ID: 916755076

View in Genome Browser
Species Human (GRCh38)
Location 1:167761636-167761658
Sequence CTAGGGAAATGGAAAGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 538
Summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 480}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916755068_916755076 27 Left 916755068 1:167761586-167761608 CCAGAGGAAGTGGAAATTTGAGG 0: 1
1: 0
2: 0
3: 25
4: 249
Right 916755076 1:167761636-167761658 CTAGGGAAATGGAAAGCAGATGG 0: 1
1: 0
2: 3
3: 54
4: 480

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916755076 Original CRISPR CTAGGGAAATGGAAAGCAGA TGG Intronic
900036807 1:418485-418507 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
900058433 1:654224-654246 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
900827376 1:4937648-4937670 TTATGGAAATGAACAGCAGAGGG + Intergenic
901150455 1:7097805-7097827 CTCTGGAGATGGAAAGTAGATGG + Intronic
901219586 1:7575803-7575825 CTGGGGAAGAGGAAAGCTGAGGG + Intronic
902141353 1:14359266-14359288 CCAAGCAAATGGAAAGGAGAAGG - Intergenic
902632386 1:17712851-17712873 CTGAGGAGATGGAATGCAGATGG + Intergenic
904754755 1:32762046-32762068 ATGAGGAAATGGAAACCAGAGGG - Intronic
905619028 1:39425103-39425125 CTAGGAAACTGGAAAGCTAATGG - Intronic
906507694 1:46392655-46392677 CTAGGGGAAGGGGAAGGAGAGGG - Intergenic
906542288 1:46596527-46596549 CTGGGGAAGTAGAAAGCACAGGG + Intronic
908640710 1:66220103-66220125 CTAAGTAAAAGGAAAGAAGAGGG + Intronic
908779028 1:67671642-67671664 ATAGGGAAATAGAAAGCAATAGG + Intergenic
910285742 1:85552204-85552226 CCAGGTGAATGGAAAGGAGAGGG - Intronic
910365560 1:86461310-86461332 CTAGGGAAATAGAAAGTAATTGG - Intergenic
910488899 1:87746347-87746369 ATGGGGAACTGGAAAGGAGATGG - Intergenic
910758088 1:90712112-90712134 GTGGGGAGATGGAGAGCAGAGGG + Exonic
911480871 1:98438462-98438484 TTAGGGAAACACAAAGCAGAAGG - Intergenic
912050606 1:105524294-105524316 CTTGGGAAGAGGAATGCAGATGG - Intergenic
912570219 1:110615970-110615992 CTAAGGAAGTGGAAACCAGATGG + Intronic
912679766 1:111721632-111721654 CAAGGAAAAGGGAAAGCATATGG + Intronic
913539209 1:119802922-119802944 CTGGTGAAATGGAGAGAAGAGGG - Intronic
914513223 1:148352635-148352657 CCAAGGAAATTGAAAGCAGTAGG - Intergenic
914802501 1:150971879-150971901 CCAGGGAAATGTAAAGCCAAAGG + Intronic
916755076 1:167761636-167761658 CTAGGGAAATGGAAAGCAGATGG + Intronic
917031630 1:170699458-170699480 CTAGATAAATGGCAAGAAGATGG + Intronic
917185877 1:172354720-172354742 AAAGGGAGCTGGAAAGCAGAGGG + Intronic
917199521 1:172500136-172500158 CTAGGAAAAGGGTAGGCAGATGG - Intergenic
917208995 1:172612257-172612279 CTAGGGAATTGGTAAGAACAAGG + Intergenic
919498125 1:198302374-198302396 TTAGAGAAATGGAAGGCAGGAGG + Intronic
920035660 1:203063805-203063827 CTAGGGAAATGAGATGCAGGAGG - Intronic
920210292 1:204322984-204323006 CCAAGGAAATGCAAAGCAAAGGG - Intronic
920435768 1:205946062-205946084 CTAGGGAAACAGAAGACAGAAGG + Intergenic
920954865 1:210609648-210609670 CTAGGGAGAGGGAAAGCATCAGG - Intronic
921379620 1:214511129-214511151 CTAGTGACTTGGAAAGCAGGAGG - Intronic
922090078 1:222387507-222387529 TTAGGGAAATGGGAGGCGGAAGG - Intergenic
922170450 1:223150141-223150163 GTGGAGAAAGGGAAAGCAGAAGG - Intergenic
923053868 1:230410091-230410113 CCAGGCAAATGCAAAGAAGAAGG + Intronic
923390398 1:233509502-233509524 CTAAGGAAAAGAAAGGCAGAGGG - Intergenic
923560417 1:235035979-235036001 CAAGGGCAATGGAAAGAAAATGG - Intergenic
923575123 1:235151386-235151408 ACAGGGAAATGGAACTCAGAAGG + Intronic
924494698 1:244575739-244575761 CTAGGGGAAAGGGAAGGAGAGGG - Intronic
924709161 1:246519640-246519662 CTAGGGGAATGGGGAGAAGAAGG + Intergenic
924743271 1:246810187-246810209 ATAGGGAAATTGCAAGCAAAAGG + Intergenic
1063599772 10:7469868-7469890 CTAGAGACACGGAAAGCTGATGG + Intergenic
1064753192 10:18553035-18553057 ATTGGGAAATGGAATGGAGAAGG - Intronic
1065539469 10:26746976-26746998 CTTGAAAAATGGAAAGTAGAAGG + Exonic
1067274397 10:44821329-44821351 ATAGGAAAAGGGGAAGCAGAAGG - Intergenic
1068174000 10:53433462-53433484 GAAGGGAAAGGGAAAGAAGAAGG + Intergenic
1068656037 10:59577390-59577412 ATAGGGAACTGGAATGGAGATGG + Intergenic
1068855178 10:61790378-61790400 GTAGGGAAATGTAAAAGAGAAGG + Intergenic
1070465756 10:76721956-76721978 TTAGGAAAATGTATAGCAGAAGG - Intergenic
1071567785 10:86680608-86680630 GTGGGGAAGTGGAAACCAGAGGG - Intronic
1072181264 10:92983282-92983304 ATGGGGAAAGGGAAAGGAGAGGG - Intronic
1072234146 10:93438682-93438704 CTAGGGATAGGGAAGGCAGAAGG + Intronic
1072524493 10:96259367-96259389 CAGGGGAAATGGGAAGGAGAGGG + Intronic
1072534000 10:96345980-96346002 CTATAGAAATGGAAAGAAGGAGG - Exonic
1073762986 10:106650546-106650568 CCAGGGAGAAGGAAAGCACAGGG - Intronic
1073970112 10:109038286-109038308 CTAAGGGAAAGGAAACCAGAAGG - Intergenic
1074738582 10:116461946-116461968 CTAGGTAAAAGGAAAGAAGTAGG + Intronic
1075385418 10:122051923-122051945 TTAGGGAAATGGCAATCAGATGG + Intronic
1076034243 10:127185674-127185696 TTAGAGAAGTGGAAAGGAGAAGG + Intronic
1076707821 10:132311392-132311414 CCTGGGAAATGGAAGACAGATGG + Intronic
1077398200 11:2336991-2337013 CTAGGGGAAGGGGAAGGAGAAGG + Intergenic
1077457445 11:2689399-2689421 CTTGGGAAATGGGGAGCATAGGG + Intronic
1077735479 11:4786207-4786229 TCAGGCAAAAGGAAAGCAGATGG + Intronic
1077896077 11:6454548-6454570 CTAGGGAGTTGGAAAGGAGCTGG + Intronic
1077901513 11:6493780-6493802 GGAGGGAAAAGGAAAGGAGAAGG - Intronic
1077909221 11:6559381-6559403 CTAGGGAAAGGGGAAGCTTAGGG - Intronic
1078194120 11:9120856-9120878 CCAGGGAAATCGAGAGCAGCAGG - Intronic
1078699133 11:13664222-13664244 CTTGGGAAATTGACAACAGATGG + Intergenic
1079633826 11:22711374-22711396 CTTGGGGAAAGGAAAGCAGCTGG + Intronic
1079689987 11:23406181-23406203 CTATGGAAATGGAAAGAAAGAGG - Intergenic
1081174074 11:39904224-39904246 ATATGGAAATGTAAAACAGATGG + Intergenic
1082808508 11:57464514-57464536 TTAGGGAAGTGGAGATCAGAGGG + Intronic
1083186524 11:61021008-61021030 CTAGGGAACTGGAAAACCCACGG + Intergenic
1085092026 11:73725155-73725177 TTAGAGAAATGGAAAGTATAAGG - Intronic
1086144862 11:83540534-83540556 AATGGGACATGGAAAGCAGAGGG - Intronic
1086286395 11:85256342-85256364 ATGGGGAGCTGGAAAGCAGATGG - Intronic
1086925354 11:92634294-92634316 ATAGGGAAATAGAAAACAAAAGG - Intronic
1087164755 11:94990657-94990679 TTTGGAAATTGGAAAGCAGATGG + Intronic
1087935192 11:104025689-104025711 CAAGGGCACTGGAAAGCGGAAGG + Intronic
1089354479 11:117840835-117840857 CTTGGGAGAAGGGAAGCAGAGGG - Intronic
1089485386 11:118841577-118841599 CTGGGGAAAGCGAAAGCAGTGGG + Intergenic
1089615276 11:119691569-119691591 CTGGGGAAAGGGAAAGCCCAGGG - Intronic
1089808163 11:121110346-121110368 CAAGGAAATTGGAAAACAGATGG - Intronic
1089958366 11:122593698-122593720 CTAGGGAAATGCAAATCCGGGGG + Intergenic
1090057513 11:123436271-123436293 CTGGGGAAATGGGATGGAGAGGG - Intergenic
1090332235 11:125941382-125941404 CTCCGGGAATGGAAAGCAGATGG + Intergenic
1090424778 11:126599824-126599846 CTAAGAAAATGGAAACCAGCTGG - Intronic
1090869002 11:130726385-130726407 CTTGGCAAATGGAAAGCCAAAGG - Intergenic
1092070038 12:5624795-5624817 GTAGTGAAATGAGAAGCAGAAGG + Intronic
1092236592 12:6814499-6814521 CTTGGGAAAAGGAAAGAAAAGGG + Intronic
1092629542 12:10363285-10363307 CTAGGGAAAGGGGAAGGAGGGGG + Intergenic
1093042243 12:14395788-14395810 ATAGAGAAATGGAAAGAATAAGG - Intronic
1093709649 12:22315483-22315505 GTGGGGAAATGGAAAGCAAGAGG - Intronic
1094123773 12:27000980-27001002 CTAAGGAAATGGGAAGGAAAAGG + Intronic
1095375759 12:41526434-41526456 CTTGGAAAATGAAAAGCAGAAGG - Intronic
1096197639 12:49658825-49658847 CTAAGGAGATGGGAAGCTGATGG + Intronic
1096944575 12:55390389-55390411 CTTGGGAGATAGAAAGCACAGGG - Intergenic
1097266461 12:57748328-57748350 GTAGAGAAATGGGAAGGAGAAGG + Exonic
1097349660 12:58534748-58534770 CCAGGGAAATCGAAATCAGTAGG + Intergenic
1097751552 12:63360036-63360058 GTAGGGGAAGGGAAAGGAGAGGG - Intergenic
1098110265 12:67114074-67114096 ATAGAGGTATGGAAAGCAGAGGG - Intergenic
1099032975 12:77551756-77551778 CTAGGGAAAAGAGAAGCAAAAGG - Intergenic
1100408653 12:94293571-94293593 CTTGTGTAGTGGAAAGCAGAGGG + Intronic
1100953509 12:99879664-99879686 ATAGGAAAATTGAAAGCATATGG - Intronic
1100955003 12:99897785-99897807 GTAGGGATATAGAAAGGAGAGGG + Intronic
1101158658 12:101951902-101951924 CCGGGGAAATGATAAGCAGATGG - Intronic
1101227610 12:102705472-102705494 TTTGGAAGATGGAAAGCAGATGG - Intergenic
1101249078 12:102914631-102914653 CAAGGAAACTGGAAAGAAGAAGG - Intronic
1102541800 12:113625570-113625592 TTAAGTAAATGGAAGGCAGATGG - Intergenic
1102681022 12:114690794-114690816 AGAAGGAAATGGAAAGAAGAGGG - Intergenic
1102881446 12:116488081-116488103 GTAGGGAGATGGAAAGAACATGG + Intergenic
1103614922 12:122145896-122145918 CAAGGGAAAGGGACAGCTGAGGG - Exonic
1104208194 12:126661011-126661033 CTGGGGAACTGTAATGCAGAGGG - Intergenic
1106336318 13:28786711-28786733 CCAAGCAAATGGAAAGCAAAAGG - Intergenic
1106573548 13:30953218-30953240 CCACGGACATAGAAAGCAGACGG - Intronic
1106990198 13:35409729-35409751 CAGGGGAAAAGGAAGGCAGAAGG + Intronic
1107025586 13:35798176-35798198 CTAGAGAAATGGAGACCAGGAGG - Intronic
1107671764 13:42753662-42753684 GGAGGTAAATGGCAAGCAGATGG - Intergenic
1107832866 13:44390039-44390061 GCAGGGTAATGGAAAACAGATGG - Intronic
1109195817 13:59376749-59376771 TAAGGAAAGTGGAAAGCAGAAGG + Intergenic
1109390004 13:61681182-61681204 CAAGAAAACTGGAAAGCAGAAGG + Intergenic
1110028882 13:70579866-70579888 CTAGAGAAATGAAAAGCAAATGG + Intergenic
1110149289 13:72230107-72230129 CTAGGGAGATGGGAAGGAGATGG + Intergenic
1111410014 13:87863136-87863158 ATTAGGAAATGTAAAGCAGAGGG + Intergenic
1111489761 13:88956514-88956536 CATTGGAAATGGAAAGAAGATGG + Intergenic
1111628739 13:90823003-90823025 CTATGGAGATGGAGAGTAGAAGG - Intergenic
1114513660 14:23283451-23283473 CCAGGGATATGGAAAGCCCAAGG - Intronic
1114624388 14:24119356-24119378 CTGGGGAAATGGAGAGCAAGGGG - Intronic
1114831888 14:26153650-26153672 TTAGGTAAGTGGAAAGCAGTTGG - Intergenic
1115914072 14:38290328-38290350 TTTGGAAACTGGAAAGCAGATGG - Intergenic
1116503989 14:45655232-45655254 ATAGGGAAATAGAAACTAGACGG - Intergenic
1117879098 14:60291473-60291495 GGAGGGGAAGGGAAAGCAGAGGG - Intronic
1118377345 14:65188629-65188651 TCAGGGGAATGGATAGCAGAAGG + Intergenic
1119148889 14:72340353-72340375 CTAAGGAAATGGTAAAAAGAAGG + Intronic
1120147292 14:80992445-80992467 CAATGAAAATGGAAAGAAGAAGG - Intronic
1121701508 14:95958068-95958090 CTAGGGGAATGGAAAAGAAAAGG + Intergenic
1122515422 14:102305038-102305060 TCAGGGAAGTGGAAAGCAGGGGG - Exonic
1126522145 15:49606831-49606853 CAAGGGAAATGAAGAGAAGAAGG + Intronic
1127629266 15:60811400-60811422 TTTGGGAGCTGGAAAGCAGATGG - Intronic
1128042073 15:64583980-64584002 TTTGGGAACTGGAAAGCAGATGG - Intronic
1128359489 15:66951183-66951205 ATTGGAAGATGGAAAGCAGATGG - Intergenic
1128899468 15:71407368-71407390 TTAGGAAACCGGAAAGCAGAAGG - Intronic
1129513295 15:76140402-76140424 CTGGGGCAATGGAAAACAAAAGG + Intronic
1129669242 15:77598001-77598023 CTAGGGAGATGGAAAGGAGCTGG + Intergenic
1129940801 15:79495252-79495274 CTGGGGAAGTGGGAAGCAGGGGG + Intergenic
1130299106 15:82666696-82666718 CTAGGGGAATGGAAAGGAACTGG - Intronic
1130414233 15:83676146-83676168 CCAAGAAAATGGAAAACAGAGGG - Intronic
1130435955 15:83900141-83900163 ATAGGGAAATGGAAAGAACAAGG + Intronic
1130757659 15:86783165-86783187 CCGGGGACATGGAAAGCAGGGGG - Intronic
1131944018 15:97599171-97599193 CTATGGAATTGGAAGGCACATGG + Intergenic
1132326585 15:100975044-100975066 CTTGGGAATTGTTAAGCAGAAGG + Intronic
1132444979 15:101907683-101907705 ATACAGAAAAGGAAAGCAGAGGG - Intergenic
1132461367 16:56752-56774 CTAGGAGAATGGCAGGCAGAGGG + Intronic
1133888173 16:9851601-9851623 CAAGGCAAATGGAAAGAAAAGGG - Intronic
1133967903 16:10545013-10545035 CTTGGCAACTGGAAAGTAGAAGG - Intronic
1134360005 16:13522500-13522522 CTAGGGAAAAGGAAATCGGGGGG - Intergenic
1135992396 16:27225919-27225941 CAAGGGAAATGGGCAGCAGGTGG + Intronic
1137747530 16:50834129-50834151 CCTGGAAGATGGAAAGCAGATGG - Intergenic
1138716206 16:59025874-59025896 CTAGGGAGATCTAAAGGAGAGGG + Intergenic
1139017602 16:62709111-62709133 TTGGGAAAATGGAAATCAGAAGG - Intergenic
1139683377 16:68582639-68582661 GTAGGAAAATGAAAAGCACAAGG - Intergenic
1140034180 16:71360113-71360135 CAAGGGGGATGGAAAACAGAGGG + Intronic
1141181283 16:81754497-81754519 AAAAGGAAATGGAAAGGAGATGG - Intronic
1141884753 16:86883970-86883992 CCAGGGAACTGGAAGGCAGGAGG + Intergenic
1142493677 17:294627-294649 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493716 17:294875-294897 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493731 17:294984-295006 CTGTAGAAATGGAAAGCAGAGGG + Intronic
1142493771 17:295233-295255 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493815 17:295507-295529 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493833 17:295616-295638 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493848 17:295725-295747 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142493866 17:295834-295856 CTGCAGAAATGGACAGCAGAGGG + Intronic
1142493881 17:295943-295965 CTGCAGAAATGGAAAGCAGAGGG + Intronic
1142968236 17:3594213-3594235 CTATGGAAATGGCAATTAGAAGG - Intronic
1143003188 17:3808618-3808640 TTAGGGAACTGGTGAGCAGAGGG + Intergenic
1143411841 17:6713811-6713833 GTAAGGAGATGGAAAGGAGAGGG - Intergenic
1143789989 17:9287155-9287177 GTCAGGAGATGGAAAGCAGATGG + Intronic
1143971132 17:10796779-10796801 AACGGGAAAAGGAAAGCAGATGG - Intergenic
1144574929 17:16423414-16423436 GTAGGCAGATGGAAAGCAGGAGG + Intronic
1145116707 17:20217010-20217032 CAAGGGAAATGCAAAGGAGCTGG + Intronic
1146272529 17:31493747-31493769 CCAGGGAAAGTGAAATCAGAAGG - Intronic
1147635499 17:41961507-41961529 CTAGAGGAAAAGAAAGCAGAGGG - Intronic
1147931579 17:43984471-43984493 GTTGGGAAAATGAAAGCAGATGG - Intronic
1148856593 17:50582350-50582372 CCCTGGAAATGGAGAGCAGAGGG + Intronic
1149618788 17:58025178-58025200 ATAGGAAAATAGAAAGTAGAGGG + Intergenic
1150336270 17:64332846-64332868 CCAGGCAAATAGAAAGTAGAAGG + Intronic
1150471800 17:65443712-65443734 CAAGAGAAATGAAAAACAGAAGG + Intergenic
1150977559 17:70105793-70105815 CTAGTGAAATGGAAACCTGAAGG - Intronic
1151020327 17:70608938-70608960 CTAGGGTAATGGAAACAACAGGG - Intergenic
1151268234 17:72973085-72973107 CTAAGGAAAGGACAAGCAGAAGG - Intronic
1151547446 17:74801859-74801881 GTAGGGGGATGGAAAGCACACGG - Intronic
1151825023 17:76519299-76519321 CTAGGGAGAGGGCAAGGAGAGGG - Intergenic
1152001810 17:77650821-77650843 CTAGGTAAATGGATGGCAGATGG - Intergenic
1153177874 18:2399421-2399443 CTAGGGAAAGACAAAACAGAAGG + Intergenic
1154138253 18:11799955-11799977 ATAGGGAAAAGGAATGGAGAGGG - Intronic
1155028882 18:21966857-21966879 CTAAGGAATAGGACAGCAGAAGG - Intergenic
1155434090 18:25792982-25793004 ATGGGGAAAGAGAAAGCAGAGGG - Intergenic
1155611850 18:27674912-27674934 TTAGGGAAAGGTAAAGAAGATGG - Intergenic
1155680183 18:28477911-28477933 CTAGCGAGATGGAAAGCAACTGG - Intergenic
1155791323 18:29974116-29974138 ATGGGGAAATGAATAGCAGAAGG + Intergenic
1156331539 18:36128730-36128752 GGAGGAAAAAGGAAAGCAGAAGG + Intronic
1156461949 18:37326203-37326225 CGAGGGCAAGGGAGAGCAGAGGG + Intronic
1158677643 18:59536318-59536340 CCAGGGAAATGATATGCAGATGG - Intronic
1159499189 18:69247139-69247161 CTAGAGAAATGGCAATAAGAGGG - Intergenic
1160533536 18:79578903-79578925 CCAGGGAACTGGAGAGCAGAGGG - Intergenic
1160640336 19:126034-126056 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
1161748858 19:6079482-6079504 CTATAGAAAGGGACAGCAGATGG + Intronic
1161754531 19:6122357-6122379 CTAGGCAACCGGGAAGCAGAAGG + Intronic
1161848440 19:6725730-6725752 CTGGGAAAATGGAGAGCAGTGGG + Intronic
1162534663 19:11255752-11255774 ACAGGGAATTGGGAAGCAGAAGG - Intronic
1163718267 19:18885109-18885131 CCAGGGAAATGGAAATCTGTGGG - Intronic
1163976622 19:20858846-20858868 CTAGGGGAAAGGGAAGGAGAGGG + Intronic
1165666680 19:37636644-37636666 ATAGGGACATGGACAGCAAAGGG - Intronic
1166007343 19:39916573-39916595 CTGGGGAAAGGGAAGGCAGAGGG - Intronic
1167453020 19:49583465-49583487 ATAGGGGGATGGAAAGCAGTGGG - Intronic
1167612305 19:50513417-50513439 CTGGGGAGAGGGAAAGGAGAGGG + Intronic
1168487727 19:56778943-56778965 GTAGGGGGATGGAAACCAGAGGG + Intronic
925174344 2:1771714-1771736 GTAGGGAAAGGGAAAGAGGAAGG + Intergenic
925948549 2:8889598-8889620 CCAGGGAAATGGAAATTATAGGG - Intronic
926938441 2:18110710-18110732 TCAAGGAAAAGGAAAGCAGAAGG - Intronic
927002342 2:18811199-18811221 CATGGGAAAAGGAAAGCAGCAGG + Intergenic
927060819 2:19417514-19417536 CTACGGAAGTGGAATGCAGAAGG + Intergenic
927546758 2:23960933-23960955 CTGTAGAAATAGAAAGCAGACGG - Intronic
928038753 2:27852366-27852388 CAAGGGTCATGGAAAGCAAAAGG + Intronic
928141836 2:28736127-28736149 ATTGGGAAATGGAAATAAGAGGG - Intergenic
928193378 2:29194409-29194431 AAATGGAAATGGAAAGCAGCTGG - Intronic
928651213 2:33405530-33405552 CTAAGGAAATGGCAAGCGGCTGG + Intergenic
929413356 2:41722216-41722238 ACAGGGAAATGGAAAGCAAAGGG + Intergenic
930084552 2:47485732-47485754 TTAGGGAAATGGAGTGCTGATGG + Intronic
930907867 2:56594738-56594760 GTATGTAAAAGGAAAGCAGAAGG - Intergenic
932082129 2:68724777-68724799 CTGAGAAAATGGAAAGGAGAAGG - Intronic
932342517 2:70975285-70975307 CAAGGGAGATGGAAGGCTGAGGG - Intronic
932876498 2:75457787-75457809 CTGGGGAAATGGGAAGATGAGGG - Intergenic
933263509 2:80155932-80155954 CTAGAGCAATGGATAACAGAAGG - Intronic
933432447 2:82200588-82200610 CTAGGGCAATGGTTATCAGAAGG + Intergenic
933997797 2:87682677-87682699 GAAGGGAAAAGGAAAGAAGAAGG + Intergenic
935357346 2:102215059-102215081 GCAGGGAAAAGGTAAGCAGAAGG + Intronic
935691983 2:105740397-105740419 CAGGGGAACTGGAGAGCAGAAGG + Intergenic
936045250 2:109182539-109182561 CTTGGGACATAGAAAGCACATGG + Intronic
936296055 2:111268189-111268211 GAAGGGAAAAGGAAAGAAGAAGG - Intergenic
937057494 2:118952029-118952051 CTAGGGGAAGGGGAAGGAGAAGG - Intronic
937840172 2:126517364-126517386 CTGCGGAAAAGCAAAGCAGAAGG + Intergenic
938131590 2:128720238-128720260 TTGGGGGACTGGAAAGCAGATGG + Intergenic
938173073 2:129099977-129099999 CTATGGAAAAGGAAAGCACAAGG - Intergenic
938176456 2:129135768-129135790 TTAAGTAAATGGAAGGCAGATGG + Intergenic
938201131 2:129374044-129374066 CTTGGGAACTTGAAAGCAAATGG - Intergenic
938605067 2:132883682-132883704 CCAGGGAGATGGAAAGCAGAGGG - Intronic
938619323 2:133032370-133032392 CTATGGATTTGGAAAGAAGAGGG + Intronic
939568217 2:143810039-143810061 CAAGGAAAATAGAATGCAGATGG + Intergenic
939767317 2:146267018-146267040 GTAGGAAAATGGAAAGGACAGGG + Intergenic
940473987 2:154136894-154136916 ATAGGCAAATGTAATGCAGAAGG - Intronic
941215839 2:162707993-162708015 CAAGAGAAATGGGAAGTAGATGG - Intronic
942147322 2:173039594-173039616 ACAGGGAAAGGGAAAGGAGAAGG + Intronic
942179117 2:173362933-173362955 CTAAAGAAATGAAAAGCAGGTGG + Intronic
943107077 2:183559165-183559187 CAAGGAAAATGGAGTGCAGAGGG + Intergenic
943384252 2:187182623-187182645 CTACAGTAATGGATAGCAGAGGG - Intergenic
943748385 2:191486106-191486128 CAAGGGAAATGGAGAGGAGTGGG - Intergenic
944428185 2:199605377-199605399 CTAAGCAAATTGATAGCAGAAGG + Intergenic
946531797 2:220578320-220578342 CTTGAGAAAGGGAAAGGAGATGG + Intergenic
946554951 2:220845961-220845983 AAAGGGAAATGGAAAGGAAAAGG + Intergenic
947223980 2:227822515-227822537 CAAAGGAAAAGGAAAGGAGATGG - Intergenic
947278961 2:228426919-228426941 CAAGGGAAGTAGAAACCAGAGGG + Intergenic
948086332 2:235252433-235252455 CAAGGGAAAGGGACAGGAGAAGG + Intergenic
1170387957 20:15841178-15841200 CTAAGCAAAGGGAAAACAGAAGG + Intronic
1170580652 20:17697259-17697281 CCAGGGAGATGGAAAGCAGGTGG + Intronic
1170654418 20:18272834-18272856 CTAGGAAAATCGAAGGAAGAGGG + Intergenic
1170693202 20:18633682-18633704 TTAAGGATATGGAAAGTAGAAGG + Intronic
1170812312 20:19684153-19684175 CTAGGGAAACGAAAAACATAAGG - Intronic
1171245804 20:23608672-23608694 CTAGGGAAATGCCAAGCAGGGGG - Intergenic
1172771064 20:37382874-37382896 ATGGGGAAATGGGAGGCAGAGGG + Intronic
1173037166 20:39423467-39423489 CTAGGGAAAAGGAATGAAGTTGG - Intergenic
1173815591 20:45985729-45985751 GTAGGGGAATGGAAGGCAGGAGG + Intergenic
1174019713 20:47520395-47520417 CTAGGGGAAGGGCAAGGAGAGGG - Intronic
1174358731 20:50015132-50015154 GTAGGGCAATGGGAAGCAGATGG + Intergenic
1174979298 20:55375212-55375234 CTATAGAAATGGAAACAAGAAGG - Intergenic
1175724019 20:61304615-61304637 CTAGAGAAAAGGACAGCAGAAGG + Intronic
1175892530 20:62321894-62321916 CTCGGGAAATGGAAGGCAGCTGG + Intronic
1178434480 21:32545909-32545931 CTAGGGAAAGGGAAGGAAGAAGG - Intergenic
1178630438 21:34255142-34255164 TTAAGTAAATGGATAGCAGATGG - Intergenic
1178711081 21:34917273-34917295 CCAAGGAAAGAGAAAGCAGATGG + Intronic
1178836868 21:36105526-36105548 CTAGGGAAAGGGGAAGGAGAGGG + Intergenic
1178849574 21:36201666-36201688 CTAGTTTAATGGAAAGAAGAAGG - Intronic
1180144999 21:45913928-45913950 CTAGGAAAAGGGACAGGAGAGGG - Intronic
1180902786 22:19386699-19386721 CTTGGGAAATGGTAAGCAGATGG + Intronic
1182559563 22:31149096-31149118 CCAGGGAAATGGAAAGAGGAAGG + Intergenic
1182662811 22:31936861-31936883 CTAAGGAAGTGGGAAGCAGAAGG + Intronic
1183278841 22:36921616-36921638 AAAGGGAACTGGCAAGCAGAGGG + Intronic
1183795138 22:40111236-40111258 CAAGGGAAATGGAAAACAATTGG + Intronic
949647979 3:6119918-6119940 CAATGGAAATAGAAAGCAGCAGG - Intergenic
949849136 3:8404232-8404254 TTTGGAAGATGGAAAGCAGATGG - Intergenic
950334419 3:12182190-12182212 CAAGGGAAATGGGGAGCAGGAGG + Intronic
950812307 3:15660442-15660464 CAAATGAAATGAAAAGCAGAGGG - Intergenic
951020794 3:17778908-17778930 CTAGTAGAATGGGAAGCAGAGGG + Intronic
953395907 3:42569603-42569625 CTGGTGACAAGGAAAGCAGAAGG + Intronic
954030955 3:47819587-47819609 CTAGGGAGCTAGAAAGCACAGGG - Intronic
954294021 3:49664276-49664298 CTAGGGAAATAAAGAGAAGAAGG - Intronic
954604492 3:51898102-51898124 CTAGGGGAAGGGGAAGGAGAGGG + Intronic
956675559 3:71728944-71728966 CTAGTGCAATGGAAAGCAACTGG - Intronic
958081909 3:88757128-88757150 CTAACAAAATGGAAGGCAGAGGG - Intergenic
958821941 3:98985244-98985266 CTTGGGAAGTGGGAAGCAGTAGG + Intergenic
959306411 3:104671831-104671853 CTATGGTAATGGTGAGCAGATGG + Intergenic
959438512 3:106347578-106347600 TTAAGTAAATGGATAGCAGATGG - Intergenic
959572477 3:107899755-107899777 CAAGGGAGATGGAAGGCAGATGG - Intergenic
960117243 3:113908505-113908527 ACAGGGAAATGGAAAGAAAATGG - Intronic
960120377 3:113942965-113942987 TTTGGAAACTGGAAAGCAGATGG - Intronic
960259544 3:115550669-115550691 CAGAGTAAATGGAAAGCAGATGG + Intergenic
960462838 3:117958176-117958198 GTAGTGAAATGCCAAGCAGATGG - Intergenic
960558870 3:119059886-119059908 TTAGGGATAAGGAAAGAAGAAGG + Intronic
961200115 3:125038806-125038828 CTGGAGAAATGGAAAGGAGACGG + Intronic
961266618 3:125648046-125648068 CTACGGAAATGGATAGGAAAGGG + Intergenic
961359887 3:126360453-126360475 CTAGGGAATAGGCAGGCAGAAGG + Intergenic
962428088 3:135292163-135292185 TTAGGTAAATGGATGGCAGATGG + Intergenic
962809155 3:138946885-138946907 CTAGGGGAAGGGGAAGGAGAGGG - Exonic
962927318 3:140007139-140007161 CTAGGGATATGAAAATGAGATGG + Intronic
963637226 3:147813505-147813527 TTAGAAAAATGGAAAGCAGGTGG - Intergenic
964362389 3:155912319-155912341 GTTGGAAAGTGGAAAGCAGATGG + Intronic
964549130 3:157867442-157867464 CAAGGGAAATTGACGGCAGAGGG - Intergenic
965036258 3:163442418-163442440 ATAAGGAAATGGGAAACAGAGGG + Intergenic
965632040 3:170742962-170742984 ACAGGGAAGTGGAAAGCAGAAGG - Intronic
966587029 3:181637588-181637610 CAAGAGAAATGTAAAGCAGATGG + Intergenic
967054191 3:185813875-185813897 CCAAGGAAATGCAAAGGAGAAGG + Intronic
967215807 3:187209239-187209261 CCTATGAAATGGAAAGCAGAGGG - Intergenic
967341334 3:188401755-188401777 TTGGGGAACAGGAAAGCAGATGG + Intronic
967439405 3:189489493-189489515 CTACGGAAACAAAAAGCAGAGGG - Intergenic
967983070 3:195077200-195077222 CTGGGGAAGGGAAAAGCAGAGGG + Intronic
968716543 4:2164110-2164132 CAAAGCAGATGGAAAGCAGATGG - Intronic
969082445 4:4629365-4629387 CCAAGGAAATTGAAAGCATATGG - Intergenic
969862042 4:10044862-10044884 TTATGGAAACAGAAAGCAGAAGG + Intronic
969923108 4:10559427-10559449 CTGGAGAAATTGAAAGCTGATGG - Intronic
971564309 4:28118042-28118064 TTAGGGAGATGGCAGGCAGATGG + Intergenic
971685101 4:29755699-29755721 CAAGGCAAATGAAATGCAGATGG + Intergenic
971777494 4:30985451-30985473 CTAGTAAAATGGAAAGAAGATGG + Intronic
972057635 4:34824534-34824556 TTAGAGATATGGAAAGCAAATGG + Intergenic
972784753 4:42315799-42315821 CTAGGGAAAGGGGAAGGAGAGGG + Intergenic
973288778 4:48449066-48449088 GTAAGGAAAAGGACAGCAGAGGG - Intergenic
974699342 4:65419298-65419320 CTAGGGCATTGGAAAAGAGAGGG - Intronic
975520026 4:75290527-75290549 CTATGGAGATGTAAGGCAGAGGG - Intergenic
975990992 4:80260009-80260031 CTACTGAAATGAAAAGCAAATGG + Intergenic
976181021 4:82398856-82398878 CTAAGAAAATGGGAAGCAGTTGG - Intergenic
976815339 4:89140929-89140951 CTCAGAAAATGGAAAGGAGATGG - Intergenic
977125310 4:93158437-93158459 CTGGGGAAAGAGAAAGGAGAAGG + Intronic
977239430 4:94548915-94548937 CCAAGGCAATGGAAAGCACAGGG - Intronic
977697264 4:99980855-99980877 ATAGGGACATGTAAAGCACATGG - Intergenic
977830550 4:101586357-101586379 CTGGAGAAATAGAAAGCAGAGGG - Intronic
978070643 4:104463922-104463944 CTAGATAAATGGAGAGCACATGG + Intergenic
979827264 4:125254798-125254820 CTAGGGAAATATAATGCAGAAGG + Intergenic
980974008 4:139593398-139593420 CTTGGGAAATGGACAGCCAATGG - Intronic
981311924 4:143305823-143305845 CTAGGAAAAAGGAAATCACAAGG + Intergenic
981909904 4:149967034-149967056 AGAGGGAAATGGAAAGCAGAGGG + Intergenic
982087288 4:151848618-151848640 CAATAGAAATGGAAAGCAGATGG + Intergenic
982305336 4:153924518-153924540 GATGGGAAATGGAAATCAGAAGG - Intergenic
982387369 4:154824840-154824862 CTATTGAAATAGAAATCAGAAGG + Intronic
982818934 4:159922318-159922340 ATAGGAAAATGGAAAGGAAATGG + Intergenic
983000086 4:162403518-162403540 CAATGGAAATGGAAGGCTGAAGG - Intergenic
983135871 4:164079348-164079370 AAATGGAAATGGAAATCAGATGG + Intronic
984278011 4:177633717-177633739 ATGGGGAATTGGAAAGGAGATGG - Intergenic
984566684 4:181339441-181339463 CTAGGAGAAAGGAAAACAGAAGG - Intergenic
986048160 5:4060844-4060866 TTAGAGAAATGGAAAGATGATGG + Intergenic
986081102 5:4394991-4395013 CTAGGGGAGTGGAGTGCAGAAGG - Intergenic
987426377 5:17777842-17777864 CGAGGGAAATGGAAGTCATAAGG - Intergenic
987712954 5:21527861-21527883 CTAGAGAAACAGAAAGCTGATGG - Intergenic
989001385 5:36764123-36764145 CAAGCTGAATGGAAAGCAGATGG + Intergenic
989358567 5:40573051-40573073 ATAAGGAAATTGCAAGCAGATGG + Intergenic
990299760 5:54438242-54438264 CTTGGCCAATGGAAAGCAGCAGG + Intergenic
990739130 5:58894494-58894516 ATAAGGAATTGGAAAGGAGAGGG + Intergenic
990925669 5:61019380-61019402 ATAGGGAAAAGGAGAGAAGAGGG - Intronic
991215831 5:64156602-64156624 CTGGGGAAATAGTAAGGAGAAGG + Intergenic
991302607 5:65144191-65144213 CTAGGGAGAAGGAAAGCCAAAGG - Intergenic
991570829 5:68051633-68051655 GCAGAGAAATGGGAAGCAGATGG - Intergenic
992168050 5:74074306-74074328 ATAGGGATTTGGAAAGAAGATGG - Intergenic
993042767 5:82834453-82834475 CTGAGGTATTGGAAAGCAGAGGG + Intergenic
993055413 5:82974789-82974811 CTAGGGGAAGGGGAAGGAGAGGG - Intergenic
994758724 5:103827128-103827150 ACAGGGAAAGGGAAACCAGATGG + Intergenic
995233559 5:109799231-109799253 TTAGGGTAATGGAAAAAAGAAGG - Intronic
996988269 5:129595244-129595266 CTAGGGAAAAGCAATGCAGGAGG - Intronic
997434599 5:133865291-133865313 TTAGGCAGCTGGAAAGCAGATGG + Intergenic
997592495 5:135084187-135084209 GTTGGAAACTGGAAAGCAGATGG - Intronic
997726639 5:136126258-136126280 CTTGGCAAATGGAAAGTTGAAGG + Intergenic
997981787 5:138472188-138472210 CTAGGGAAATAGAAAACCAAGGG + Intergenic
998330304 5:141320368-141320390 CTAGGGAACAGGAAAGCAAATGG + Exonic
998552784 5:143093735-143093757 CTAGGGGAAGGGGAAGGAGAGGG - Intronic
998612459 5:143703812-143703834 ATAGGGAGCTGGAAAGCGGATGG + Intergenic
999216168 5:149937271-149937293 AGAGGGAGAGGGAAAGCAGAGGG + Intronic
999610842 5:153367841-153367863 CTATGGAACTTGAAAGAAGAAGG - Intergenic
999944746 5:156582709-156582731 CTAGGGATAAGGAAATCAGAAGG - Intronic
1000644109 5:163740295-163740317 TTAAGTAAATGGACAGCAGATGG - Intergenic
1000825675 5:166040823-166040845 CTAGGGATATGGCAGGCAAAGGG + Intergenic
1000845064 5:166269546-166269568 CTAAGATATTGGAAAGCAGAAGG - Intergenic
1001093251 5:168756944-168756966 CTGGGAGAATGGAAAACAGAAGG + Intronic
1002557076 5:180050610-180050632 GGAGGGAAATGGAACACAGAAGG - Intronic
1002737014 5:181400381-181400403 ATACAGAAAAGGAAAGCAGAGGG - Intergenic
1002747685 6:74437-74459 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
1003772127 6:9317088-9317110 CTAGAGAATTGGAAAGTAGCTGG + Intergenic
1005226769 6:23652363-23652385 CTAGAGAAAAGAAAACCAGATGG + Intergenic
1005713632 6:28526037-28526059 CTAGGAGAAGGGGAAGCAGATGG - Exonic
1005997557 6:30940683-30940705 CTGGGGAAGTGGGGAGCAGATGG - Intergenic
1006303918 6:33207962-33207984 CTAGGGAGAGCCAAAGCAGAGGG + Intergenic
1006554899 6:34857709-34857731 ACAAGGAACTGGAAAGCAGAGGG - Exonic
1006574930 6:35038044-35038066 GAGGGGAAAAGGAAAGCAGAGGG + Intronic
1007103463 6:39267507-39267529 CTAGAGAAATGGTAAGAAGAGGG - Intergenic
1007582970 6:42970109-42970131 GTGGGGAAAAGGAATGCAGATGG + Intronic
1007691000 6:43701347-43701369 CCAGGGAAAGGGGAAGAAGAGGG - Intergenic
1007704198 6:43781138-43781160 CTAGAGCAATGGAAACCAGTTGG - Intronic
1007727718 6:43926742-43926764 CCGGGGAAATGGAAAGCAGGAGG + Intergenic
1008605399 6:53134572-53134594 CTAGGGAAGTGTCAATCAGATGG - Intronic
1008862977 6:56173369-56173391 CAAAGGAAAGGGAAAGGAGAAGG + Intronic
1009886785 6:69632920-69632942 TTAGGCAAATCCAAAGCAGATGG + Intergenic
1011261929 6:85478866-85478888 CTAGAGAAATAGAAACCAGTAGG + Intronic
1011570132 6:88725813-88725835 CTAGGGGAAGGGGAAGGAGAGGG + Intronic
1011935948 6:92777584-92777606 GTAAGGAAATGAAAATCAGAAGG + Intergenic
1012188225 6:96248218-96248240 CTAGGGTAAGGAAAACCAGATGG - Intergenic
1012545555 6:100415069-100415091 CTAGGGAAAAGGCAAGAGGAGGG + Intronic
1012679868 6:102166713-102166735 GGATGGAAATGGAAAGCAAATGG - Intergenic
1013134199 6:107263916-107263938 CTAGGGTAAAGGGATGCAGAAGG - Intronic
1013205594 6:107942390-107942412 CCAGGGAACTGGAAAGAGGAGGG - Intronic
1014009091 6:116456651-116456673 CAATGGAAGTGTAAAGCAGAAGG - Intergenic
1014882784 6:126743995-126744017 AAAGGGAAAAAGAAAGCAGAAGG - Intergenic
1015102245 6:129495299-129495321 CTAGGGAAATGGTTAGCCTAGGG - Intronic
1015181242 6:130365312-130365334 CGGGGGAAATGGAAGACAGAGGG - Intronic
1016153095 6:140768509-140768531 GAAAGGAAAAGGAAAGCAGAAGG + Intergenic
1016312236 6:142746554-142746576 TTAAGTAAATGGAAGGCAGAAGG - Intergenic
1016457913 6:144250368-144250390 CTAGGGAAAGCAAAAGGAGAAGG - Intergenic
1016873658 6:148843135-148843157 CAGGGGGAATGGGAAGCAGATGG + Intronic
1017139299 6:151175959-151175981 CTAGTCACATGGAAAGGAGATGG + Intergenic
1017616323 6:156250413-156250435 CTAGGGAAAGGGAAGGAAGGAGG - Intergenic
1018191611 6:161314361-161314383 CTAGGGGAAGGGGAAGGAGAGGG - Intergenic
1018560164 6:165093685-165093707 CAAAGAAAATGGAAAGAAGAAGG + Intergenic
1019242111 6:170675915-170675937 ATACAGAAAAGGAAAGCAGAGGG - Intergenic
1019397926 7:833110-833132 CTTGGAAAACTGAAAGCAGAAGG - Intronic
1020507059 7:9004203-9004225 CTTGGGAAATAGAAAGGTGAGGG - Intergenic
1020532055 7:9350443-9350465 CCATGAAAATGGAAAGCAGAGGG + Intergenic
1021527125 7:21600507-21600529 TTAGGAAAATGGGAAGCACAGGG + Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1021930814 7:25579501-25579523 CTAGGAAAGTGGAAAGCAGTAGG + Intergenic
1022052567 7:26692113-26692135 CAAAGGAAATGGAAAGGAGATGG + Intronic
1022097008 7:27147458-27147480 CTCGGGCAGTGGCAAGCAGAGGG - Exonic
1022279454 7:28891352-28891374 GCAGGGAAAAGGAAAACAGAAGG + Intergenic
1022495775 7:30852244-30852266 ACAGGGAAATACAAAGCAGATGG + Exonic
1023149199 7:37183953-37183975 GTAGAGAAATGGAAAACAGTAGG - Intronic
1023963001 7:44943258-44943280 CTAGGGGTTTGGAAAGAAGAGGG + Intergenic
1026372967 7:69720121-69720143 GTAAGAAAATGGAAAGCTGATGG + Intronic
1028214312 7:88113053-88113075 CTAGGGAAGCAGGAAGCAGAGGG - Intronic
1028987167 7:97017693-97017715 CTAGGCAAGTGGAAACCGGAAGG + Intergenic
1029607596 7:101608580-101608602 CCAGGGAAAAGAAAAGCAGGGGG - Intergenic
1029882409 7:103829336-103829358 CTGGGGGAAGGGAAAGAAGAAGG - Intronic
1030555547 7:111019857-111019879 GTATGAATATGGAAAGCAGAGGG - Intronic
1030813881 7:114009965-114009987 ACAGGGAAATGGAAGGCACAGGG + Intronic
1031060060 7:117040982-117041004 CCAGAGAAAAGGAAAGCAAAGGG - Intronic
1031192740 7:118575386-118575408 GTAGGGAAAAGGAACCCAGAAGG + Intergenic
1031374396 7:121006508-121006530 CTAAGGAAGAGGAAAGCAGAGGG + Intronic
1031449738 7:121900173-121900195 CCAGGGAGAAGGTAAGCAGAAGG + Intronic
1031944123 7:127820706-127820728 GAAGGAAAATGGAAGGCAGAAGG - Intronic
1033249829 7:139748847-139748869 ATAGAAAAATGGAAGGCAGATGG - Intronic
1033251123 7:139760675-139760697 CTAAGGAAAGTGAAAGCATAAGG + Intronic
1033426297 7:141247584-141247606 GTAGGGAAAGGGAAAGAGGATGG + Intronic
1033468055 7:141615337-141615359 CTAAGGATGTGGAAAGGAGATGG + Intronic
1034202532 7:149291342-149291364 CTAGGGGGATGCAAAGCAGCAGG + Intronic
1034944174 7:155251208-155251230 CTGGGGCACTGGAAGGCAGATGG + Intergenic
1035506007 8:132185-132207 ATACAGAAAAGGAAAGCAGAGGG + Intergenic
1036913174 8:12776369-12776391 GTAGAGAAAAGGAAAGGAGAGGG + Intergenic
1036960659 8:13241422-13241444 CTGAGGAAAAGGAAACCAGAGGG - Intronic
1036962460 8:13259985-13260007 CAGGAGAAATGAAAAGCAGAAGG + Intronic
1037533428 8:19802281-19802303 GAAGGGAGCTGGAAAGCAGATGG - Intergenic
1037727211 8:21492594-21492616 TTGGGAAAATGCAAAGCAGAGGG + Intergenic
1037737255 8:21577653-21577675 CTTGGGAAATAGAAATGAGAAGG + Intergenic
1038308095 8:26422536-26422558 CTAGGGGACTGGGAAGGAGACGG + Intronic
1038370800 8:26988318-26988340 TTTGGAAAATAGAAAGCAGAAGG + Intergenic
1038652009 8:29412806-29412828 CTAGGCAAATGTAAAGCAAAAGG - Intergenic
1039314572 8:36356945-36356967 CTGGGGGAATGGAAAGCAGCAGG + Intergenic
1041013980 8:53572213-53572235 CTAACAAAATGGAAAGAAGAAGG - Intergenic
1041342294 8:56858651-56858673 GTAAGGAAATGGAGAGGAGAGGG - Intergenic
1042400872 8:68345032-68345054 CAAGAGAAATGGAAAACAAAAGG + Intronic
1043460284 8:80452991-80453013 TTAGGGAAATGGAAAGGGAAAGG + Intergenic
1044338150 8:91014113-91014135 TTTGGACAATGGAAAGCAGATGG + Intronic
1044735602 8:95275148-95275170 CAAGGGAAATGGAAGACTGATGG - Intergenic
1045660811 8:104435870-104435892 TTAGGAATGTGGAAAGCAGATGG + Intronic
1046208229 8:111032502-111032524 TTAAGTAAATGGATAGCAGATGG + Intergenic
1047120701 8:121901213-121901235 CTTGGGAAATGAAAGGCAGATGG - Intergenic
1047348035 8:124047588-124047610 GAAGGGAAATGGAAAGCAATGGG - Intronic
1047488588 8:125355345-125355367 GAAGGGAAAGGGAAAGGAGAAGG + Intronic
1048028108 8:130605365-130605387 CAAGGGAAGTGGAAAGTAAATGG - Intergenic
1048167653 8:132077563-132077585 GTAGGGCAAAGGAAAGGAGAAGG + Intronic
1048876349 8:138839439-138839461 CTTGGAAAATAGAAACCAGATGG - Intronic
1048939837 8:139390278-139390300 CTAGAAAAATGGAAAACAAAAGG + Intergenic
1048996607 8:139798435-139798457 CTGGGGACATTGAAATCAGAAGG + Intronic
1050526568 9:6551713-6551735 ATAGGGAAAGAGAAAGGAGAAGG + Intronic
1052418489 9:28208888-28208910 GATGGGAAATGGAAAGCAGATGG - Intronic
1055045860 9:71923150-71923172 TGAGGGATATGGAAACCAGATGG - Intronic
1055293883 9:74814261-74814283 CCATGGAGATGGAGAGCAGAAGG + Intronic
1057804438 9:98210408-98210430 CTAGATAAATGGAAAGCATGGGG + Intronic
1058760690 9:108128621-108128643 TTTGGAAGATGGAAAGCAGATGG + Intergenic
1059693894 9:116712665-116712687 CTAAGGAAAAGCAAATCAGAGGG - Intronic
1059992484 9:119878331-119878353 GTAGAGAAATGGCAAGAAGATGG - Intergenic
1060229324 9:121815058-121815080 TTTGGCAAGTGGAAAGCAGATGG - Intergenic
1060354025 9:122887073-122887095 CTGGGGAAATTTATAGCAGATGG - Intronic
1061319393 9:129818583-129818605 CTGGAGGAGTGGAAAGCAGAGGG - Exonic
1061488796 9:130934020-130934042 ACTGGGAAATGGAAAGCTGAAGG + Intronic
1061822497 9:133236394-133236416 ACAGGGTAATGGAAAGCAAAGGG - Intergenic
1062236804 9:135514144-135514166 ACAGGGTAATGGAAAGCAAAGGG + Intergenic
1062258266 9:135641686-135641708 CAATGGAAATGAAAAGCAAAAGG - Intergenic
1062687792 9:137824489-137824511 CTATGGAAATGCAAAGGACATGG - Intronic
1203602302 Un_KI270748v1:25149-25171 ATACAGAAAAGGAAAGCAGAGGG - Intergenic
1186215664 X:7297895-7297917 CTAAGGAACTGGGAGGCAGATGG - Intronic
1186781004 X:12911900-12911922 TTAGCAAAATGGAAAGCAGGTGG - Intronic
1187393981 X:18904208-18904230 CCAGGAAAGTGGAAAACAGAAGG + Intronic
1187412351 X:19062346-19062368 CAGGGGAAACTGAAAGCAGAGGG - Intronic
1187960589 X:24563372-24563394 CCAGGTGAATGGAAATCAGAGGG + Intronic
1188265534 X:28068595-28068617 TCAGGGAAATAGAAAGTAGAAGG - Intergenic
1188459493 X:30407272-30407294 CTACAGAAATGGAAAGAAGAGGG - Intergenic
1188860414 X:35248997-35249019 GTAGGGAAATTCAAGGCAGAGGG - Intergenic
1189585150 X:42452757-42452779 ATAAGGAAATGGACGGCAGATGG + Intergenic
1189654695 X:43231806-43231828 TTAGAGAAATGCAAAGAAGAAGG + Intergenic
1190095233 X:47474524-47474546 CTAGAGAAATGAGAAACAGATGG + Intronic
1190450616 X:50576645-50576667 ACAGAGAAATGAAAAGCAGAGGG - Intergenic
1190728613 X:53209336-53209358 CTAGGGAATTGGACAGAAGGAGG - Intronic
1192020804 X:67388554-67388576 CCAAGCAAATGGAAAGCAAAAGG + Intergenic
1192844584 X:74892754-74892776 TTAGGGAGATGGCAGGCAGATGG - Intronic
1193074737 X:77343759-77343781 TTTGGAAGATGGAAAGCAGAAGG + Intergenic
1193359879 X:80569216-80569238 CCATGCAAATGGAAAACAGAAGG - Intergenic
1193500604 X:82269584-82269606 CCAGGGAAATGGAGAGCATCAGG - Intergenic
1194687048 X:96933263-96933285 AAAGGGAAATGGAAAGGAAAAGG - Intronic
1196030989 X:111095975-111095997 AGAGGGAAAGGGAAAGGAGATGG - Intronic
1196874359 X:120144179-120144201 CTAGGGGAAGGGGAAGGAGAGGG + Intergenic
1196920270 X:120578192-120578214 AAAGGCAGATGGAAAGCAGATGG + Intergenic
1197170322 X:123426771-123426793 GTAGGGAATGGGAAAGAAGATGG - Intronic
1198116729 X:133551436-133551458 ATAGAGAAATGGAAAGGAGGGGG - Intronic
1198185434 X:134249806-134249828 CTGGGGATATGGAAATCAAAGGG + Intergenic
1199278331 X:145971550-145971572 CTAGGGAAAGGTGAAGGAGAGGG + Intergenic
1199546661 X:149013523-149013545 TTGGGGAAATGGAAAGTAGCCGG - Intergenic
1199621176 X:149703055-149703077 CTAGAGCAATGACAAGCAGATGG + Intronic
1199637518 X:149827167-149827189 CTAGGGAAAGGGGAAGGAGAGGG + Intergenic
1199637854 X:149830218-149830240 CTAAGGGAAGGGAAAGGAGAAGG + Intergenic
1199785692 X:151102913-151102935 CTAAGGAAATGTAAGGAAGATGG + Intergenic
1199840443 X:151641706-151641728 ATAGGGAATTGGAGAGGAGAAGG + Intronic
1201511596 Y:14770096-14770118 CTAGGGAAAGGGACAGCAGTGGG + Intronic