ID: 916756160

View in Genome Browser
Species Human (GRCh38)
Location 1:167772006-167772028
Sequence GCCTCGGGCTGCCGACTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 848
Summary {0: 1, 1: 0, 2: 39, 3: 246, 4: 562}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916756160_916756168 8 Left 916756160 1:167772006-167772028 CCAGGCAGTCGGCAGCCCGAGGC 0: 1
1: 0
2: 39
3: 246
4: 562
Right 916756168 1:167772037-167772059 CACAGGAGCCCGAGGCAGGGAGG 0: 5
1: 34
2: 53
3: 150
4: 895
916756160_916756162 -9 Left 916756160 1:167772006-167772028 CCAGGCAGTCGGCAGCCCGAGGC 0: 1
1: 0
2: 39
3: 246
4: 562
Right 916756162 1:167772020-167772042 GCCCGAGGCAGGAGAATCACAGG 0: 2
1: 75
2: 1558
3: 3812
4: 6474
916756160_916756171 30 Left 916756160 1:167772006-167772028 CCAGGCAGTCGGCAGCCCGAGGC 0: 1
1: 0
2: 39
3: 246
4: 562
Right 916756171 1:167772059-167772081 GTTGCAGCGAGCCAAGATCACGG 0: 10
1: 224
2: 551
3: 1086
4: 1643
916756160_916756167 5 Left 916756160 1:167772006-167772028 CCAGGCAGTCGGCAGCCCGAGGC 0: 1
1: 0
2: 39
3: 246
4: 562
Right 916756167 1:167772034-167772056 AATCACAGGAGCCCGAGGCAGGG 0: 5
1: 36
2: 38
3: 37
4: 194
916756160_916756165 0 Left 916756160 1:167772006-167772028 CCAGGCAGTCGGCAGCCCGAGGC 0: 1
1: 0
2: 39
3: 246
4: 562
Right 916756165 1:167772029-167772051 AGGAGAATCACAGGAGCCCGAGG 0: 5
1: 36
2: 89
3: 625
4: 3643
916756160_916756166 4 Left 916756160 1:167772006-167772028 CCAGGCAGTCGGCAGCCCGAGGC 0: 1
1: 0
2: 39
3: 246
4: 562
Right 916756166 1:167772033-167772055 GAATCACAGGAGCCCGAGGCAGG 0: 5
1: 35
2: 38
3: 66
4: 656

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916756160 Original CRISPR GCCTCGGGCTGCCGACTGCC TGG (reversed) Intronic
900082603 1:869860-869882 GCTTCGCGCTGCCGCCTGGCTGG + Intergenic
900276053 1:1829303-1829325 GCCTCGGCCTCCCAAATGCCGGG + Intronic
901649874 1:10737344-10737366 GCCCAGGGCTGCCGTCAGCCTGG + Intronic
902593401 1:17491270-17491292 GCCTCAGCCTCCCGACTACCTGG + Intergenic
903002898 1:20279058-20279080 GCCTGGGGCTGCCGCCAGCTGGG + Intergenic
903146429 1:21375690-21375712 GCCTCAGCCTCCCGACTGGCTGG - Intergenic
903278671 1:22237633-22237655 GCCTCAGGCTTCCGAGTGCCTGG - Intergenic
903629736 1:24758569-24758591 GCCTCAGCCTCCCGACTGGCTGG + Intronic
904561319 1:31399347-31399369 GCCTCGGCCTGCCGAGTAGCTGG - Intergenic
904761144 1:32805111-32805133 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
904831797 1:33310186-33310208 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
904930152 1:34081531-34081553 GCCTCGGCCTGCCGAGTGCCTGG + Intronic
905673337 1:39807798-39807820 GCCTCAGCCTGCAGAGTGCCTGG + Intergenic
905680724 1:39869215-39869237 GCTTCAGCCTGCCGAGTGCCTGG + Intronic
906308698 1:44738155-44738177 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
906355659 1:45105064-45105086 GCCTTGGCCTGCCGAGTGCCTGG + Intronic
906370223 1:45247582-45247604 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
907009702 1:50952220-50952242 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
907689833 1:56652125-56652147 GCCTCGGCCTCCCGACTAGCTGG + Intronic
908467707 1:64414361-64414383 GCCTCAGCCTGCCAAGTGCCTGG + Intergenic
908489613 1:64630413-64630435 GCCTCAGCCTGCCGAGTACCTGG + Intronic
910815859 1:91289743-91289765 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
910891806 1:92026768-92026790 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
910980927 1:92960003-92960025 GCCTCGGCCTCCCAAGTGCCGGG + Intronic
911569631 1:99507664-99507686 GCCTCGGCCTGCCAAGTGCCTGG + Intergenic
912203019 1:107480030-107480052 CCATCTGGCTGCCGCCTGCCTGG + Intronic
912359260 1:109081425-109081447 GCCTCAGGCTCCCGAATGGCTGG + Intergenic
912372803 1:109186861-109186883 GCCTTGGCCTGACCACTGCCGGG + Intronic
912966540 1:114241976-114241998 GCCTCGGCCTGCCGAGTGCCTGG + Intergenic
913705502 1:121418424-121418446 GCCTCGGCCTGCCGAGTGCCTGG - Intergenic
914374463 1:147061397-147061419 GCCTCAGCCTGCCAAGTGCCTGG + Intergenic
914780822 1:150782768-150782790 GCCTCGGCCTGCCGAATAGCTGG - Intergenic
914802292 1:150970608-150970630 GCCTCAGCCTCCCGAGTGCCTGG + Intronic
914909119 1:151769955-151769977 GCCTCAGCCTGCTGAGTGCCTGG - Intronic
914954090 1:152145521-152145543 GCCTCAGCCTGCCAAGTGCCTGG - Intergenic
915079940 1:153345227-153345249 GTCTCTGGCTGCAGACTGTCTGG + Exonic
915178254 1:154035510-154035532 GCCTCAGCCTGCCGAGTGTCTGG + Intronic
915992463 1:160531520-160531542 GCCTCAGCCTGCCGAATGCCTGG + Intergenic
916037194 1:160932774-160932796 GCCTCAGCCTGCCCAGTGCCTGG + Intergenic
916049909 1:161029080-161029102 GCCTCAGCCTGCTGAGTGCCTGG + Intronic
916108443 1:161447192-161447214 GGCTCTGCCTGCCAACTGCCAGG - Intergenic
916110030 1:161454572-161454594 GGCTCTGCCTGCCAACTGCCAGG - Intergenic
916111616 1:161461983-161462005 GGCTCTGCCTGCCAACTGCCAGG - Intergenic
916113202 1:161469363-161469385 GGCTCTGCCTGCCAACTGCCAGG - Intergenic
916114107 1:161472878-161472900 GCTGCTGGCTGCCGACTGCTGGG - Intergenic
916279413 1:163032638-163032660 GCCTCAGCCTCCCGACTGGCTGG + Intergenic
916320649 1:163499638-163499660 GCCTCGGCCTGCCGAGTGCCTGG - Intergenic
916324981 1:163546398-163546420 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
916646693 1:166793649-166793671 GCCTCAGGCTTCCGAGTGGCTGG + Intergenic
916671875 1:167029359-167029381 GCCTCAGCCTGCAGAGTGCCTGG + Intergenic
916756160 1:167772006-167772028 GCCTCGGGCTGCCGACTGCCTGG - Intronic
916759957 1:167806887-167806909 GCCTAGGCCTGCTGAGTGCCTGG - Intergenic
916881896 1:169026930-169026952 GCCTCAGGCTGCCGAGTAGCTGG + Intergenic
917988853 1:180351388-180351410 GCCTCGGCCTCCCGACTAGCTGG + Intronic
918172333 1:182010339-182010361 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
918812637 1:189140495-189140517 GCCTCAGCCTGCCTAGTGCCTGG - Intergenic
918818674 1:189225165-189225187 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
919329117 1:196146545-196146567 GCCTCAGGCTCCCGAGTACCTGG + Intergenic
920144047 1:203842481-203842503 GCCTCAGCCTGCAGAGTGCCTGG - Intronic
921109009 1:212014658-212014680 GCCTCAGCCTGCCAAGTGCCTGG + Intronic
921192638 1:212724358-212724380 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
922306664 1:224350546-224350568 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
922436817 1:225615155-225615177 GCCTCAGCCTGCGGAGTGCCTGG + Intronic
922458515 1:225796714-225796736 GCCTCGGCCTGCTGAGTGCCTGG - Intergenic
922644743 1:227275715-227275737 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
922674621 1:227542748-227542770 GCTTCGCGCTGCCGCCTGGCTGG - Intergenic
923174746 1:231453667-231453689 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
923716503 1:236429019-236429041 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
923901189 1:238327549-238327571 GCCTCGGCCTGCCAAGTGCCTGG - Intergenic
923907582 1:238402528-238402550 GCCTCAGTCTCCCGAGTGCCTGG + Intergenic
1063122061 10:3112089-3112111 CCCTGGGGCTGCTGGCTGCCCGG + Intronic
1064070881 10:12227139-12227161 GCTTCAGCCTGCCGAGTGCCTGG - Intronic
1064520076 10:16191485-16191507 GCCTCAGGCTTCCGAGTGACTGG + Intergenic
1064570244 10:16685133-16685155 GCCTCGGTCTCCCGAGTACCTGG - Intronic
1065055195 10:21837023-21837045 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
1065737914 10:28771282-28771304 GCCTCAGCCTCCCGAGTGCCTGG + Intergenic
1066115376 10:32234156-32234178 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
1066140660 10:32500929-32500951 GCCTCAGCCTGCCAAGTGCCTGG - Intronic
1066141380 10:32506735-32506757 GCCTTGGCCCGCCGAGTGCCTGG - Intronic
1066325224 10:34352458-34352480 GCCTCAGCCTGCAGAGTGCCTGG + Intronic
1066390772 10:34976068-34976090 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1066590715 10:36991073-36991095 GCCTCAGGCTCCCGAGTGGCTGG - Intergenic
1067086386 10:43242645-43242667 GCCTCGGCCTGCCAAGTGCCTGG + Intronic
1067100109 10:43328914-43328936 GCCTCGGCCTGCCGAGTGCCTGG + Intergenic
1067117582 10:43447072-43447094 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
1067166703 10:43871118-43871140 GCCTGGAGCTGCCAACTGCCCGG + Intergenic
1067333856 10:45346293-45346315 GCCTCGGCCTGCCGAGTGCCTGG + Intergenic
1067825920 10:49572782-49572804 GCCTCAGGCAGCTGGCTGCCTGG + Intergenic
1068673106 10:59743777-59743799 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1068690864 10:59912490-59912512 GCCTCGGCCTCCCGAGTGTCTGG + Intergenic
1068967703 10:62929402-62929424 GCCTTGGCATGCCGAGTGCCTGG - Intergenic
1069399683 10:68029851-68029873 GCCTCAGCCTCCCGACTACCTGG + Intronic
1069675086 10:70240610-70240632 GCCTCGGCCTGCCGAGTGCCTGG - Intergenic
1069709408 10:70479114-70479136 GCCTCGGGCTGGGGGGTGCCCGG - Intronic
1070367584 10:75751198-75751220 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
1070629810 10:78076540-78076562 GCCTCAGCCTGCCGACTGCCTGG - Intergenic
1070807658 10:79279845-79279867 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
1071171921 10:82876771-82876793 GCCTCGGCCTCCCAACTGCTGGG - Intronic
1071289869 10:84180969-84180991 GCCTCAGCCTGCCAAGTGCCTGG - Intronic
1071538200 10:86454490-86454512 GCCTCAGCCTGCCTAGTGCCTGG + Intronic
1073076805 10:100829426-100829448 GCCCCGGGCGGCCGAAGGCCGGG + Exonic
1073206301 10:101771044-101771066 GCCTCGAGCTCCCCACTTCCTGG - Intronic
1073274999 10:102302148-102302170 GCCTCAGCCTGCCAAGTGCCTGG - Intronic
1073578006 10:104641288-104641310 GGCTCGGGCTGCCGAGTGTGTGG - Exonic
1075243254 10:120798054-120798076 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1075407438 10:122204041-122204063 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
1075893061 10:125970697-125970719 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
1076011893 10:126995523-126995545 GCCTCAGCCTGCGGAGTGCCTGG - Intronic
1076639107 10:131901606-131901628 GCCTGGGGCTGCCTCCTGCCCGG + Intronic
1076639120 10:131901641-131901663 GCCCGGGGCTGCCTCCTGCCTGG + Intronic
1077040063 11:516962-516984 GCCTCGGCCTGCCAAGTGCCTGG + Intergenic
1077183918 11:1228184-1228206 GCCCAGGGCTGCCGGCTGCGGGG - Intronic
1077680624 11:4237284-4237306 GCCTCAGCCTGCTGAGTGCCTGG + Intergenic
1077684903 11:4282682-4282704 GCCTCAGCCTGCCCAGTGCCTGG + Intergenic
1077690287 11:4335248-4335270 GCCTCAGCCTGCCCAGTGCCTGG - Intergenic
1077839524 11:5960372-5960394 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1078122266 11:8522904-8522926 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
1078174628 11:8960794-8960816 GCCTCGGCCTCCCGAGTGGCTGG + Intronic
1078270250 11:9788347-9788369 TCCTCAGGCTGGCTACTGCCAGG + Intronic
1079018191 11:16887506-16887528 GCCTCAGCCTGCCCAGTGCCTGG + Intronic
1080405113 11:31971894-31971916 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
1080538248 11:33243199-33243221 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1080983326 11:37432217-37432239 GCCTCGGCCTGCCGAGTGCTTGG - Intergenic
1081200227 11:40206348-40206370 GCCTCAGCCTGCCGAGTACCTGG + Intronic
1081722411 11:45300018-45300040 GAGTCTGGCTTCCGACTGCCTGG + Intergenic
1081773504 11:45663701-45663723 GCCTAGGGCTGCTCACCGCCAGG + Intronic
1081950594 11:47039378-47039400 GCCTCAGCCTGCCAACTGCCTGG - Intronic
1082005365 11:47416066-47416088 GCCTGGGGCTGCTCCCTGCCCGG - Exonic
1082064948 11:47892402-47892424 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1082166598 11:48956409-48956431 GCCTCAGCCTGCCCAGTGCCTGG - Intergenic
1082706071 11:56496673-56496695 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1082770678 11:57205287-57205309 GCCCCGGGCTGCCTGCTGGCTGG - Intergenic
1082871148 11:57944516-57944538 GCCTCAGCCTGCAGAGTGCCTGG - Intergenic
1083120656 11:60509716-60509738 GCCTCAGCCTGCCAAGTGCCTGG + Intergenic
1083196755 11:61092681-61092703 GCCTCGGGTTGCTGTCTTCCAGG - Intergenic
1083897255 11:65626091-65626113 GGCTCGGGCTGCAGCCTGGCTGG + Intronic
1084175887 11:67421994-67422016 GCCTCAGGCTCCCGAGTACCTGG + Intronic
1084572212 11:69966537-69966559 GCCTCGGGCTTCCCAGTGGCAGG - Intergenic
1085159529 11:74327918-74327940 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1085443486 11:76583190-76583212 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
1085484553 11:76850968-76850990 GCCTCTGGCACCAGACTGCCTGG + Intergenic
1085609371 11:77933335-77933357 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
1085791179 11:79499368-79499390 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1085822064 11:79804126-79804148 GCCTCAGCCTGCCGAATGCCTGG + Intergenic
1085887539 11:80537799-80537821 GCCTGGGCCTGCAGACAGCCAGG - Intergenic
1087487131 11:98770638-98770660 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
1088257449 11:107914999-107915021 GCCTCGGCCTCCCGACTAGCTGG + Intronic
1088368411 11:109062983-109063005 TCCTCGAGCTGCAGACTGGCTGG + Intergenic
1088829546 11:113523786-113523808 GCCTCGGCCTGCCGAGTGCCTGG + Intergenic
1089510300 11:118992400-118992422 GCCTCAGCCTGCAGAGTGCCTGG - Intergenic
1089742819 11:120596837-120596859 GCCTCAGCCTGCCGAGTGGCTGG + Intronic
1090152927 11:124403996-124404018 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
1090426459 11:126610203-126610225 GCCTCAGCCTGCCGAGTGGCTGG + Intronic
1090686535 11:129128696-129128718 GCCTCAGCCTGCAGAGTGCCTGG + Intronic
1090758647 11:129816270-129816292 GCCCCGGGCCTCCGTCTGCCCGG + Intronic
1090762323 11:129848396-129848418 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
1091219237 11:133920504-133920526 GCCTTGGGCTGCAGACTCTCGGG + Exonic
1092850152 12:12618922-12618944 GCCTCAACCTGCCGAGTGCCTGG - Intronic
1094844621 12:34356008-34356030 GCCTTGGGCTGGCCACTGTCGGG + Intergenic
1095243766 12:39893412-39893434 GCCTCAGCCTCCCGACTGGCTGG + Intronic
1095452979 12:42350847-42350869 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
1096054660 12:48641478-48641500 GCCTCGGCCTGCCGAGTGCCTGG + Intergenic
1096101485 12:48972717-48972739 GCCTTGGGCTGCGGTCTGGCAGG - Intergenic
1096809285 12:54159371-54159393 GCCTCGGGCTGGGGATTGGCTGG + Intergenic
1096826155 12:54279756-54279778 GCCTTGAGCTGCCGACTGATCGG - Intronic
1096968807 12:55649041-55649063 GCCTCAGCCTGCTGAGTGCCTGG - Intergenic
1097110200 12:56652320-56652342 GCCTCAGCCTGCCGATCGCCCGG - Intergenic
1097228762 12:57495883-57495905 GCCTCAGCCTGCCCAGTGCCTGG - Intronic
1097254652 12:57664585-57664607 GTCTCGGCCTACCGAGTGCCTGG + Intergenic
1097872269 12:64611009-64611031 GCCTCGGGCTGCCGCCTGCGGGG + Intronic
1098022985 12:66174531-66174553 GCCTCGGCCTGCCAAGTGCCTGG + Intergenic
1098333270 12:69375785-69375807 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
1098751142 12:74293954-74293976 GCCTCGCGCTGCCTACCTCCTGG - Intergenic
1098774026 12:74588816-74588838 CCCTCAGCCTGCCGAGTGCCTGG - Intergenic
1098907050 12:76172918-76172940 GCCTCAGGCTCCCGAGTGGCTGG - Intergenic
1099635460 12:85206149-85206171 GCCTGGGACTGCTGACTTCCAGG + Intronic
1100048109 12:90410684-90410706 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1100263024 12:92950505-92950527 GCCTCGGCCTCCCGAGTGGCTGG - Intergenic
1100642305 12:96493681-96493703 GCCTCGGCCTGCCGAGTAGCTGG - Intronic
1101504074 12:105330699-105330721 GCAGCGGGCTGCGGGCTGCCGGG - Exonic
1102152589 12:110699011-110699033 GCCTCAGCCTCCCGACTGGCTGG - Intronic
1102323145 12:111956626-111956648 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
1102656424 12:114485498-114485520 GCCTCAGCCTGCCCAGTGCCTGG - Intergenic
1102696942 12:114807329-114807351 GCCTCAGCCTGCCGAGTGGCTGG - Intergenic
1102883531 12:116504690-116504712 GCCTCAGCCTGCCGACTAGCTGG + Intergenic
1103045250 12:117730621-117730643 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
1103350301 12:120278895-120278917 GCCTTGGCCTGCCGAGTGCCTGG - Intergenic
1104910767 12:132239933-132239955 GCCTCAGGCAGCCGCCTGCCTGG + Intronic
1106747845 13:32722239-32722261 GCCTCAGCCTGCCCAGTGCCTGG - Intronic
1106799389 13:33241653-33241675 GCCTCAGCCTGCCCAATGCCTGG + Intronic
1107042704 13:35966617-35966639 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
1107562552 13:41571461-41571483 GCCTCAGCCTGCAGAGTGCCTGG + Intronic
1107737862 13:43417092-43417114 GCCTCGGCCTGCCGAGTGCCTGG - Intronic
1108214754 13:48173219-48173241 GCCTCGGCCTCCCGAGTGCTGGG + Intergenic
1108685743 13:52817585-52817607 GCCTCAGCCTGCCCAGTGCCTGG + Intergenic
1110506583 13:76294802-76294824 GCCTCAGCCTGCCCAGTGCCTGG + Intergenic
1110629412 13:77690472-77690494 GCCTCAGCCTCCCGACTGGCTGG + Intergenic
1111230755 13:85341389-85341411 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
1111388470 13:87561206-87561228 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1112070696 13:95846308-95846330 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
1112077423 13:95929077-95929099 GCCTCAGCCTGCCTAGTGCCTGG - Intronic
1112250470 13:97774586-97774608 GCCTCGGCCTGCCGAGTGCCTGG + Intergenic
1112252960 13:97800757-97800779 GCCTCGGGCTCCTGACTAGCTGG - Intergenic
1112611279 13:100957161-100957183 GCCTCAAGCTGCCTCCTGCCTGG - Intergenic
1113139072 13:107127060-107127082 GCCTCTGGATCCTGACTGCCAGG - Intergenic
1113328978 13:109311010-109311032 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1113465716 13:110511726-110511748 GCCTGGGGCTGCCTCCTGCAGGG + Intronic
1113735896 13:112678922-112678944 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
1113802253 13:113092717-113092739 GCCTGTGGCTGCCCACTCCCAGG + Intronic
1113827578 13:113268342-113268364 GCCTGGGCCTGGCCACTGCCTGG - Intergenic
1114137111 14:19865823-19865845 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1114578614 14:23736442-23736464 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1114594457 14:23899087-23899109 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
1115494042 14:33984971-33984993 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
1115547309 14:34475574-34475596 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1115568820 14:34648191-34648213 GCCTCAGGCTCCCGACTAGCTGG - Intergenic
1116501987 14:45634631-45634653 GCCTCAGCCTGCTGAGTGCCTGG + Intergenic
1116959771 14:50957115-50957137 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
1117010768 14:51468174-51468196 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
1118253414 14:64183799-64183821 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
1119051977 14:71377859-71377881 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
1119074656 14:71624097-71624119 GCCTCTGGCTGTCGAGTGCTTGG - Exonic
1119166983 14:72502647-72502669 GCCTCAGGCTCCCGAGTACCTGG - Intronic
1119503462 14:75151153-75151175 GCCTCGGCCTCCCAACTGCTGGG + Intronic
1119722171 14:76898751-76898773 GCCTCAGCCTGCAGAGTGCCTGG - Intergenic
1119835592 14:77747029-77747051 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
1120170685 14:81245132-81245154 GCCTCAGCCTGCAGAGTGCCTGG - Intergenic
1120193892 14:81463022-81463044 GCCTCAGCCTGCAGAGTGCCTGG - Intergenic
1121297233 14:92838480-92838502 GCCTCAGCCTGCCGAGTACCTGG + Intronic
1121656106 14:95597044-95597066 GCCTCAGCCTCCCGACTGGCTGG + Intergenic
1122095349 14:99366510-99366532 GCCTCAGACTGCCGAGTACCTGG + Intergenic
1122120142 14:99548704-99548726 GCCTCGGTCTCCCGAGTACCTGG - Intronic
1122298782 14:100720152-100720174 GCCTCTGGCTGCGGGGTGCCTGG + Intergenic
1123721804 15:23067185-23067207 GCCTCGGCCTCCCGAGTGGCTGG + Intergenic
1123743520 15:23301178-23301200 GCCTCAGGCTCCCGAGTACCTGG - Intergenic
1123764681 15:23466455-23466477 GCCTCAGCCTCCCGAGTGCCTGG + Intergenic
1124607745 15:31184080-31184102 ACCTCAGCCTGCCGAGTGCCTGG + Intergenic
1125566403 15:40682209-40682231 GCCTCAGCCTGCCGAGTACCTGG + Intergenic
1125861404 15:43004491-43004513 GCCTCAGCCTGCAGAGTGCCTGG + Intronic
1126210851 15:46098683-46098705 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
1126573039 15:50172255-50172277 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
1126580328 15:50236916-50236938 GCCTCGGCCTCCCGAGTGGCTGG - Intergenic
1126752068 15:51886549-51886571 GCCTCAGCCTGCCCAGTGCCTGG - Intronic
1126816669 15:52460529-52460551 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
1127023961 15:54781978-54782000 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
1127088911 15:55447661-55447683 GCCTCGGCCTGCCGACTGCTTGG - Intronic
1127191935 15:56540290-56540312 GCCCCCGCCTGCCGAGTGCCTGG + Intergenic
1127866511 15:63037560-63037582 GCCTCAGGCTGCCGAGTAGCTGG + Intergenic
1128229213 15:66023303-66023325 GCCTGGGGCTGGAGCCTGCCTGG + Intronic
1128303093 15:66579645-66579667 GCCTCGGCCTCCCGACTAGCTGG + Intergenic
1128499998 15:68221344-68221366 GCCTCGGCCTGCCGAGTGCCTGG + Intronic
1128519654 15:68366943-68366965 GCATCGTGCTGCCCAGTGCCTGG + Intronic
1128577517 15:68786372-68786394 GCCTCGGCCTCCCGAGTGGCTGG + Intronic
1128843863 15:70872278-70872300 GCCTCAGCCTGCCCAGTGCCTGG - Intronic
1129589068 15:76899277-76899299 GCCTCGGCCTGCCGAGTGCCTGG + Intronic
1130401602 15:83560238-83560260 GCCCCAGGCTGCGCACTGCCTGG + Intronic
1130942544 15:88523552-88523574 GCCTCAGTCTACCGAGTGCCTGG + Intronic
1131385154 15:91999675-91999697 GCCTCGGCCTCCCGAGTACCTGG - Intronic
1131396096 15:92087631-92087653 GCCTCGGCCTCCTGAGTGCCTGG + Intronic
1131701338 15:94939535-94939557 GCCTCGGGCTGCTGAGTAGCTGG + Intergenic
1131815996 15:96221977-96221999 GCCTCAGCCTGCCGAGTGGCTGG + Intergenic
1132265525 15:100466966-100466988 GCCTCAGGCTCCCGAGTGGCTGG + Intronic
1132723598 16:1328877-1328899 GCCTCAGCCTCCCGAGTGCCTGG + Intergenic
1132848304 16:2011052-2011074 GCCTCAGGCTGCCGAGTAGCTGG - Intronic
1132984325 16:2756375-2756397 GGATCGGGCTGCCGACGCCCCGG + Exonic
1133696988 16:8274252-8274274 GCCTCAGCCTGCCGAATGGCTGG + Intergenic
1133802231 16:9092634-9092656 GCCTCGGGGCGGGGACTGCCAGG + Intronic
1134398685 16:13889185-13889207 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1134750287 16:16619724-16619746 GCCTCAGCCTGCTGAGTGCCTGG - Intergenic
1134995171 16:18733874-18733896 GCCTCAGGCTGCTGAGTGCCTGG + Intergenic
1135034332 16:19064472-19064494 GCCTCGGGCTCCCGAGTAGCTGG + Intergenic
1135699718 16:24621471-24621493 GCCTCGGCCTCCCGAGTGGCTGG + Intergenic
1135915385 16:26600753-26600775 GCCTCAGGCTCCCGAGTACCTGG - Intergenic
1136165029 16:28448072-28448094 GCCTCAGCCTGCCAAGTGCCTGG + Intergenic
1136197936 16:28666908-28666930 GCCTCAGCCTGCCAAGTGCCTGG - Intergenic
1136214283 16:28781085-28781107 GCCTCAGCCTGCCAAGTGCCTGG - Intergenic
1136259003 16:29060930-29060952 GCCTCAGCCTGCCAAGTGCCTGG - Intergenic
1136424265 16:30158807-30158829 GCCTCGGCCTGCCGAGTGCCTGG + Intergenic
1136587354 16:31195686-31195708 GCCTCGGGCTCCTGAATGACTGG + Intergenic
1137430942 16:48417386-48417408 GCCTCAGCCTGCCCAGTGCCTGG - Intronic
1137439193 16:48483729-48483751 GCCTCAGCCTGCCGAGTTCCTGG - Intergenic
1137716818 16:50603242-50603264 GCCTGGGCGTCCCGACTGCCAGG + Intronic
1138037610 16:53624878-53624900 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
1139211205 16:65078859-65078881 ACCTGGGGCTGCTGACTGCCTGG + Intronic
1139378238 16:66514232-66514254 GCCTCAGCCTGCCAAGTGCCTGG + Intronic
1139394614 16:66630451-66630473 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
1139743402 16:69054824-69054846 GCCTCAGGCTCCCGAATGGCTGG - Intronic
1139848573 16:69937111-69937133 GTCTCAGGCTGCTGACTGACTGG + Exonic
1140128011 16:72133865-72133887 GCCTCGGCCTGCATACTTCCGGG - Intronic
1140498220 16:75408659-75408681 GCCTCAGGCTCCCGAGTGGCTGG - Intronic
1140777080 16:78259439-78259461 GCCTCAGTCTGCCGACTAGCTGG + Intronic
1140823740 16:78686394-78686416 GCCTCGGCCTCCCGACTAGCTGG - Intronic
1141603652 16:85141026-85141048 GCCTCAGGCTCCCGAGTGGCTGG + Intergenic
1141886201 16:86894112-86894134 ACTTCGAGCTCCCGACTGCCAGG + Intergenic
1142011663 16:87718482-87718504 GCCTCAGCCTGCTGAGTGCCTGG + Intronic
1142226838 16:88881665-88881687 GCCTGGGACTGCCGAGCGCCTGG + Intronic
1142287952 16:89179094-89179116 GCCAGGGGCTGCAGACAGCCTGG + Intronic
1142430683 16:90025129-90025151 GCCTCGGCCTCCCGAGTACCTGG + Intronic
1142913346 17:3113489-3113511 GCCTCAGCCTGCGGAGTGCCTGG - Intergenic
1143161724 17:4876245-4876267 TCCTCAGGCTGCCGCGTGCCAGG + Intronic
1143259001 17:5584428-5584450 GCCCCGGGCTGCTGGCTCCCAGG + Exonic
1143570469 17:7754899-7754921 ACCCCGGGCTGCCGTCTGCATGG + Intronic
1143636407 17:8166221-8166243 GCCTCAGGCTCCCGAGTCCCTGG + Intergenic
1143667556 17:8373287-8373309 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
1143669795 17:8388775-8388797 GCCTCAGCCTGCCGAGTGGCCGG - Intergenic
1143884658 17:10056902-10056924 GCCTCAGCCTGCCAAGTGCCTGG + Intronic
1144831473 17:18133769-18133791 GCCTCAGCCTCCCGACTGCCTGG + Intronic
1144866236 17:18337684-18337706 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
1145053798 17:19684958-19684980 GCCCCGGCCTGCCGAGTGCCTGG + Intronic
1145086903 17:19950422-19950444 GCCTCAGCCTGCAGAGTGCCTGG + Intronic
1145158269 17:20557067-20557089 GCCTCAGCCTGCCCAGTGCCTGG + Intergenic
1145927750 17:28660122-28660144 GCCACGGCCTGCCGAGTGCCTGG - Intronic
1146361076 17:32178304-32178326 GCCTCGGCCTACCGAGTGCCTGG + Intronic
1147140014 17:38455509-38455531 GCCTGGAGCTGCCAGCTGCCTGG - Intronic
1147277749 17:39333258-39333280 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
1147278274 17:39337098-39337120 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
1147440013 17:40442398-40442420 GCCTCAGGCTCCCGAGTACCTGG + Intergenic
1147708901 17:42448605-42448627 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1147710644 17:42461654-42461676 GCCTCGGCCTCCCGAGTGGCTGG - Intronic
1148328355 17:46797339-46797361 GCCTGGAGCTGCCGTCTTCCTGG - Intronic
1148672384 17:49420325-49420347 GCCTCGGCCTGCCGAGTGCCTGG - Intronic
1149450474 17:56746156-56746178 GCCTCGACCTCCCCACTGCCTGG - Intergenic
1150217149 17:63477104-63477126 GCCTCGGGCCGCCGGGGGCCGGG + Intergenic
1150518159 17:65836915-65836937 GCCTCAGCCTGCCCAGTGCCTGG + Intronic
1150751704 17:67869885-67869907 GCCTCAGGCTGCCGAGTAGCTGG - Intronic
1150780421 17:68116863-68116885 GCCTCAGCCTGCTGAGTGCCTGG - Intergenic
1151088301 17:71406379-71406401 GCCTCAGGCTCCTGAGTGCCTGG + Intergenic
1151317081 17:73329554-73329576 GCCTCAGCCTCCCAACTGCCTGG - Intergenic
1151670896 17:75571170-75571192 GCCGGGGGCTGCTGCCTGCCTGG + Intronic
1152426794 17:80222443-80222465 GCCTCAGGGTGCAGACAGCCAGG - Intronic
1152507713 17:80762226-80762248 GGCACGGGCTGCTGACTCCCCGG + Intronic
1152552255 17:81035550-81035572 GCCTGGGGCTGGGGACTGACCGG - Intronic
1152587754 17:81196617-81196639 GCCAGGGGCTTCCCACTGCCAGG - Intronic
1152824289 17:82454306-82454328 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
1153646957 18:7204117-7204139 GCCTCAGCCTGCCCAGTGCCTGG - Intergenic
1154003702 18:10507291-10507313 GCCTTGGCCTGCCGAGTGCCTGG - Intergenic
1154089486 18:11344158-11344180 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1154943632 18:21138357-21138379 GCCTCGGCCTGCCGAGTGCCTGG - Intergenic
1154969332 18:21391922-21391944 GCCTCAGCCTCCCGAGTGCCTGG + Intronic
1155235431 18:23813898-23813920 GCCTAGAGATGCCGACTTCCAGG + Intronic
1155972251 18:32092952-32092974 ACCCCGGGCTGCCGCCTGGCGGG + Intronic
1156066476 18:33148307-33148329 GCCTCAGGCTGCCGAGTGCCTGG - Intronic
1157455755 18:47827593-47827615 GCCTCAGCCTGCCGAGTGCCTGG + Exonic
1157778683 18:50418316-50418338 GCCTCGGCCTGCCGAGTACCTGG - Intergenic
1157857866 18:51117964-51117986 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
1158040775 18:53090577-53090599 GCCTCAGCCTGCCGAGTGGCTGG - Intronic
1158462426 18:57658159-57658181 GCCTCAGGCTCCCGAGTGGCTGG + Intronic
1158646760 18:59255091-59255113 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1158819878 18:61147127-61147149 GCCTCAGCCTCCCGACTGGCTGG - Intergenic
1158961897 18:62594702-62594724 GCCTCGGCCTCCCGAGTACCTGG + Intergenic
1160170311 18:76547778-76547800 GCCTCGGCCTGCCGAGTAGCTGG + Intergenic
1160465621 18:79073511-79073533 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
1161512176 19:4677912-4677934 GCCTGGGGCCGCCAGCTGCCTGG + Intronic
1161694292 19:5757410-5757432 GCCTCGGGCTCCCGAGTAGCTGG + Intronic
1161698476 19:5783029-5783051 GGCTGGGCCTGCCGGCTGCCTGG + Exonic
1161850588 19:6736207-6736229 ACCTCGGCCTCCCGACTGGCTGG + Intronic
1162163730 19:8738891-8738913 GCCTCAGCCTGCGGAGTGCCTGG + Intergenic
1162280502 19:9693344-9693366 GCCTCAGCCTCCCGAGTGCCTGG + Intronic
1162436135 19:10660421-10660443 GCCTCAGGCTGCAGACAGCAAGG - Intronic
1162538331 19:11277371-11277393 GCCTCAGCCTGCCAAGTGCCTGG - Intergenic
1162602273 19:11677759-11677781 GCCTCAGACTGCCGAGTGCCTGG - Intergenic
1164012287 19:21213323-21213345 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
1164016929 19:21261659-21261681 GCCTCGGCCTGCCCAGTGCCTGG - Intronic
1164034924 19:21444322-21444344 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
1164054895 19:21614404-21614426 GCCTCAGCCTGCGGAGTGCCTGG + Intergenic
1164126386 19:22322279-22322301 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
1164168263 19:22701172-22701194 GCCTCAGCCTGCAGACTGCCTGG - Intergenic
1164168684 19:22703737-22703759 GCCTCAGCCTGCAGACTGCCTGG - Intergenic
1164217413 19:23161689-23161711 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
1164260893 19:23567988-23568010 GCCTCGGCCTGCTGAGTGCCTGG + Intronic
1164659457 19:29949793-29949815 GCCTCAGCCTGCAGAGTGCCTGG - Intronic
1165088786 19:33371352-33371374 GCCTCAGGCTCCCGAGTGGCTGG + Intergenic
1165148565 19:33748190-33748212 GCCTGGGCCTGGCGAGTGCCTGG - Intronic
1165218609 19:34296209-34296231 CCCTCGGGCTGCCGTCTGCATGG - Intronic
1165541583 19:36496505-36496527 GCCTCGGGCTCCCAAGTGCTGGG + Intergenic
1166108602 19:40609849-40609871 CCCACGGGCTGCGGAATGCCTGG + Exonic
1166115202 19:40649048-40649070 GCCTCAGCCTGCCGAGTACCTGG - Intergenic
1166181178 19:41110261-41110283 GCCTCAGGCTCCCGACTAGCTGG + Intergenic
1166416250 19:42596481-42596503 GCCTCATGTTGCCGGCTGCCTGG + Intronic
1166567508 19:43774212-43774234 GCCTCTGGCTGACCACCGCCTGG - Exonic
1166611548 19:44203442-44203464 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1166649534 19:44562048-44562070 GCCTCGGCCTCCCGACTAGCTGG - Intergenic
1166750671 19:45162705-45162727 GTCTGGGGCTGCCCTCTGCCCGG - Intronic
1167588854 19:50391580-50391602 GCCTCAGCCTGCTGAGTGCCTGG - Intronic
1167913408 19:52721562-52721584 GCCTCAGCCTGCTGAGTGCCTGG - Intronic
1168696888 19:58408764-58408786 GCCGAGGACTGCGGACTGCCGGG - Exonic
925407731 2:3616642-3616664 GCCTCAGCCTGCAGAGTGCCTGG - Intronic
926252915 2:11165899-11165921 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
926729824 2:16028115-16028137 GCCTCGGCCTCCCGAGTACCTGG + Intergenic
927489911 2:23514383-23514405 GCCTCAGGGTGCAGAGTGCCAGG + Intronic
927515946 2:23671791-23671813 ACCTAGGGCTGCCCACTGGCTGG + Intronic
927737675 2:25536585-25536607 GCCTCGGCCTGCTGAGTGCCTGG - Intronic
927763569 2:25783012-25783034 GCCTCAGCCTGCCGAGTGGCTGG - Intronic
927937248 2:27082878-27082900 GCCACTGGCTGCCTGCTGCCCGG + Exonic
928009633 2:27595012-27595034 GCCTGGGCCTGCCCAATGCCTGG - Intronic
928509068 2:31984689-31984711 GCCTCAGCCTCCCGACTGGCTGG - Intronic
928514526 2:32033191-32033213 GCCTCAGCCTCCCGAGTGCCTGG - Intronic
928722306 2:34133805-34133827 GCCTCAGCCTGCCGAGTACCTGG - Intergenic
930122992 2:47775156-47775178 GCCTCGGCCTGCCAAGTGCTGGG - Intronic
930363485 2:50411139-50411161 GCCTCAGCCTGCCCAGTGCCTGG + Intronic
930428289 2:51239793-51239815 GCCTCGGCCTTCCGACTAGCTGG - Intergenic
931314292 2:61112741-61112763 GCCTCGGCCTCCCAACTGCTGGG + Intronic
932625638 2:73293593-73293615 GCTCCGGGCTTCCGACTCCCCGG + Exonic
933014740 2:77111230-77111252 GCCTCAGGCTGCCGAGTAGCTGG + Intronic
933869308 2:86550259-86550281 ACCTCGGCCTGCCAAGTGCCTGG - Intronic
933951867 2:87337928-87337950 GCCTCAGCCTCCCGAGTGCCTGG - Intergenic
934128223 2:88920031-88920053 GCCTCAGCCTGCCTAGTGCCTGG + Intergenic
935760831 2:106319191-106319213 GCCTCGGCCTCCCGAGTGGCTGG - Intergenic
936158350 2:110064525-110064547 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
936186311 2:110306801-110306823 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
936345478 2:111672189-111672211 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
937222140 2:120347719-120347741 TCCCCGGGCTGCCTGCTGCCTGG - Intronic
937734998 2:125277666-125277688 GCCTCAGCCTGCAGAGTGCCTGG - Intergenic
937991516 2:127664728-127664750 GTCTCCGGCTGCCACCTGCCAGG + Intronic
938236126 2:129708601-129708623 GTATGGGGCTGCCGGCTGCCAGG + Intergenic
938253288 2:129833133-129833155 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
938398794 2:130970472-130970494 GCCTCAGCCTGCCGAGTGGCTGG - Intronic
938836082 2:135105344-135105366 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
938970211 2:136424688-136424710 GCCCCGGGCTGGGGACTGGCAGG + Intergenic
940005161 2:149003397-149003419 GCCCCGGGCAGCTGACTGGCTGG + Intronic
940129263 2:150362848-150362870 GGCTCTGCCTGCCAACTGCCAGG + Intergenic
940817433 2:158311354-158311376 GCCTCAGCCTGCCGAGTGCATGG - Intronic
941024965 2:160448407-160448429 GCCTCAGCCTGCAGAGTGCCTGG + Intronic
941822505 2:169856715-169856737 GCCTCAGCCTACCGAGTGCCTGG - Intronic
942060966 2:172228297-172228319 GCCTCGGCCTCCCGACTAGCCGG - Intergenic
942085919 2:172443887-172443909 GCCTCGGCCTCCCGAGTACCTGG + Intronic
942110241 2:172674795-172674817 CCCTCGGGCTGCAGGCTGCCGGG + Intergenic
942113029 2:172700886-172700908 GCCTCGGCATGCGGAGTGCCTGG - Intergenic
943100194 2:183478662-183478684 GCCTCAGCCTGCCCAGTGCCTGG + Intergenic
943125975 2:183793233-183793255 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
943418670 2:187638024-187638046 GCCTCGGCCTGCCAAGTGCCTGG - Intergenic
943863069 2:192893593-192893615 GCCTCAGCCTGCAGAGTGCCTGG + Intergenic
944570706 2:201042069-201042091 GCCTCAGACTGCCAAGTGCCTGG + Intronic
944722785 2:202440679-202440701 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
945316804 2:208378256-208378278 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
945737408 2:213617454-213617476 GCCTCAGCCTCCCGACTGGCTGG + Intronic
945864979 2:215164156-215164178 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
946262940 2:218511421-218511443 GCCTCAGGCTCCCGACTAGCTGG + Intronic
948456714 2:238107843-238107865 GCCTCGGGCTGCAAAGTGCAGGG - Exonic
1169080955 20:2797503-2797525 GCCTAGGGCTGCCCATTGGCAGG - Intronic
1169420019 20:5452413-5452435 GCCTCGGCCTGACGAGTGCCTGG + Intergenic
1169788610 20:9386136-9386158 GCCTCGGCCTGCCAAGTGCCTGG - Intronic
1169872999 20:10267664-10267686 GCCTCAGCCTCCCGAGTGCCTGG + Intronic
1170592068 20:17778689-17778711 GCTTCAGCCTGCCGAGTGCCTGG + Intergenic
1170694337 20:18645034-18645056 GCCTCAGCCTTCCGACTGGCTGG - Intronic
1170975048 20:21155508-21155530 GCCTAGGGCTGGGGACTGACTGG + Intronic
1172337753 20:34131957-34131979 GCCTCAGCCTGCTGAGTGCCTGG + Intergenic
1172738870 20:37150400-37150422 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
1172806342 20:37614689-37614711 GCCTCAGCCTGCCGACTAGCTGG + Intergenic
1173473143 20:43338912-43338934 GCCTCAGCCTGCTGAGTGCCTGG - Intergenic
1173811117 20:45956341-45956363 GCCTCGGCCTCCCGAGTGGCTGG + Intronic
1174043395 20:47715694-47715716 GCCTCAGCCTCCCGACTGGCTGG + Intronic
1175256780 20:57652559-57652581 GCCTCGGCCCACCGACCGCCTGG - Exonic
1176019362 20:62954626-62954648 GCCTCAGGTAGCCGACTGTCTGG + Intronic
1176183556 20:63765541-63765563 TCCTCGGCCTGCCGAGTACCTGG + Intronic
1176672538 21:9748048-9748070 GCCAGGGCCTGCCCACTGCCAGG - Intergenic
1177057522 21:16326411-16326433 GCCTCGGGCTGCCCTTTCCCGGG - Intergenic
1177788440 21:25696271-25696293 GCCTCAGCCTGCCGAGCGCCTGG - Intronic
1178453608 21:32727585-32727607 GTCCCGGGCAGTCGACTGCCCGG + Intronic
1178708295 21:34891130-34891152 GACTCGGGCTGCGGTCTCCCAGG + Intronic
1178873261 21:36393095-36393117 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
1178912596 21:36687600-36687622 GCCTCAGCCTGCTGACTGGCTGG - Intergenic
1179029404 21:37707292-37707314 GACTGGGTCTCCCGACTGCCCGG + Intronic
1179064522 21:38011979-38012001 GCCTCAGCCTGCCGAGTGGCTGG + Intronic
1179204248 21:39259403-39259425 GCCTCGGCCTCCCGACTAGCTGG + Intronic
1179803200 21:43821699-43821721 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1179814733 21:43898014-43898036 GCCTCAGCCTGCTGAGTGCCTGG - Intronic
1179969016 21:44824194-44824216 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1180050251 21:45327791-45327813 TCCTGGGGCTGCCGCCTGCAGGG + Intergenic
1180195979 21:46194595-46194617 GCCTCCGTCTGCCATCTGCCGGG + Exonic
1181052151 22:20243052-20243074 GCATGGGGCTGCCACCTGCCAGG + Exonic
1181237229 22:21455046-21455068 GCCTCAGCCTCCCGACTACCTGG + Intergenic
1181274087 22:21677580-21677602 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
1181296833 22:21847112-21847134 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
1182564156 22:31184798-31184820 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
1183229513 22:36572585-36572607 GCCTCGGGCTCCCGAGTAGCTGG - Intronic
1183537332 22:38410580-38410602 GCCTCAGCCTGCAGAGTGCCTGG - Intergenic
1184065583 22:42117939-42117961 GCCTCAGGCTACCGAGTGGCTGG - Intergenic
1184145350 22:42607224-42607246 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
1184717834 22:46291839-46291861 GCCTCAGGCTCCCGACTAGCCGG - Intronic
1184962179 22:47938715-47938737 GCCTCGGGCTCCCAAGTGGCTGG - Intergenic
1185283851 22:49990473-49990495 GCCTCGGCCTGCCGAGTGCCTGG - Intergenic
949706411 3:6822887-6822909 GCCTCGGCCTGCCGAGTAGCTGG + Intronic
949936688 3:9121404-9121426 GCCTCGGGCTGCCTATTCCTTGG - Intronic
949989776 3:9569593-9569615 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
950227174 3:11245236-11245258 GCCTCGGCCTCCTGAGTGCCTGG - Intronic
950518210 3:13480687-13480709 GTCTCTGGGTGACGACTGCCAGG + Intronic
951026380 3:17834939-17834961 GCCTCGGCCTCCCGACTAGCTGG + Intronic
951264358 3:20548651-20548673 GCCTCAGCCTGCCTAGTGCCTGG - Intergenic
952285487 3:31964269-31964291 GCCTCAGGCTCCCGACTAACTGG + Intronic
953440272 3:42910235-42910257 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
954033185 3:47835116-47835138 GCCTCAGCCTCCCGAGTGCCTGG + Intronic
954351025 3:50043993-50044015 GCCTCAGTCTTCCGACTGGCTGG + Intronic
954481493 3:50804622-50804644 GCTTCAGCCTGCCGAGTGCCTGG - Intronic
954567212 3:51608709-51608731 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
954941867 3:54380621-54380643 GCCTCGGCCTCCCGAGTGGCTGG - Intronic
955256518 3:57338125-57338147 GCCTCGGCCTGCCGAGTGCCTGG + Intronic
955626704 3:60927112-60927134 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
955670208 3:61394269-61394291 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
956680290 3:71773092-71773114 GCCTCGGGCTCCCGAGTAGCTGG + Intronic
956781452 3:72606372-72606394 CCCTCGGACTGGAGACTGCCCGG - Intergenic
956803713 3:72787827-72787849 GCCTCAGCCTGCCAAGTGCCTGG + Intronic
958047476 3:88303339-88303361 GCCTCGGCCTGCCGAGTGCCTGG + Intergenic
958431240 3:94043770-94043792 GCCTTAGCCTGCCGAGTGCCTGG + Intronic
959053974 3:101551001-101551023 GCCTCGGCCTGCCCAGTGCCTGG + Intergenic
959184718 3:103032016-103032038 GCCTCAGCCTCCCGACTGGCTGG + Intergenic
960073503 3:113458325-113458347 GCCTCAGCCTGCCAAGTGCCTGG + Intronic
960344755 3:116518746-116518768 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
960431290 3:117571685-117571707 GCCTCAGGCTCCCGAGTGGCTGG + Intergenic
960577358 3:119242078-119242100 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
960770917 3:121191422-121191444 GCCTCAGCCTGCCGAATGCCTGG - Intronic
961473906 3:127135356-127135378 GCGTCGGGCTGACGGCTGCCTGG + Intergenic
961717518 3:128868796-128868818 GCCTCGGCCTCCCGACTAGCTGG + Intergenic
961941834 3:130646323-130646345 GCCTCGGGCTCCCAAGTGCTGGG - Intronic
962761682 3:138520921-138520943 GCCTCAGCCTGCTGAGTGCCTGG + Intronic
963776526 3:149445627-149445649 GCCTCAGCCTGCCCAGTGCCTGG - Intergenic
964341191 3:155710100-155710122 GCCTCGGCCTCCCGACTAGCAGG + Intronic
965136818 3:164784046-164784068 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
965177232 3:165351091-165351113 GCCTCAGCCTCCCGAGTGCCTGG + Intergenic
965302202 3:167018217-167018239 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
965598032 3:170426894-170426916 GCCTCAGGCTCCCGACTAGCTGG + Intronic
965649922 3:170923113-170923135 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
965649950 3:170923250-170923272 GCCTCGGCCTCCTGAGTGCCGGG + Intergenic
965960732 3:174425703-174425725 GCCTAGAGCTGCTGACAGCCAGG - Intergenic
966130079 3:176627490-176627512 GCCTCGGCCTCCCGAGTACCTGG - Intergenic
966176193 3:177140184-177140206 GCCTCAGCCTCCCGAGTGCCTGG - Intronic
966617349 3:181926552-181926574 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
966732732 3:183163821-183163843 AGCTCGCGCTGCCGACTCCCCGG + Intronic
967127382 3:186436084-186436106 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
967578655 3:191125666-191125688 GCCTCAGCCTGCCAAGTGCCTGG - Intergenic
967723361 3:192838541-192838563 GCCTCGGCCTCCCGAGTGGCTGG + Intronic
967880718 3:194299401-194299423 GCCTCAGGCTCCCGAGTGGCTGG + Intergenic
968076928 3:195821148-195821170 TCCTGGGGCTGCCATCTGCCTGG - Intergenic
968114288 3:196077635-196077657 GCCTCAGGCTCCCGAGTGGCTGG - Intronic
968156412 3:196385115-196385137 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
968852952 4:3095409-3095431 GCCTCAGCCTGCCAAGTGCCTGG - Intronic
969464917 4:7350611-7350633 GCCTGGACCTGCCGCCTGCCGGG - Intronic
970055572 4:11968002-11968024 GCCTCAGCCTGCCGAGTACCTGG + Intergenic
971282201 4:25250102-25250124 GCCTCAGCCTGCCAAGTGCCTGG - Intronic
972270856 4:37509846-37509868 GCCTCAGCCTGCAGAGTGCCTGG - Intronic
972517019 4:39818432-39818454 GCCTCAGGCTCCCGACTAGCTGG - Intergenic
972617404 4:40713100-40713122 GCCTCAGGCTGCCGAGTAGCTGG + Intergenic
972700926 4:41492284-41492306 GCCTCGGCCTGCCCAGTGCCTGG - Intronic
972815556 4:42641091-42641113 GGCTCTGGGTGCAGACTGCCTGG + Intronic
973021059 4:45206986-45207008 GCCTCGGCCTGCCGAGTGCCTGG + Intergenic
973263225 4:48185970-48185992 GCCTCAGCCTGCGGAGTGCCTGG + Intronic
973369602 4:49234885-49234907 GCTGCTGGCTGCCGGCTGCCAGG + Intergenic
973391429 4:49560531-49560553 GCTGCTGGCTGCCGGCTGCCAGG - Intergenic
973604065 4:52569654-52569676 GGCTCTGGTTGCAGACTGCCTGG + Intergenic
973650296 4:52992139-52992161 GCCTCAGCCTGTCGAGTGCCTGG + Intronic
973663979 4:53138983-53139005 GCCTCAGCCTGCCAAGTGCCTGG + Intronic
974597730 4:64036758-64036780 GCCTCAGCCTGCTGAGTGCCTGG + Intergenic
974848510 4:67380292-67380314 GCCTTGGCCTGCTGAGTGCCTGG + Intergenic
975063678 4:70037066-70037088 GCCTCAGCCTGCGGAGTGCCTGG + Intergenic
975796061 4:78007768-78007790 GCCTCAGCCCGCCGAGTGCCTGG - Intergenic
975908639 4:79244740-79244762 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
976103077 4:81586500-81586522 GCCTCAGGCTCCCGACTAGCTGG - Intronic
976124530 4:81819283-81819305 GCCTCAGGCTCCCGAGTGGCTGG - Intronic
976959878 4:90957214-90957236 GCCTCAGCCTCCCGACTACCTGG + Intronic
977542293 4:98331179-98331201 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
978014141 4:103722815-103722837 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
978157078 4:105501092-105501114 GCCTCAGCCTGCCCAGTGCCTGG - Intergenic
978224772 4:106320859-106320881 GCCTCAGTCTGCCGAGTTCCTGG + Intronic
978519661 4:109603208-109603230 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
978527393 4:109679529-109679551 GCCTCGGCCTGCTGAGTGCCTGG - Intronic
978742592 4:112154380-112154402 GCCTCAGGCTACCGAGTTCCTGG + Intronic
978888588 4:113796024-113796046 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
979264731 4:118688217-118688239 GCCTCGAACTCCCGACTTCCTGG - Intronic
979273589 4:118791637-118791659 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
979474593 4:121140217-121140239 GCCTCAGCCTCCCGACTGGCTGG - Intronic
979482739 4:121238094-121238116 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
979674143 4:123392803-123392825 GCCTCGGCCTCCCAACTGCTGGG + Intergenic
979702379 4:123684430-123684452 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
979709166 4:123757416-123757438 GCCTCAGGCTCCCGAGTGGCTGG + Intergenic
979941630 4:126770716-126770738 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
980909958 4:138985263-138985285 GCCTCGGCCTCCCAACTGCTAGG + Intergenic
980910908 4:138993373-138993395 GCCTCAGCCTGCCGAGTGGCTGG - Intergenic
981668849 4:147261901-147261923 GCCTCAGGCTCCCGAATACCTGG + Intergenic
981962723 4:150560869-150560891 GCCTCAGCCTGCCGAGTGGCTGG - Intronic
981994692 4:150963298-150963320 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
982138609 4:152296222-152296244 GCCCAGGGCTGCCAACTTCCTGG - Intergenic
982183014 4:152766003-152766025 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
982711060 4:158759296-158759318 GCCTCAGCCTGCTGAGTGCCTGG + Intergenic
983205825 4:164909341-164909363 GCCTCGGCCTCCCAAGTGCCAGG + Intergenic
983613898 4:169679773-169679795 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
983628628 4:169827916-169827938 GCCTCAGCCTGCAGAGTGCCTGG + Intergenic
983653047 4:170052662-170052684 GCCTCAGGCTCCCGAATGGCTGG - Intergenic
983664600 4:170166963-170166985 GCCTCAGCCTGCTGAGTGCCTGG - Intergenic
983906172 4:173184481-173184503 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
983937081 4:173509548-173509570 GCTTCGGCCTGGCGGCTGCCGGG + Intergenic
985402187 4:189603783-189603805 GCCAGGGCCTGCCCACTGCCAGG + Intergenic
985806960 5:2052903-2052925 GCCTCGGGCTGCCCGCCACCAGG + Intergenic
985861790 5:2477238-2477260 GCCTCCGGGTGCTGCCTGCCTGG + Intergenic
986790321 5:11153145-11153167 GCCTCAGCCTCCCGAGTGCCTGG - Intronic
987334807 5:16889289-16889311 GCCTCAGCCTCCCGACTGCCTGG - Intronic
988532416 5:32039218-32039240 GCCTCGGCCTGCCGAGTGCCTGG + Intronic
989063160 5:37430808-37430830 GCCTCGGCCTCCCAACTGCTGGG + Intronic
989216629 5:38910893-38910915 GCCTCAGCCTCCCGACTGGCTGG - Intronic
989247354 5:39269162-39269184 GCCTCGGCCTCCCGAGTGGCTGG + Intronic
989574609 5:42978809-42978831 GCCTCAGCCTGCCCAGTGCCTGG + Intergenic
989648913 5:43666475-43666497 GCCTCAGGCTGCTGAGTGCCTGG - Intronic
989656074 5:43746972-43746994 GCCTCAGCCTGCCGAGTGTCTGG - Intergenic
989663610 5:43825247-43825269 GCCTCAGCCTGCCAAGTGCCTGG - Intergenic
989977800 5:50607580-50607602 GCCTCGGCCTGCGGAGTGCCTGG + Intergenic
989991904 5:50775438-50775460 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
990381869 5:55227149-55227171 GCCTCCGGGTGCCGACTGCTCGG + Exonic
990485875 5:56258735-56258757 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
990501238 5:56398537-56398559 GCCTCAGCCTGCCCAGTGCCTGG - Intergenic
990617089 5:57519080-57519102 GCCTCGGCCTGCCGAGTGCCTGG - Intergenic
990709564 5:58565040-58565062 GCCTCGGCCTGCCGAGTGCCTGG - Intergenic
991394080 5:66185254-66185276 GCCTCAGCCTCCCGACTGGCTGG + Intergenic
991935472 5:71795148-71795170 GCCTCGGCCTGCCGAGTGCCTGG - Intergenic
992415954 5:76551737-76551759 GCCTCAGCCTGCAGAGTGCCTGG - Intronic
993934540 5:93985536-93985558 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
994517073 5:100785282-100785304 GCCTCTGCCTGCCGAGTGCCTGG + Intergenic
994907369 5:105859031-105859053 GCCTCAGCCTGCCGAGTGCGTGG + Intergenic
995236378 5:109833553-109833575 GCTTCAGCCTGCCGAGTGCCTGG - Intronic
995373125 5:111442380-111442402 GCCTCAGCCTTCCGAGTGCCTGG - Intronic
995456713 5:112360386-112360408 GCCTCAGCCTGCCCAGTGCCTGG + Intronic
996057582 5:118998604-118998626 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
996127670 5:119745104-119745126 GCCTCGGCCTCCCGAGTACCTGG - Intergenic
996159753 5:120147534-120147556 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
997433697 5:133858719-133858741 GCCTGGGCCTGCCGAGTGCCTGG - Intergenic
999299742 5:150484006-150484028 GCCTCAGGCTCCCGAGTGGCTGG + Intergenic
999528978 5:152440969-152440991 GCCTCAGCCTCCCGACTGGCTGG + Intergenic
999978914 5:156940069-156940091 GCCTCAGCCTGCTGAGTGCCTGG + Intronic
1000002185 5:157149499-157149521 GCCTCGGGCTCCCGAGTAGCTGG - Intronic
1000032794 5:157419061-157419083 GCCTCAGCCTGCTGAGTGCCCGG + Intronic
1000103584 5:158037878-158037900 GCCTCAGCCTGCAGAGTGCCTGG - Intergenic
1000630395 5:163584468-163584490 GCCTCAGCCTGCAGAGTGCCTGG - Intergenic
1001583220 5:172814310-172814332 GCCTCGGTCTTCCAAATGCCAGG - Intergenic
1002108920 5:176894889-176894911 GCCTCGGCCTCCCGAGTGGCTGG + Intronic
1002118389 5:176983347-176983369 GCCTCGGCCTGCCAAGTGCCTGG + Intronic
1002590958 5:180291652-180291674 GCCCGGGGCTGCTGACAGCCGGG + Intronic
1002626312 5:180531867-180531889 GCCTCAGCCTGCAGAGTGCCTGG - Intronic
1003279076 6:4676366-4676388 TCCTGGGGCTGCCGACTGAGAGG - Intergenic
1003808674 6:9755132-9755154 GCCTCGGCCTCCCGAGTACCTGG + Intronic
1004152339 6:13133406-13133428 GCCTCAGCCTGCCGAGTCCCTGG + Intronic
1005414626 6:25586837-25586859 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
1005624746 6:27653015-27653037 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1005710731 6:28501668-28501690 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1005901791 6:30222584-30222606 GCCTTGACCTGCCGAGTGCCTGG - Intergenic
1005903181 6:30237287-30237309 GCCTCAGCCTCCCGACTACCTGG + Intergenic
1006225220 6:32531656-32531678 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1006293698 6:33160277-33160299 GCCTCGGTCTCCCAACTGCTGGG - Intergenic
1006353926 6:33542369-33542391 GCCTCAGGCTCCTGACTGGCTGG - Intergenic
1006454818 6:34125687-34125709 TCCTGGGGCTGCCCAATGCCAGG + Intronic
1006455400 6:34129127-34129149 GCCTCAGCCTGCCGAGTGGCTGG + Intronic
1006678819 6:35782552-35782574 GCCTCAGGCTGAAGACTTCCTGG - Intronic
1006904241 6:37522252-37522274 GCCTCGGCCTCCCGACTAGCTGG - Intergenic
1007023029 6:38541621-38541643 GCCTCAGCCTCCCGACTACCTGG - Intronic
1007651372 6:43424772-43424794 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1007725581 6:43913827-43913849 CCCTCCAGCTGCCCACTGCCAGG - Intergenic
1008106450 6:47444519-47444541 GCCTCAGCCTGCCCAGTGCCTGG - Intergenic
1008377753 6:50810652-50810674 GCTTCAGCCTGCCGAGTGCCTGG - Intergenic
1008571884 6:52824829-52824851 GCCTTGGTCTGCCGAGTGCCTGG + Intergenic
1009041900 6:58190145-58190167 GCCTCAGCCTGCCGAGTGTCTGG + Intergenic
1009217754 6:60944413-60944435 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1009392633 6:63163463-63163485 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1009844905 6:69122332-69122354 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
1009869303 6:69433943-69433965 GCCTCGGCCTGCCGAGTGCCTGG - Intergenic
1009931293 6:70179995-70180017 GCCTCGGGCTCCCGAGTAGCTGG + Intronic
1010413691 6:75589608-75589630 GCCTCAGCCTCCCGAGTGCCTGG + Intergenic
1013800006 6:113931699-113931721 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1014123287 6:117750501-117750523 GCCTCAGCCTGCTGAGTGCCTGG + Intergenic
1014463783 6:121730284-121730306 GCCTCAGCCTGCTGAGTGCCTGG - Intergenic
1016123771 6:140374549-140374571 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
1016480014 6:144470909-144470931 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
1017000719 6:149995538-149995560 GCCTCGGGGTGGGGGCTGCCAGG + Intergenic
1017055352 6:150431218-150431240 GCCTCAGCCTCCCGAGTGCCTGG + Intergenic
1017063342 6:150507080-150507102 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1017856115 6:158350608-158350630 GCCTCGGCCTGCCGAGTGCCTGG - Intronic
1017897441 6:158692834-158692856 GCCTCAGCCTGCCGAGTGGCTGG - Intronic
1017947082 6:159104485-159104507 ACCACGGGCTGTCCACTGCCTGG + Intergenic
1017981771 6:159406854-159406876 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1019128557 6:169857576-169857598 GCCTCGGCCTGCTGAGTGCCTGG - Intergenic
1019488491 7:1300327-1300349 GACTGGGGCTGCCGCCTGCCAGG - Intergenic
1019980042 7:4614700-4614722 GCCTCGGGCTTCTGAGTGGCTGG + Intergenic
1020093984 7:5357524-5357546 GCCTCAGGCTCCCGACTAGCTGG + Intronic
1020283907 7:6665412-6665434 GCCTCGGTCTCCCGACTAGCTGG + Intergenic
1021995831 7:26177480-26177502 GCCTCGGCCCGCCCAGTGCCTGG - Intronic
1022035069 7:26526383-26526405 GCCAAGGCCTGCCGACTACCTGG + Intergenic
1022187725 7:27986768-27986790 GCCTCAGCCTGCCCAGTGCCTGG + Intronic
1022317938 7:29263141-29263163 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
1022542658 7:31153171-31153193 GCCTCGGCCTGCCAAGTGCCTGG + Intergenic
1022700182 7:32753285-32753307 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1023415120 7:39924921-39924943 GCCTCAGGCTGCCGAGTAGCTGG - Intergenic
1023895735 7:44431436-44431458 GCCTAGGCCTGCAGTCTGCCAGG - Intronic
1023954391 7:44872484-44872506 GCCTGGGCCTGCCGGGTGCCTGG - Intergenic
1024304996 7:47922025-47922047 GCCTCAGCCTGCCCAGTGCCTGG + Intronic
1024322897 7:48088144-48088166 GCCTCGGCCTGCCTAGTACCTGG + Intergenic
1025139059 7:56447886-56447908 GCCTCGGGGTGCCGCGTTCCTGG - Intergenic
1025731517 7:64112782-64112804 GCCTCAGCCTTCCGACTACCTGG - Intronic
1025775017 7:64553698-64553720 GCCTCAGCCTGCCAAGTGCCTGG + Intronic
1025938131 7:66053462-66053484 GCCTCAGTCTCCCGACTGGCTGG + Intergenic
1026007885 7:66614182-66614204 GCCTTAGCCTGCCGAGTGCCTGG + Intergenic
1027183661 7:75956838-75956860 GCCTCAGTCTCCCGAGTGCCTGG + Intronic
1027410076 7:77906791-77906813 GCCTCAGGCTCCCGAGTGGCTGG - Intronic
1027826670 7:83124867-83124889 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
1028535494 7:91886998-91887020 GCCTCGGCCTGCTGAGTGCCTGG + Intergenic
1028548014 7:92026447-92026469 GCCTCGGCCTGCCTAGTGCCTGG + Intronic
1028595814 7:92545695-92545717 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
1029291870 7:99508182-99508204 GCCTCAGCCTCCCGAGTGCCTGG - Intronic
1029814728 7:103081484-103081506 GCCTCGGCCTCCCGAGTACCTGG + Intronic
1030193488 7:106831938-106831960 GCCTCGGAATGCCCACAGCCCGG + Intergenic
1030212857 7:107013489-107013511 GCCTCGGCCTCCCGAGTACCTGG - Intergenic
1030329225 7:108255279-108255301 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
1030525867 7:110654256-110654278 GCCTCGGGCTCCCGAGTAGCTGG - Intergenic
1030706475 7:112697911-112697933 GCCTCAGCCTGCCCAGTGCCTGG - Intergenic
1031021924 7:116638267-116638289 GCCTCGGCCTGCCGAGTGCCTGG + Intergenic
1032028513 7:128462976-128462998 GCCTCAGCCTGCTGAGTGCCTGG + Intergenic
1032129339 7:129215849-129215871 GCCTCAGCCTGCCAAGTGCCTGG + Intergenic
1032179662 7:129664008-129664030 GCCTCGGCCTGGCGAGTGCCTGG - Intronic
1032792520 7:135253047-135253069 GCCTCAGCCTGCCGAGTGGCTGG + Intronic
1033185557 7:139224979-139225001 GCCTCGGCCTGCCGAGTGCCTGG + Intergenic
1033293919 7:140114280-140114302 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
1033565555 7:142575037-142575059 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1034059188 7:148070465-148070487 GCCTCGGCCTCCCGAGTGCTGGG - Intronic
1034359369 7:150480636-150480658 GCCTCGGGCTGCCGAGTAGCTGG + Intergenic
1034671636 7:152863198-152863220 GCCTCAGGCTGCCGAGTAGCTGG + Intergenic
1034980504 7:155473041-155473063 CCCTCGGGCTGCCAGTTGCCTGG - Intergenic
1035020148 7:155796168-155796190 GCCTTGCGTTGCCGCCTGCCTGG + Intergenic
1035213077 7:157343272-157343294 GCCTCAGGCTGCCGAGTAGCTGG + Intronic
1035528929 8:336235-336257 GCCTGGGGCTGCCGGCTGCCAGG - Intergenic
1036414946 8:8538298-8538320 GCCTCAGGCTGCCGAGTAGCTGG + Intergenic
1037129367 8:15389117-15389139 CCCTCAGGCTGCAGACTGACAGG - Intergenic
1037134728 8:15446610-15446632 GCCTCAGCCTGCCGAGCGCCTGG - Intronic
1037942104 8:22959359-22959381 GCCTCGGGCTCCCGAGTAGCTGG + Intronic
1038167822 8:25102546-25102568 GCCTCAGCCTGCCAAGTGCCTGG + Intergenic
1038799677 8:30738408-30738430 GCCTCGGCCTCCCGAGTGCTGGG - Intronic
1039067862 8:33624590-33624612 GCCTCAGCCTCCCGACTGGCTGG - Intergenic
1039463128 8:37762614-37762636 GCCACGGGCTGCCGGGGGCCTGG + Exonic
1039753310 8:40497110-40497132 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
1039841346 8:41295412-41295434 GCCTCGGCCTCCCGAGTACCTGG - Intronic
1040041481 8:42919825-42919847 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
1040053004 8:43033858-43033880 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
1040409189 8:47137616-47137638 GCCTCGGCCTGCTGACTGCCTGG + Intergenic
1040616397 8:49042174-49042196 GCCTCAGCCTGCCAAGTGCCTGG - Intergenic
1040917185 8:52574432-52574454 GCCTCGGCCTGCCAAGTGCCTGG - Intergenic
1041241095 8:55849693-55849715 GCCTCGGGCTGCAGACATGCTGG - Intergenic
1042040295 8:64581849-64581871 GCCCCCGGCTGCCTCCTGCCCGG + Exonic
1042312055 8:67388647-67388669 GCCTCGGCCTGCCGAGTAGCTGG - Intergenic
1043309781 8:78843697-78843719 GCCTCGGGCTCCCGAGTAGCTGG - Intergenic
1043958690 8:86390577-86390599 GCCTCAGCCTGCCTAGTGCCTGG - Intronic
1044582372 8:93835106-93835128 GCCTCAGCCTGCCCAGTGCCTGG - Intergenic
1044690120 8:94869095-94869117 GCCTCAGGCTCCCGAGTACCTGG + Intronic
1044969294 8:97604467-97604489 GCCTCAGCCTGCCCAGTGCCTGG + Intergenic
1045022048 8:98052400-98052422 GCCTCAGTCTGCGGAGTGCCTGG - Intergenic
1045235652 8:100350871-100350893 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
1046735936 8:117777222-117777244 GCCTCAGCCTGCCCAGTGCCTGG + Intergenic
1047457472 8:125029144-125029166 GCCTCAGCCTCCCGACTGGCTGG + Intronic
1048448810 8:134513310-134513332 GCCTCAGCCTCCCGAGTGCCTGG + Intronic
1048729853 8:137426121-137426143 GCCTCAGGCTCCCGACTAGCTGG - Intergenic
1048769152 8:137877015-137877037 GCCTCAGGCTGCCGAGTAGCTGG - Intergenic
1049093873 8:140536439-140536461 GCCTCGGCCTCCCGAGTGGCTGG + Intronic
1049168105 8:141139499-141139521 GCCTGGGGCTGCTGGCAGCCAGG - Intronic
1049481760 8:142827692-142827714 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
1049725826 8:144145565-144145587 GCCTCAGCCTCCCGACTGGCTGG - Intergenic
1049976148 9:862384-862406 GCCTCAGCCTGCCGCGTGCCTGG - Intronic
1050417464 9:5432610-5432632 GTCTCGGCCTGCCGAGTGCCAGG + Intronic
1050862193 9:10449152-10449174 GCCTCAGCCTGCCAAGTGCCTGG + Intronic
1051281194 9:15443054-15443076 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
1051594183 9:18807528-18807550 GCCTCAGGCTCCCGACTAGCTGG - Intronic
1051654038 9:19361111-19361133 GCCTCGGCCTCCCAACTGCTGGG + Intronic
1052236351 9:26215780-26215802 GCCTCAGCCTGCCGAGTACCTGG - Intergenic
1052258947 9:26492070-26492092 GCCTCGGCCTGCCCAGTGCCTGG + Intergenic
1052274682 9:26663770-26663792 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1052338493 9:27342579-27342601 GCCTCAGCCTGCAGAGTGCCTGG + Intronic
1053082062 9:35184591-35184613 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
1054883886 9:70174838-70174860 GCCTCAGGCTCCCGACTAGCTGG + Intronic
1055297861 9:74852604-74852626 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
1055580706 9:77703705-77703727 GCCTCAGCCTGCGGAGTGCCTGG - Intergenic
1056097666 9:83272216-83272238 GCCTCAGCCTGCCCAGTGCCTGG + Intronic
1056162987 9:83916280-83916302 GCCTCGGCCTCCCAAGTGCCAGG + Intronic
1056166657 9:83947626-83947648 GCCTCAGACTGCCAAGTGCCTGG + Intronic
1056229526 9:84528108-84528130 GCCTCAGCCTGCTGAGTGCCTGG - Intergenic
1057441831 9:95089038-95089060 GCCTCGGGGAGCCTCCTGCCTGG - Intergenic
1057630638 9:96716398-96716420 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
1057674982 9:97131168-97131190 GCCTCGGCCTGCTGAGTGCCTGG - Intergenic
1057716326 9:97498776-97498798 GCTTCAGCCTGCCGAGTGCCTGG - Intergenic
1057800125 9:98185862-98185884 TCCTGGGGCTGCCTGCTGCCAGG - Intronic
1057838132 9:98463748-98463770 GCCTCGGCCTGCCTAGTGCCTGG + Intronic
1058053295 9:100427271-100427293 GCCGCGGGCTCCCGAACGCCGGG - Intronic
1058244338 9:102604153-102604175 GCCTCGGCCTGCCGAGCGCCTGG - Intergenic
1058368441 9:104235939-104235961 GCCTGGGCCTGCCGAGTGCCTGG - Intergenic
1058375332 9:104316174-104316196 GCCTCAGCCTGCCCAGTGCCTGG + Intergenic
1058390555 9:104490462-104490484 GCCTCAGCCTGCAGAGTGCCTGG - Intergenic
1059438883 9:114291632-114291654 GCCTCGGCCTCCCGAGTGGCTGG - Intronic
1059880091 9:118678930-118678952 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
1060101049 9:120841462-120841484 GCCTCAGCCTGCCGAGTACCTGG - Intronic
1060784129 9:126435755-126435777 GCCTCTGGGTGCCGCCGGCCTGG - Intronic
1061108852 9:128552735-128552757 GCCCCGGGCAGCCGACCCCCGGG + Intronic
1061977163 9:134075272-134075294 GCCTCAGCCTGCCCAGTGCCTGG + Intergenic
1062520562 9:136955986-136956008 GCCTCGGGCTGGAGCCTGCTGGG + Intronic
1185579249 X:1197885-1197907 GCCTCAGCCTCCCGAGTGCCTGG - Intronic
1186099623 X:6141702-6141724 GCCTCAGCCTGCCGAGTACCTGG - Intronic
1186747126 X:12581743-12581765 GCCTCAGGCTGCAGGGTGCCTGG - Intronic
1186893068 X:13979105-13979127 GCCTCAGTCTCCCGAGTGCCTGG - Intergenic
1187366424 X:18669374-18669396 GCCTCAGGCTCCCGAGTGGCTGG - Intronic
1187859210 X:23665705-23665727 GCCTCGGCCTGCCGAGTAGCTGG - Intronic
1188086274 X:25905369-25905391 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1188214163 X:27457954-27457976 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1189342060 X:40211654-40211676 GCCTCAGCCTGCAGAGTGCCTGG - Intergenic
1189882286 X:45504762-45504784 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
1190158904 X:48016417-48016439 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
1190174601 X:48138682-48138704 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1190329916 X:49229562-49229584 GCCTCGGCCTCCCAAATGCCGGG + Intronic
1190331587 X:49239091-49239113 GCCTCAGCCTGCCGAGTGGCTGG + Intronic
1190793479 X:53721250-53721272 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1190848397 X:54215303-54215325 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
1190888496 X:54549582-54549604 GCCTCGGCCTCCCGAGTACCTGG - Intronic
1190906676 X:54735909-54735931 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1191679496 X:63826201-63826223 GCCTCAGCCTGCCGAGTGCCCGG - Intergenic
1191828556 X:65391878-65391900 GCCTCAGCCTGCCAAGTGCCTGG + Intronic
1191894332 X:65975927-65975949 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
1192324689 X:70122556-70122578 GCCTCAGCCTGCAGAGTGCCTGG + Intergenic
1192350292 X:70350368-70350390 GCCTCGGCCTGCCGAGTGCCTGG - Intronic
1192454016 X:71262625-71262647 GCCTCAGCCTCCCGAGTGCCTGG + Intergenic
1192500291 X:71645751-71645773 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
1192504781 X:71675299-71675321 GCCTTGGCCTGCCGAGTGCCTGG + Intergenic
1192530381 X:71877628-71877650 GCCTCAGCCTGCCGCGTGCCTGG - Intergenic
1192610107 X:72559184-72559206 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
1192663501 X:73067445-73067467 GCCTCGGCCTGCTGAGTGCCTGG + Intergenic
1192886063 X:75336189-75336211 GCCTCGGCCTGCCGAGTGCCTGG - Intergenic
1193890131 X:87033856-87033878 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
1194181062 X:90713221-90713243 GCCTCAGGCTGCCGAGTGCCTGG + Intergenic
1195119792 X:101738565-101738587 GCCTCGGCCTGCCGAGTGCCTGG + Intergenic
1195267132 X:103193368-103193390 GCCTCGGGCGCCCGAGTGGCTGG + Intergenic
1195888820 X:109670738-109670760 GCCTCAGCCTGCCGAGTGCCTGG + Intronic
1196716218 X:118813332-118813354 GCCTCAGTCTCCCGACTACCTGG - Intergenic
1198108782 X:133484534-133484556 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
1198182747 X:134225387-134225409 GCCTCGGGCTGCCAAATTGCTGG - Intergenic
1198189267 X:134286593-134286615 GCCTCAGCCTGCCGAGTGCCTGG - Intergenic
1198404651 X:136300396-136300418 GCCTCGGGCTCTGGCCTGCCCGG - Intergenic
1198600936 X:138283334-138283356 GCGTCAGCCTGCCGAGTGCCTGG - Intergenic
1199836903 X:151600147-151600169 GCCTCAGCCTGTCGAGTGCCTGG - Intronic
1199981563 X:152923404-152923426 GCCCCAGGCAGCAGACTGCCAGG + Intronic
1200324724 X:155224485-155224507 GCCTCAGCCTGCCGAGTGCCTGG - Intronic
1200422268 Y:2984436-2984458 GCCTCGGCCTCCCGACTAGCTGG - Intergenic
1200527682 Y:4295110-4295132 GCCTCAGGCTGCCGAGTGCCTGG + Intergenic
1201294920 Y:12454342-12454364 GCCTCGGCCTGCCCAGTGCCTGG - Intergenic
1201440380 Y:14001445-14001467 GCCTCAGCCTGCTGAGTGCCTGG - Intergenic
1201444191 Y:14041263-14041285 GCCTCAGCCTGCTGAGTGCCTGG + Intergenic
1201554203 Y:15251471-15251493 GCCTCAGCCTCCCAACTGCCTGG - Intergenic
1201948182 Y:19535312-19535334 GCCTCAGCCTGCCGAGTGCCTGG + Intergenic
1202028627 Y:20551137-20551159 GCCTCGGCCTGCCAAGTGCCTGG + Intergenic
1202343050 Y:23889320-23889342 GCCTCGGGCTCCCAAGTGTCTGG - Intergenic
1202527718 Y:25780765-25780787 GCCTCGGGCTCCCAAGTGTCTGG + Intergenic