051577579 9:18634400-18634422 CAAAATTACAAAAACCATCTGGG + Intronic
1058788431 9:108415977-108415999 CAATTTTACCAATTCCCTCCAGG + Intergenic
1059558039 9:115301034-115301056 CCAGATTTCCACATCCCTTTTGG - Intronic
1059748211 9:117223247-117223269 CTCTATTACCAAATGCCTCTTGG - Intronic
1060495859 9:124118204-124118226 CAAGATTAACAAAGGGCTCTGGG + Intergenic
1062670438 9:137705793-137705815 CAAGACTGCCACAGCCCTCTAGG - Intronic
1203759932 EBV:7076-7098 CAGGATTCTCTAATCCCTCTGGG + Intergenic
1187736327 X:22307666-22307688 CAAGAATCCCAAAGTCCTCTTGG - Intergenic
1194465083 X:94224415-94224437 CATAATTACCTAATCACTCTAGG + Intergenic
1198951262 X:142075135-142075157 CAATATTAACACAACCCTCTAGG - Intergenic
1199819117 X:151427233-151427255 CAGGATAACCAAATACCTATTGG - Intergenic
1200850719 Y:7880504-7880526 CAGGATTACTAAATCACTCAGGG + Intergenic
1202246909 Y:22829446-22829468 CAAGATTATTAAATCACTCAGGG - Intergenic
1202399898 Y:24463194-24463216 CAAGATTATTAAATCACTCAGGG - Intergenic
1202470882 Y:25206892-25206914 CAAGATTATTAAATCACTCAGGG + Intergenic