ID: 916772276

View in Genome Browser
Species Human (GRCh38)
Location 1:167922511-167922533
Sequence GTGTAGGTAGGGAGAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 919
Summary {0: 1, 1: 0, 2: 10, 3: 81, 4: 827}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916772272_916772276 13 Left 916772272 1:167922475-167922497 CCACTATAAAGATATATTATTAC 0: 1
1: 1
2: 3
3: 26
4: 289
Right 916772276 1:167922511-167922533 GTGTAGGTAGGGAGAGAAGAAGG 0: 1
1: 0
2: 10
3: 81
4: 827

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916772276 Original CRISPR GTGTAGGTAGGGAGAGAAGA AGG Intronic
900090867 1:919857-919879 GTGTTGGCAGGGGGAGGAGAGGG + Intergenic
900427551 1:2587425-2587447 GGGGAGGCAGGGAGAGATGAGGG - Intronic
900767441 1:4514592-4514614 GTGCAGGTAGAGAGGGAACAGGG - Intergenic
901450065 1:9330651-9330673 GTTTGGGAAGGGAGAGAAAAAGG - Intronic
901559346 1:10057926-10057948 ATGTAGGTAAAGAGAGGAGAAGG + Intronic
901911797 1:12464709-12464731 GTGGGGGTGGGGAGAGAAGAGGG + Intronic
902081946 1:13827249-13827271 GGGGAGGTGGGGAGAGTAGATGG + Intergenic
902528264 1:17073610-17073632 GAGTGGGGAGGGAGAGAGGAGGG + Intronic
902632940 1:17716464-17716486 GTGAAGGGAGGCAGGGAAGAAGG + Intergenic
902681297 1:18045752-18045774 GTGGAGGCAGGCAGAGGAGAGGG + Intergenic
903302227 1:22387419-22387441 GTGAAGGAAGGGAGAGAGCAGGG - Intergenic
903739969 1:25553025-25553047 GGGTGGGTGGGGAGAGGAGAAGG - Intronic
903825118 1:26139056-26139078 GTGTTTGTAGGGCGTGAAGAGGG - Intergenic
903852326 1:26315580-26315602 GGGCGGGGAGGGAGAGAAGAGGG - Intronic
904354671 1:29931141-29931163 GTGGGGTGAGGGAGAGAAGATGG - Intergenic
904653644 1:32025710-32025732 GGGAAGGGAGGGAGGGAAGAAGG - Intronic
905187910 1:36209953-36209975 GTGGAGGTAGAGAGGGAAGTGGG + Intergenic
905408710 1:37753910-37753932 GGGTAGGCAGGGTGAGGAGAGGG + Intronic
905942912 1:41878662-41878684 GGGAAGGGAGGGAGAGAGGAAGG - Intronic
905998235 1:42400875-42400897 GTGTATGTAGGAAGAAAAGAGGG + Intronic
906659376 1:47571700-47571722 ATGGAGGGAGGGAGGGAAGAAGG - Intergenic
907458380 1:54590512-54590534 GGGAAGGTAGAGAGAGAAGGAGG + Intronic
907672148 1:56485414-56485436 GAGCAGGCAGGGACAGAAGAGGG + Intergenic
907728656 1:57044575-57044597 TTGTAGCTAGGGAATGAAGAAGG + Intronic
908210104 1:61891468-61891490 GTGTGAGTTGGGAGAGAAAAGGG + Intronic
908599420 1:65723077-65723099 GTGCAGGTAGGGAGAAGAGAAGG + Intergenic
909007692 1:70296760-70296782 CTGAAGGGAGGGATAGAAGAAGG + Intronic
909251922 1:73368822-73368844 ATGTAGAGAGGCAGAGAAGAAGG - Intergenic
910229067 1:84967823-84967845 GTGGAGGGAGGGAAGGAAGAAGG + Intronic
911477704 1:98393830-98393852 GTGTAGAAAGGGAGGGAAGAAGG + Intergenic
911693328 1:100860303-100860325 GTGTAGGGGGAGAGAGGAGAGGG + Intergenic
911736671 1:101343861-101343883 GTGAAGACACGGAGAGAAGATGG + Intergenic
912245699 1:107959839-107959861 GTGTATGTGGGGAGAGGGGAAGG - Intronic
912310805 1:108619128-108619150 GTTTAAGTAGAGAGAGAAAAGGG - Intronic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
912977144 1:114341159-114341181 ATGGAGGAAGGGAGTGAAGATGG - Intergenic
913511067 1:119563022-119563044 GAGCAGGTAGGGAGAGATAATGG - Intergenic
915266517 1:154722059-154722081 TTGTTTGTAGGGAGGGAAGAGGG - Intronic
915283593 1:154839005-154839027 GGGGAGGGAGGGAGAGCAGAAGG - Intronic
915327067 1:155086093-155086115 GTGCGGGTGGGGAGAGAGGAGGG - Intronic
915476673 1:156156597-156156619 GTGTGGGCTGGGAGTGAAGAGGG + Intronic
915746471 1:158163512-158163534 GGATAGGGAGAGAGAGAAGAAGG + Intergenic
916102002 1:161400635-161400657 GAGGAGGTAGGAAGAGGAGATGG + Intergenic
916508006 1:165445348-165445370 GTGTAGGTCAGGAGAGAGGCGGG + Intronic
916652611 1:166845470-166845492 GTGGAGGTGGGGAGAGAACAAGG + Intronic
916666613 1:166973520-166973542 TTGCAGGGAGTGAGAGAAGAAGG - Intronic
916772276 1:167922511-167922533 GTGTAGGTAGGGAGAGAAGAAGG + Intronic
917014432 1:170513300-170513322 AAGTAGGTAGGAAGAGAAAAAGG + Intergenic
917808432 1:178635057-178635079 GGGTGGCTTGGGAGAGAAGACGG - Intergenic
918095449 1:181330336-181330358 CTGGAGGCAGGCAGAGAAGAAGG - Intergenic
919043257 1:192419965-192419987 ATGTAGGTAGGGAGATATGAAGG + Intergenic
919988843 1:202694797-202694819 GTGTCGGAGGGGAGAGAAGGAGG - Intronic
920171715 1:204076084-204076106 GTGAAGGGAGGGAGAAAGGAAGG - Intronic
920301243 1:204990380-204990402 GTGCACATAGGGAGGGAAGAAGG - Intronic
920637454 1:207717904-207717926 GGGATGGTAAGGAGAGAAGAGGG + Intronic
920816000 1:209332631-209332653 GTGTTGGTAAGGAGGGCAGAAGG - Intergenic
920839548 1:209542730-209542752 GTGGTGGGAGGGAGAGAGGAGGG - Intergenic
920855204 1:209656231-209656253 GTGAGGGTGGGGAGAGGAGAAGG - Intergenic
921337021 1:214098393-214098415 GTGAAGGGTGGGAGGGAAGAGGG + Intergenic
921382668 1:214541089-214541111 TTATAGGAAGGCAGAGAAGATGG + Intronic
921672258 1:217938610-217938632 ATCTAGTTAGGGAAAGAAGATGG - Intergenic
922499857 1:226088780-226088802 GAGAATCTAGGGAGAGAAGAGGG - Intergenic
922595904 1:226812697-226812719 AGGGAGGGAGGGAGAGAAGAAGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923383716 1:233446626-233446648 CTGTAGGAAGGGACAGATGATGG + Intergenic
923404496 1:233646597-233646619 GTGCAGGGAGTGAGAGCAGATGG + Intronic
924113036 1:240718577-240718599 GTGAAGGGAGGGAGGGAGGAAGG - Intergenic
924152012 1:241139219-241139241 GAGAAGGGAGGGAGAGAGGAAGG - Intronic
924702073 1:246464191-246464213 GTGTCAGTAGAGAGAGAAAAAGG + Intronic
1063601677 10:7487345-7487367 GTGTGTGTGGTGAGAGAAGAAGG - Intergenic
1063636011 10:7783845-7783867 TTGGAGGTAGAAAGAGAAGAAGG - Intronic
1063953143 10:11242792-11242814 GTGTAGGGAGGGAGAAGAGGTGG + Intronic
1064364371 10:14693748-14693770 GGGTAGGTGGGGAGAAGAGATGG - Intronic
1064453695 10:15467215-15467237 GTGTGGCAGGGGAGAGAAGAGGG + Intergenic
1064710830 10:18122633-18122655 AGGTAGGGAGGGAGAGAGGAAGG - Intergenic
1065066851 10:21977080-21977102 TTGTACGTAGGTAGAGAACATGG + Intronic
1065129897 10:22609990-22610012 GGGAAGGTAGGGAGAGTGGATGG - Intronic
1065233282 10:23621090-23621112 GTGCATGTAGGGAGGGAAAAAGG + Intergenic
1065382391 10:25103158-25103180 GGGGGGGTTGGGAGAGAAGAGGG - Intergenic
1065690771 10:28331268-28331290 GTGTAGAAAGGAAGAGAAGAAGG - Intronic
1065780587 10:29162868-29162890 GTGTAGAGGAGGAGAGAAGAAGG + Intergenic
1066190008 10:33047479-33047501 GTTATGGAAGGGAGAGAAGAGGG + Intergenic
1066473305 10:35720188-35720210 GTATAGGTAGTGAGAGGAGAAGG + Intergenic
1067545270 10:47188237-47188259 GTGGAGGTGGGGAGAGAAGAGGG + Intergenic
1067923852 10:50487342-50487364 GTGGAGGGAGAGAGAGCAGATGG + Intronic
1067982766 10:51105480-51105502 GTGCACGAAGGGAGAAAAGAAGG + Intronic
1068561469 10:58519387-58519409 GTGGAAGTAGGCAAAGAAGAAGG + Intronic
1069252932 10:66294320-66294342 CTGTGGGTAGAGAGAGAAGAAGG + Intronic
1069455519 10:68550964-68550986 GAGCAGGAAGAGAGAGAAGATGG + Intergenic
1069547434 10:69338785-69338807 GTGTAGAGAGAGAGGGAAGAGGG + Intronic
1069765731 10:70857221-70857243 GGATAGGAAAGGAGAGAAGAAGG + Intronic
1070979077 10:80630096-80630118 GTGGAGGGAGAGAGGGAAGAAGG + Intronic
1071574630 10:86716434-86716456 GTGTAGGTGGGGACAGGTGAGGG - Exonic
1072275278 10:93816697-93816719 AGGCAGGTAGGGAGAGAAGGAGG + Intergenic
1072305590 10:94103726-94103748 GTGTGGGTAAGGATAGAAGGAGG - Intronic
1072502967 10:96037394-96037416 GAGCAGGGAGGGAGAGAAGGGGG - Intergenic
1072529693 10:96307295-96307317 GGGTTGGTAGGGAGAGATTATGG + Intronic
1072935437 10:99708044-99708066 GAGCAGGGAGGGAGAGAGGAGGG - Intronic
1073020433 10:100439036-100439058 GTGCAGTTAGGGGGTGAAGATGG - Intergenic
1073127960 10:101163668-101163690 TTGTATGTAGGGAGAAAGGAGGG - Intergenic
1073349721 10:102810961-102810983 ATGAAGGGAGGGAGGGAAGAAGG - Intronic
1073465397 10:103692312-103692334 GTGGAGGCAGGGAGAGAGGCGGG - Intronic
1074296710 10:112195946-112195968 GTGGGGTGAGGGAGAGAAGATGG - Intronic
1074370800 10:112899302-112899324 GTGTGGTTAGGGAGAGAACTGGG - Intergenic
1074568162 10:114600412-114600434 GTGTAGCTAGGGTAAGAAGGTGG - Intronic
1075212401 10:120502329-120502351 GGGGAGGCAGGGAGAGAAGGGGG + Intronic
1075380843 10:122017358-122017380 AGGGAGGGAGGGAGAGAAGATGG - Intronic
1076063349 10:127430055-127430077 CTGTAGGTGGGGAGGGGAGAGGG - Intronic
1076482221 10:130792228-130792250 GGGCAGGCAGGGAGGGAAGAAGG - Intergenic
1077020258 11:414114-414136 GGGAAGGTAGGCAGAGGAGAGGG - Intronic
1077020286 11:414198-414220 GGGAAGGTAGGCAGAGGAGAGGG - Intronic
1077020314 11:414282-414304 GGGAAGGTAGGCAGAGGAGAGGG - Intronic
1077268574 11:1664624-1664646 GAGGAGGCAGGGAGGGAAGAAGG + Intergenic
1077304511 11:1863075-1863097 GTGTATGTAGGGAGTGGGGACGG + Intronic
1077307031 11:1873063-1873085 GTGGAGGCAGGGAGAGATGGAGG + Intronic
1078108163 11:8371724-8371746 AGGGAGGGAGGGAGAGAAGAAGG - Intergenic
1079236912 11:18697705-18697727 GTGTAGGTTGGGGAAGAGGAAGG - Intronic
1079282859 11:19103576-19103598 GGGTAGGTAGAGAGTGGAGAGGG - Intergenic
1079327344 11:19505568-19505590 GAGTGGGGAGAGAGAGAAGAAGG + Intronic
1079407125 11:20156839-20156861 GTCGGGGTGGGGAGAGAAGAGGG + Intronic
1079488812 11:20964643-20964665 GTGTGGGTAGTGGAAGAAGAGGG - Intronic
1080021679 11:27567074-27567096 GTGTAGGTAAGGGGAGATAAAGG + Intergenic
1080393999 11:31873421-31873443 GTTGAAGGAGGGAGAGAAGAGGG + Intronic
1081655822 11:44856829-44856851 GTGTAGGGAGGGAGGGAGGGAGG - Intronic
1082760076 11:57118926-57118948 GGGGAGGGAGGGAGAGAAGGGGG + Intergenic
1082941562 11:58710516-58710538 GTGAATGCAGGGAGAGAAGTTGG + Intronic
1083007548 11:59361799-59361821 GTGGAGAAAGGGGGAGAAGAAGG - Intergenic
1083741763 11:64714951-64714973 GGGGAGGGAGGGAGAGAAGGAGG + Intronic
1083893399 11:65608098-65608120 GTGGGGGTTGGGAGAGAAAAGGG - Intronic
1084187756 11:67483846-67483868 TTGTAGGTTGGGGGAGAAGCGGG - Intronic
1084441853 11:69179119-69179141 GGGTAGGTGGGGAGAAGAGAAGG + Intergenic
1084470423 11:69356206-69356228 GAGTAGGGAGGGAAAGAAGGAGG + Intronic
1084497508 11:69513559-69513581 GAGAAGGGAGGGAGAGAAGGGGG - Intergenic
1084756192 11:71240374-71240396 GAGGGGCTAGGGAGAGAAGATGG - Intronic
1085051223 11:73381296-73381318 GTGCAGGTAGAGAGAGGAGTGGG + Intronic
1085129234 11:74023553-74023575 ATGAAGGAAGGCAGAGAAGATGG - Intronic
1085283721 11:75346714-75346736 GCCTGGGTATGGAGAGAAGAGGG - Intronic
1085447535 11:76610707-76610729 GTGTAGGGTGGGGGAGAAGTGGG + Intergenic
1085787600 11:79468766-79468788 GTGGAGGGAGGGAGGGAGGAGGG + Intergenic
1085957754 11:81421030-81421052 GGGTAGGAAGGGTGAGAAAAGGG - Intergenic
1086245888 11:84752428-84752450 GTGTAAGAAGAGAGAGTAGAAGG + Intronic
1086348741 11:85923972-85923994 GTGTAGGTGGTGAGTGAGGAGGG - Intergenic
1086887620 11:92223846-92223868 GTGTAGGTGGCGAGTGGAGAGGG + Intergenic
1086903995 11:92398165-92398187 GTGAAGACAGGGGGAGAAGATGG - Intronic
1087675088 11:101152507-101152529 GTGGGGGTAGGGAGAGCATAAGG - Intergenic
1088116028 11:106315895-106315917 GGGGAGGAAGGGAGAGAGGAAGG - Intergenic
1088321604 11:108560015-108560037 GTGTGGGTAGGGTGGGAAGGAGG - Intronic
1088354116 11:108923732-108923754 GAGTAGGTAGGGAATGAACATGG + Intronic
1088435763 11:109811503-109811525 GAATAGGAAGAGAGAGAAGAAGG + Intergenic
1088631454 11:111777731-111777753 GTGGAGGTATGTAGAAAAGAAGG - Intergenic
1088678147 11:112216214-112216236 TTGCAGGTTTGGAGAGAAGATGG + Exonic
1089130872 11:116210988-116211010 GTGAAGGTGGAGAGAGAACAGGG - Intergenic
1089191687 11:116658575-116658597 CCGTAAGTGGGGAGAGAAGAGGG - Intergenic
1089377685 11:118006087-118006109 GTGAAGGATGGGAGAGAAGGTGG - Intergenic
1089500862 11:118930380-118930402 GTGTGGGTGGGGAAAGAGGAGGG + Intronic
1089723385 11:120450913-120450935 GAGGATGTAGGGAAAGAAGAAGG - Intronic
1090208635 11:124899602-124899624 GAGTAGGGTGGGAGACAAGAAGG + Intergenic
1090237774 11:125162038-125162060 GTGCAGGTAGAGTGAGAAGAGGG + Intergenic
1090947845 11:131447753-131447775 TTGGGGGAAGGGAGAGAAGAGGG + Intronic
1091183434 11:133627716-133627738 GTAGAGACAGGGAGAGAAGAGGG - Intergenic
1091183443 11:133627758-133627780 GTAGAGACAGGGAGAGAAGAGGG - Intergenic
1091183452 11:133627800-133627822 GTAGAGACAGGGAGAGAAGAGGG - Intergenic
1091405205 12:204485-204507 GGGTAGGCAGGGAGAGACCATGG + Intronic
1091641062 12:2237888-2237910 GTGGAGCTAGGGAGGGCAGAGGG - Intronic
1091816415 12:3442398-3442420 GTGTAGGGAGGCAGAGAAAAGGG + Intronic
1091921465 12:4308191-4308213 GTGGCGGTAGTGAGAGAAGCAGG - Intergenic
1092090520 12:5800053-5800075 GTGAAGGAAGGGAGAGGAGTAGG + Intronic
1092283532 12:7115280-7115302 GTGCAGGGAGGAAGAGAAGCAGG + Intergenic
1092699515 12:11212337-11212359 CTGGAGGGAGGGAGAGAGGAGGG + Intergenic
1092720119 12:11433022-11433044 GTGTAAGCAGGGAGGGTAGAAGG + Intronic
1093249145 12:16778848-16778870 AGGTAGGTAGGAAGAGAGGAGGG - Intergenic
1093354009 12:18140775-18140797 GTGAAGGTAAGGAGTGAAGTCGG - Intronic
1094249558 12:28343483-28343505 GTGTAGAGAGGGAGAGAGAAAGG + Intronic
1094554905 12:31489288-31489310 ATGGAAGGAGGGAGAGAAGAGGG - Intronic
1094671994 12:32579482-32579504 GAGTAGGGAGGGAGAGGAGACGG - Intronic
1094738593 12:33262601-33262623 ATTTAGATAGGCAGAGAAGATGG + Intergenic
1095700930 12:45190103-45190125 AAGGAGGGAGGGAGAGAAGAAGG - Intergenic
1096186862 12:49587247-49587269 GTGTAGGGAGGGAGAGATGAGGG - Intronic
1096736409 12:53658906-53658928 GTGGATGTAGGAAGAGAAGGAGG + Intronic
1096863809 12:54549526-54549548 GAGAAGGGAGGGAGAGCAGAGGG + Exonic
1097262658 12:57728194-57728216 GTGGGGGTAGGGAAAGCAGAGGG + Intronic
1097880674 12:64683464-64683486 GTGTGGGGAGGTAGAGAAGTGGG + Intronic
1098448337 12:70590737-70590759 GGGTAGGGAAGGAGAGAGGATGG - Intronic
1098599438 12:72312966-72312988 GGGAAGGGAGGGAGAGAGGAAGG - Intronic
1098743771 12:74208495-74208517 GTGTAGAAAGGAATAGAAGAGGG + Intergenic
1098918818 12:76284186-76284208 AGGAAGGGAGGGAGAGAAGAAGG + Intergenic
1100014028 12:89987234-89987256 GTGTGGGTATGGAGAGACGAAGG + Intergenic
1100065684 12:90641393-90641415 GGGAAGGAAGGGAGGGAAGAAGG + Intergenic
1100550746 12:95644406-95644428 GGGAAGGAAGGGGGAGAAGAAGG - Intergenic
1100689247 12:97021983-97022005 ATGGAGGGAGGGAGAGAAGAAGG - Intergenic
1101085820 12:101234808-101234830 GTGAAGGTAGGGAAAGGAGGGGG - Intergenic
1101175793 12:102150550-102150572 TCGTAAGTAGGGAGTGAAGAGGG - Intronic
1101658811 12:106748073-106748095 GGGTAGGTAGGTAGGTAAGAAGG + Intronic
1101898338 12:108772170-108772192 AAGTGGGCAGGGAGAGAAGAGGG + Intergenic
1102212627 12:111138361-111138383 GTGGGGGTGGGGAGAGAGGAGGG + Intronic
1102287455 12:111670350-111670372 ATGTTGGATGGGAGAGAAGAAGG - Intronic
1102746226 12:115251310-115251332 GAGAAAGAAGGGAGAGAAGAAGG + Intergenic
1102746240 12:115251404-115251426 GAGAAAGAAGGGAGAGAAGAAGG + Intergenic
1102746255 12:115251498-115251520 GAGAAAGAAGGGAGAGAAGAAGG + Intergenic
1103012401 12:117467138-117467160 GAGTAGGGAGGGAGAGGTGACGG + Exonic
1103147584 12:118609028-118609050 AAGGAGGTAGGGGGAGAAGAAGG + Intergenic
1103366797 12:120389661-120389683 AGGTAGGAAGGGAGAGAGGAAGG + Intergenic
1103367023 12:120390801-120390823 AGGAAGGGAGGGAGAGAAGAAGG + Intergenic
1104134392 12:125923499-125923521 GTGAAGGGAGGGAGAGGAGAAGG + Intergenic
1104552038 12:129766089-129766111 GTGTAGGAAGGAATAGAAGAAGG - Intronic
1104833062 12:131767836-131767858 GTGGAGGGAGGGAGGGAGGAGGG + Intronic
1105038064 12:132940879-132940901 GGGGAGGGAGGGAGGGAAGAGGG - Intronic
1105805023 13:23947603-23947625 GGGTAGGCAGGGAGAGGGGAGGG - Intergenic
1106073833 13:26440398-26440420 GAGTGGGTAGGGAGAGATGTAGG + Intergenic
1106363036 13:29050102-29050124 GTGTAGGTAAGGAGAGAAAGGGG - Intronic
1107167066 13:37295145-37295167 GTGGAGGCAAGGAGACAAGACGG - Intergenic
1107410721 13:40156035-40156057 ATGGAGGGAGGGAGGGAAGAAGG + Intergenic
1107785229 13:43949148-43949170 ATATAGGTAGAGAGAAAAGAGGG + Intergenic
1107944843 13:45408948-45408970 GTGAGGATAGGCAGAGAAGAAGG - Exonic
1107950455 13:45456838-45456860 TTGGAGGTGGAGAGAGAAGATGG + Intergenic
1108618974 13:52162423-52162445 GTGAGGGTAGGGAGAGGGGATGG + Intergenic
1110739549 13:78978377-78978399 GTATAGGTGGGGAGGGGAGAGGG + Intergenic
1111708874 13:91785884-91785906 GTGGAAGTAGGGAGAGTAGTTGG - Intronic
1111786921 13:92799745-92799767 GTGTGTGAAGGGAGAGAAAAAGG - Intronic
1112966396 13:105201391-105201413 GCAAAGGAAGGGAGAGAAGAAGG + Intergenic
1113023207 13:105911528-105911550 GTATAGGTTGGGAAAGATGATGG + Intergenic
1113508909 13:110836165-110836187 AGGGAGGGAGGGAGAGAAGAAGG + Intergenic
1113709713 13:112455231-112455253 GTTTAGACAGGGAGAGAAGCTGG - Intergenic
1114534486 14:23414115-23414137 GGGTAGGCAGGGGGTGAAGATGG + Intronic
1114563014 14:23607077-23607099 GTGTAGGGAGGGAGAGAGTCAGG + Intergenic
1115112748 14:29843221-29843243 GTGAAGATACAGAGAGAAGATGG + Intronic
1115345137 14:32334915-32334937 GGGTAAGTAGGGAGAGAATGTGG + Intronic
1117139305 14:52770546-52770568 GTCTAGGTTGGGAGAAAGGAAGG - Intronic
1117261365 14:54037401-54037423 GTGGAGAGAGGGAGAGAAGCAGG - Intergenic
1117474805 14:56083306-56083328 AGGCAGGTAGGGAAAGAAGAAGG - Intergenic
1117971342 14:61253959-61253981 GAGGAGGGAGGGAGGGAAGAAGG - Intronic
1118447889 14:65868203-65868225 GGGTAGGGAGGGAGAGAGGGAGG + Intergenic
1118501275 14:66364832-66364854 ATGAAGGTAGGGAGATAAGTAGG + Intergenic
1118562155 14:67097540-67097562 ATGTAGGTGGGGAGAGACAAAGG - Intronic
1119415018 14:74464164-74464186 TTGTGGGTAGGGAGTGAAAAAGG + Intergenic
1120388127 14:83871230-83871252 GAGAAGGAAGGGGGAGAAGAAGG + Intergenic
1121513885 14:94536065-94536087 GTGTAGGTGGAGAGAGCAGGGGG + Intergenic
1121963898 14:98286824-98286846 GTGTAGGGAGGGAGAGGATCAGG + Intergenic
1122794227 14:104197936-104197958 GTGAATGGAGGGAGAGAGGAAGG - Intergenic
1124222890 15:27865245-27865267 GTGTAGGTGGGGAGAGCTGGCGG - Intronic
1125124992 15:36209776-36209798 GTGAAGATAGAGAGGGAAGAAGG + Intergenic
1125282995 15:38063031-38063053 GAGTGGGTAGGGAGAGAAGTGGG - Intergenic
1125883868 15:43214213-43214235 GAGTGGGGAGGAAGAGAAGATGG + Intronic
1126958152 15:53958167-53958189 GTATAGGTAGGGAGAAAAAAGGG - Intergenic
1127332266 15:57950808-57950830 GTGGAGGGAGGGAAGGAAGAAGG + Intergenic
1128010699 15:64293175-64293197 GTGTAGGTAGGAGGACATGATGG - Intronic
1128056711 15:64705002-64705024 GAGTAGGTAGGGATAGCTGAGGG - Intergenic
1128721731 15:69955297-69955319 GTGGGAGTAGGGAGAGGAGAAGG - Intergenic
1128729868 15:70013889-70013911 GTGTGGGCAGGGAGAGAGGGAGG + Intergenic
1128793433 15:70449211-70449233 GTGGAGGGAGGGAGAGATGGAGG + Intergenic
1128880495 15:71237781-71237803 GTGTAGGGAGGGAGACTGGATGG + Intronic
1129107552 15:73320040-73320062 GTGTGTGTAAGTAGAGAAGAGGG + Exonic
1129327591 15:74809369-74809391 GGGTAGGGAGGGAGAGCAGCTGG + Intergenic
1129933062 15:79428298-79428320 AGGAAGGAAGGGAGAGAAGAAGG - Intergenic
1130090333 15:80815536-80815558 AGGTAGGAAGGGAGAGAGGAAGG - Intronic
1130113487 15:80986270-80986292 GGGGAGATAGGGAGAGAGGATGG + Intronic
1130246709 15:82258012-82258034 GTGTGGGTTGGGAGGGAAGCTGG - Intronic
1130354510 15:83117422-83117444 GAGAAGGTAGAGAGAGAAAAGGG + Intronic
1130423142 15:83768392-83768414 ATGGAGGGAGGGAGAGAAGAAGG + Intronic
1130453956 15:84085334-84085356 GTGTGGGTTGGGAGGGAAGCTGG + Intergenic
1131065612 15:89433393-89433415 TTGGAGGGAGGGAGGGAAGAAGG - Intergenic
1131174627 15:90201886-90201908 GCGGAGGGAGGGAGAGGAGAGGG + Intronic
1131349498 15:91684878-91684900 TTGCAGGAAGGCAGAGAAGAAGG - Intergenic
1131905200 15:97134981-97135003 GGCTAGGTAGAGTGAGAAGAGGG - Intergenic
1132156133 15:99496361-99496383 GTGTGGGCAGGGAGGGCAGAAGG + Intergenic
1132535009 16:474439-474461 GAGTAAGTGGGGAGAGTAGAAGG + Intronic
1132574619 16:658731-658753 GTGGGGGCAGGGAGAGCAGAAGG + Intronic
1133467092 16:6038011-6038033 CTGTAGGAAGTTAGAGAAGATGG + Intronic
1133656711 16:7872049-7872071 GGGAAGGAAGGGAGGGAAGAAGG - Intergenic
1133663052 16:7937510-7937532 GGGGAGGAAGGGAGGGAAGAAGG - Intergenic
1133919486 16:10139324-10139346 GGGGAGGCAGGGAGAGGAGAGGG + Intronic
1134461712 16:14435209-14435231 TTGTAGGAAGGGAGAGGAGCAGG + Intergenic
1134634813 16:15784242-15784264 ATGATGGCAGGGAGAGAAGAGGG + Intronic
1134819757 16:17237393-17237415 GTGTGGGAAGGCAGAGGAGAGGG - Intronic
1135521189 16:23179666-23179688 GTGTGAGTAGGAAGAGACGAGGG + Intergenic
1135693237 16:24562518-24562540 GTTTAGATAGGTAGAGAAGAGGG + Intronic
1135853898 16:25988720-25988742 GTGGAGGGAGGGAGAGAATCAGG + Intronic
1135983753 16:27168588-27168610 GAGAAGGGAGGGAGGGAAGAAGG + Intergenic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136065167 16:27753797-27753819 GAGAAGGAAGGGAGAGAGGAAGG - Intronic
1136095863 16:27955963-27955985 AGGGAGGGAGGGAGAGAAGAAGG + Intronic
1136170054 16:28483679-28483701 AGGAAGGGAGGGAGAGAAGAAGG - Intronic
1136285578 16:29238501-29238523 ATGGAGGGAGGGAGGGAAGAAGG + Intergenic
1137219806 16:46437424-46437446 GTGTAGGAAGGAAGAAAGGAAGG - Intergenic
1137376161 16:47953711-47953733 GCGAAGTCAGGGAGAGAAGAAGG - Intergenic
1137746494 16:50824281-50824303 GTGTGGGGAGAGAGGGAAGAGGG + Intergenic
1137845008 16:51678432-51678454 GGGGAAGTTGGGAGAGAAGAAGG - Intergenic
1138008649 16:53358803-53358825 GTGCAGGTGGGGAGAGCAGAAGG + Intergenic
1138094647 16:54202313-54202335 CTGTAGGATGAGAGAGAAGAGGG - Intergenic
1138124374 16:54426767-54426789 GTGTTGGTGGAGAGAGAAGTGGG + Intergenic
1139004306 16:62551650-62551672 GTGAAGGGAAGGGGAGAAGAAGG - Intergenic
1139303137 16:65962068-65962090 AGGCAGGGAGGGAGAGAAGAAGG + Intergenic
1139665554 16:68453015-68453037 GTTTAGGCAGGAAGAGAAGTAGG + Intergenic
1139725198 16:68891924-68891946 GAGGAGGGAGGGAGAGAGGAAGG + Intronic
1139776511 16:69320050-69320072 CTGTGGGAAGGGTGAGAAGAGGG + Intronic
1140207478 16:72945624-72945646 ATCAAGGTAGGGAGAGAAGGTGG + Intronic
1140727000 16:77822529-77822551 TTGGAGGAGGGGAGAGAAGAAGG + Intronic
1141539524 16:84708938-84708960 GGGTAGTGAGGGAGAGAAGCAGG + Intronic
1141713925 16:85716320-85716342 GAGTAAGTTGGGGGAGAAGAGGG + Intronic
1142090911 16:88208653-88208675 ATGGAGGGAGGGAGGGAAGAAGG + Intergenic
1142251459 16:88993800-88993822 GAGGAGGGAGGGAGAGAAGAAGG - Intergenic
1142419382 16:89961100-89961122 GTGGTGGCAGGGAGAGAAGAGGG + Intronic
1142553514 17:755961-755983 GAGCAGGAAGGGAGGGAAGAGGG - Intergenic
1142889830 17:2936052-2936074 GTGGAGACAGGGAGAGGAGATGG - Intronic
1143031543 17:3970711-3970733 GTATAGCTTGAGAGAGAAGAGGG - Intergenic
1143854285 17:9837232-9837254 GTGGAGGTGGGGAGGGATGATGG - Intronic
1144192155 17:12856401-12856423 CTGTAGGGAAGCAGAGAAGAAGG - Intronic
1144365677 17:14542018-14542040 GGGTAGAGAGGGAGAGAGGAGGG - Intergenic
1144465529 17:15493771-15493793 GAGGAGGGAGGGAGAGAAGAGGG - Intronic
1144527554 17:16003108-16003130 CTGCAGGAAGGGGGAGAAGATGG + Intronic
1145958790 17:28873350-28873372 GTGGGGGTAGGGAGTGAGGAGGG - Intergenic
1146468786 17:33108218-33108240 GTGTAGGAAGACAGAGAAAATGG - Intronic
1146500182 17:33357275-33357297 GTTTAGCGAGGGAGAGAAGAAGG + Intronic
1148026495 17:44592723-44592745 AGGGAGGTAGGGAGGGAAGAAGG + Intergenic
1148380536 17:47193654-47193676 GTGTAGGGTGGGTGAGAAGAAGG - Intergenic
1148673838 17:49433359-49433381 GAGAAGGAAGGGAGGGAAGATGG + Intronic
1148697208 17:49567779-49567801 GTGGAGGTAGGGGGAGTGGAGGG - Intergenic
1149223576 17:54442610-54442632 ATACAGTTAGGGAGAGAAGATGG - Intergenic
1149534401 17:57421353-57421375 GTGTATGTAGGGCGTGAACATGG + Intronic
1149658113 17:58320707-58320729 GGGTAGGGAGAGAGGGAAGAGGG + Intronic
1149814835 17:59713517-59713539 GGGGAGATAGGGAGAGGAGAGGG + Intronic
1150293226 17:63993428-63993450 GAGGAGGGAGGGAGAGAAGGAGG + Intergenic
1150628610 17:66859846-66859868 GGGTGGAGAGGGAGAGAAGAGGG - Intronic
1150709003 17:67514044-67514066 GTGTAGGTCGAGATAGAAGAGGG + Intronic
1151003696 17:70408550-70408572 GAGAAGGAAGGCAGAGAAGATGG - Intergenic
1151150349 17:72079774-72079796 GTGGAGGTGGGGAGAGAAGGCGG + Intergenic
1151213891 17:72564326-72564348 GGGCAGGTATGGAGAGAAGAAGG + Intergenic
1152003235 17:77660436-77660458 AGGAAGGGAGGGAGAGAAGAAGG - Intergenic
1152103897 17:78317983-78318005 GGACAGGTAGGGAGAGAAAAAGG + Intergenic
1152222919 17:79079023-79079045 GTGCAGGCAGGGAGAGAGGCAGG - Intronic
1152336647 17:79702889-79702911 GAGGAGGTAGGGGGAGAAGGAGG - Intergenic
1152615399 17:81335667-81335689 GGGTAGGAAGGGAGAGGAGAAGG - Intergenic
1152897217 17:82919395-82919417 GTGTAGGTTGGTAGGGAAAACGG + Intronic
1153101322 18:1473219-1473241 GAGTGGGGAGGGAGAGAGGAAGG + Intergenic
1153235880 18:2986969-2986991 GTGGAGGTCGGGGGTGAAGAGGG + Intronic
1153597557 18:6743107-6743129 GAGAAGGAAGAGAGAGAAGAGGG + Intronic
1154009108 18:10560294-10560316 GGGCAGGGAGGGAGGGAAGATGG + Intergenic
1154223465 18:12478277-12478299 GTGTAGCTAGGGTGTGAAGCTGG + Intronic
1155762150 18:29582085-29582107 AGGAAGGAAGGGAGAGAAGAAGG + Intergenic
1156590005 18:38476096-38476118 CTGTATGGAGGTAGAGAAGATGG + Intergenic
1156597746 18:38566702-38566724 ATGGAGGAAGGGAGAGAGGAAGG + Intergenic
1156625303 18:38901070-38901092 GTGTGGGGAGAGAGAGAAGAAGG + Intergenic
1156883301 18:42106012-42106034 GGAGAGGTGGGGAGAGAAGATGG - Intergenic
1157084995 18:44570992-44571014 GTGGAGGAGGGGAGAGAGGAAGG + Intergenic
1157462995 18:47918239-47918261 GTATAAGTAGGAAGAAAAGAGGG + Intronic
1157566041 18:48679965-48679987 CTGTATGTAGGGAGAGCAGTTGG + Intronic
1157778809 18:50419570-50419592 GAGTAGGGAGGGTGGGAAGAGGG - Intergenic
1158264233 18:55642078-55642100 TTGTAAGTAGGGAGAGTAAAAGG + Intronic
1158517082 18:58139603-58139625 TGGTAGTTAGGGACAGAAGAAGG + Intronic
1158594077 18:58801357-58801379 TTTTAGGTTGGGAAAGAAGAGGG + Intergenic
1159111441 18:64061247-64061269 GGGCAGGTAGGGAGAGAAAGAGG + Intergenic
1159138609 18:64365969-64365991 GTGGAGGTGGGGAGGGTAGAAGG + Intergenic
1159893955 18:73979120-73979142 GTGTAAGAAGGGAGAGAATAAGG - Intergenic
1159966743 18:74602294-74602316 GAGAAGGTAGAGAGAGATGATGG + Intronic
1159987291 18:74858149-74858171 GGGAAGGGAGGGAGAGAGGAAGG - Intronic
1159994998 18:74955829-74955851 GTGTGTGCAGGGAGAGAGGATGG - Intronic
1160178301 18:76613499-76613521 GTGGAGGGAGGTAGAGCAGAAGG + Intergenic
1161584750 19:5099317-5099339 GTGGCGGTAGTGAGACAAGACGG + Intronic
1161684810 19:5697502-5697524 GAGGAGGGGGGGAGAGAAGAGGG + Intronic
1161814327 19:6490314-6490336 AGGGAGGGAGGGAGAGAAGAGGG - Intergenic
1162028472 19:7907263-7907285 GTGTTGGGAGAGAGAGTAGATGG + Intronic
1162104713 19:8363493-8363515 AGGTAGGGAGGGAGGGAAGAAGG - Intronic
1162458354 19:10799353-10799375 GGGGAGGGAGGGAGGGAAGAAGG - Intronic
1162515948 19:11147759-11147781 CTGTAGGTAGGGACATAAAATGG - Intronic
1162853449 19:13449809-13449831 GTCTAGGGAGGGAGAAAACAGGG + Intronic
1162865321 19:13541630-13541652 ATGGAGGGAGGGAGGGAAGAAGG + Intronic
1163054599 19:14708849-14708871 GTGAAGATATAGAGAGAAGATGG - Intronic
1163156830 19:15444245-15444267 GTGGAGGTAGGGTGGGGAGAGGG + Intronic
1164581704 19:29438980-29439002 ATGTAGGGAGAGAGAGAAGAAGG + Intergenic
1164588788 19:29494787-29494809 GGGGAGGGAGGGAAAGAAGAAGG + Intergenic
1164588798 19:29494822-29494844 GAGGAGGGAGGGAAAGAAGAAGG + Intergenic
1164794426 19:31014701-31014723 AAGGAGGGAGGGAGAGAAGAAGG + Intergenic
1164869821 19:31633405-31633427 GAGACGGGAGGGAGAGAAGATGG + Intergenic
1165489725 19:36116011-36116033 GAGGAGGCAGGGTGAGAAGAAGG - Intronic
1165819120 19:38663412-38663434 GTGTAGCTGGGGAGAGAGCAAGG + Intronic
1166124140 19:40703632-40703654 GAGAAGGGAGGGAGAGAAGGTGG + Intronic
1166283293 19:41809198-41809220 CTGGAGGGAGGGAGAGAAGGAGG + Intronic
1166900364 19:46056900-46056922 GGGTGTATAGGGAGAGAAGAGGG - Intronic
1166981577 19:46634836-46634858 GTGGAGGGAGGGACAGATGAAGG + Intergenic
1168075477 19:53978865-53978887 GGGTAGGGAGGGAGGGAAGGAGG + Intronic
925363413 2:3295220-3295242 GTGTATGTGTGGAGAGAGGACGG - Intronic
926796383 2:16622516-16622538 GGGTAGGTAGGGAAAGGAGCTGG + Intronic
926893241 2:17657185-17657207 CTGTAGGCAGGGAGAGATCAGGG + Intergenic
927445795 2:23160471-23160493 GAGTAATTAGGGAGAAAAGATGG + Intergenic
927605266 2:24481199-24481221 CTGTTGGTGGGGAGAGAGGATGG - Intergenic
928235503 2:29535974-29535996 GTGTAAATCGGGAGAGAGGAAGG - Intronic
928373793 2:30759218-30759240 AAGGAGGGAGGGAGAGAAGAGGG - Intronic
928406949 2:31022181-31022203 GGGGAGGAAGGGAGGGAAGAAGG + Intronic
928692627 2:33816701-33816723 ATGGAGGGAGGGAGAGAAGGAGG - Intergenic
928926537 2:36585505-36585527 GGGTGGGGAGGGAGAGCAGAAGG + Intronic
929171129 2:38934476-38934498 ATGGAGGGAGGGAGAGAAGCGGG - Intronic
929171138 2:38934503-38934525 GGGGAGGGAGGGAGAGAAGGGGG - Intronic
929171146 2:38934522-38934544 GGGGAGGGAGGGAGAGAAGGGGG - Intronic
929171161 2:38934560-38934582 GGGGAGGGAGGGAGAGAAGCGGG - Intronic
929171172 2:38934590-38934612 GGGGAGGGAGGGAGAGAAGCGGG - Intronic
929171183 2:38934620-38934642 GGGGAGGGAGGGAGAGAAGCGGG - Intronic
929171194 2:38934650-38934672 GGGGAGGGAGGGAGAGAAGCGGG - Intronic
929444769 2:41993026-41993048 GTGCGGGGAGGGAGAAAAGATGG - Intergenic
929853430 2:45613931-45613953 GTGTAGGTGGAGGGAGAAGTTGG - Intergenic
929873414 2:45776687-45776709 GTGGAGGGAGGGGGAGAAGCAGG - Intronic
929897034 2:45969580-45969602 GTGGAGAAGGGGAGAGAAGAGGG - Intronic
930245802 2:48982247-48982269 GTGTAGGTAAGAAGAGAAGATGG + Intronic
930576086 2:53150517-53150539 GTGTGGGTGGGGAGAGAGGGAGG + Intergenic
931018010 2:58008519-58008541 GTGAAGGAAGGAAGAAAAGAAGG + Intronic
931450201 2:62362224-62362246 GAGCAGGTAGGAAGAGAAGATGG - Intergenic
931635203 2:64334328-64334350 GGGTGGGCAGGGAAAGAAGAGGG - Intergenic
931683079 2:64768734-64768756 GTGTAGGGAGAGAGGGAAGGAGG - Intergenic
932049642 2:68385781-68385803 GTGAAGGAGGTGAGAGAAGAGGG - Intronic
932142012 2:69287392-69287414 ATGTGGGTAGGGAGGGAACAGGG - Intergenic
932165374 2:69500872-69500894 GGGTTGGTAGGGTGAGTAGATGG + Intronic
932213790 2:69953173-69953195 GTTTAGGCAGGTACAGAAGATGG - Intergenic
932313855 2:70767204-70767226 GGGGAGGCAGGGAGAGGAGAGGG + Intronic
932377752 2:71253082-71253104 GTATAGGTAAGGAGAGGAGAGGG + Intergenic
932852750 2:75201961-75201983 ATGGAGGCAGGGAGAGAAGGCGG - Intergenic
932924311 2:75954283-75954305 GTGGAGGAAGGGAGGAAAGAAGG - Intergenic
934074556 2:88416628-88416650 GTGGAGGTAGGGAGAAGGGAAGG + Intergenic
934106352 2:88698589-88698611 GGGTAGGGAGGTAGAGGAGAGGG + Intronic
934504641 2:94880686-94880708 GGGTGGGCAGGGAGAGCAGAGGG - Intergenic
935210226 2:100933294-100933316 AGGTAGGTAGAGAGAGGAGAAGG + Intronic
935979548 2:108613487-108613509 GTGTAGGGAGGGAGGGCAGAAGG - Intronic
935998343 2:108798798-108798820 GTGTAGGTGTGGAGAGGAGGAGG - Intronic
936283142 2:111160139-111160161 GTGCAGGTGGAGAGAGAAGCTGG - Intronic
936627185 2:114161017-114161039 GAGAAGGAGGGGAGAGAAGAGGG - Intergenic
936908422 2:117564837-117564859 GAGTATGGAGGGTGAGAAGAGGG - Intergenic
936912272 2:117605110-117605132 GTGTAAGAATGGAGAGAAGGGGG + Intergenic
937096537 2:119239205-119239227 GTGTAGAGAGGGAAAGAGGAAGG - Intronic
937222642 2:120350618-120350640 GGGGAGGGAGGGAGAGAAGAGGG + Exonic
937226481 2:120373267-120373289 CTCTGGGGAGGGAGAGAAGAAGG + Intergenic
937394082 2:121519385-121519407 CTGGAGGCAGGGACAGAAGAGGG + Intronic
937593831 2:123648662-123648684 CTATAGGTAGGAAGAGCAGATGG + Intergenic
937855125 2:126666690-126666712 GTGTAGGGAGGGAGGGGAGGGGG - Intronic
938926132 2:136044127-136044149 GAGTAGGGAGGGAGTGAAGGGGG + Intergenic
939417373 2:141916767-141916789 GAGTGGGAAGGGAGAGAGGACGG + Intronic
939981603 2:148789096-148789118 GGGAAGGTAGGGGGAGAACAAGG + Intergenic
939987899 2:148850120-148850142 GACTAGGCAGTGAGAGAAGAGGG + Intergenic
940039920 2:149349328-149349350 CTGTAGGTACAGAGAGAAGTAGG + Intronic
940336977 2:152539436-152539458 GTGGAGGTAGAAAGAGGAGATGG + Intronic
940697881 2:157002684-157002706 GTGAATGTAGATAGAGAAGAGGG + Intergenic
940865516 2:158813861-158813883 GTGGAGGTAGGAAAAGAAAAAGG - Intronic
941102127 2:161308219-161308241 GCAGAGGTAGGGAGAGAAAAAGG + Exonic
941268960 2:163401277-163401299 GTGTTGGTATGGAGGGTAGAAGG - Intergenic
941684082 2:168429884-168429906 TTGTAGGTAGGGATAGGAGAAGG - Intergenic
942194820 2:173507039-173507061 TGGCAGGGAGGGAGAGAAGATGG + Intergenic
942342312 2:174961196-174961218 GGGAAGGGAGGGAGGGAAGAAGG + Intronic
942349295 2:175036216-175036238 GAGGAGGGAAGGAGAGAAGATGG + Intergenic
942919344 2:181352346-181352368 GTGGAGGGAGGGTGAGAAGCGGG - Intergenic
943388415 2:187230935-187230957 GTGATGGAAAGGAGAGAAGATGG - Intergenic
943794959 2:191980693-191980715 CTGGAGGTCTGGAGAGAAGAGGG - Intronic
944529072 2:200649794-200649816 GTGCAAGGAGGAAGAGAAGAAGG + Intronic
944562732 2:200957016-200957038 GTGGAGGGAGGGAGAGCATAAGG + Intronic
945471275 2:210230075-210230097 GTGGAGGTGGGGAGAGTAAATGG + Intergenic
945624692 2:212188262-212188284 GAAGAGGGAGGGAGAGAAGAGGG - Intronic
945624696 2:212188277-212188299 GAAGAGGGAGGGAGAGAAGAGGG - Intronic
945935182 2:215896754-215896776 GTGAAGTTAGAGTGAGAAGATGG - Intergenic
947464349 2:230327692-230327714 GTGAAGGTAGAGAGGGCAGAGGG - Intronic
947572765 2:231249036-231249058 AGGTGAGTAGGGAGAGAAGAAGG + Intronic
948540685 2:238689830-238689852 GTGTAGGAAGGGAGGGAGGAGGG + Intergenic
948545377 2:238724903-238724925 GTGTAGGCAGGAAGAGCAGCAGG + Intergenic
948557101 2:238820586-238820608 GCGGAGGGAGGGAGAGAGGAAGG + Intergenic
948582639 2:238998287-238998309 ATGAAGGAAGGGAGAGAAGGAGG - Intergenic
948786703 2:240356387-240356409 GTGTGGGAAGGGTGTGAAGAGGG + Intergenic
948851672 2:240711349-240711371 TGGTTGGTAGGGAGAGGAGAAGG + Intergenic
1168743144 20:212126-212148 CTGTAGGTAGAGAAAGAAGGAGG + Intergenic
1168779926 20:480272-480294 GTGTGTGTAGGGAGAGAAAGGGG + Intronic
1169092166 20:2867589-2867611 GGCTAGATAGGGAGAGCAGAGGG - Intronic
1169308359 20:4514443-4514465 GTGCATGTAGGAAGAGATGAGGG + Intergenic
1169544300 20:6635162-6635184 ATGGAGGGAGGGAGAGAGGAAGG - Intergenic
1169549452 20:6687341-6687363 GTGGAGGTAGGTAGGGAAAATGG + Intergenic
1170869082 20:20188170-20188192 GTGGAGGTAGAGTTAGAAGATGG + Intronic
1171151924 20:22834951-22834973 GTGTAGGGAGGGAGAGAAGGAGG - Intergenic
1172017595 20:31887277-31887299 GGGGAGGGAGGGAGAGAAGTTGG - Intronic
1172055310 20:32150597-32150619 GTGGAGGGAGGGAGGGAGGAAGG - Intronic
1172114001 20:32563103-32563125 GTGGAGGCAGGGAGAGTGGAGGG + Intronic
1172321763 20:34000372-34000394 GGGGAGGTAGGGACAGAAAAAGG + Intronic
1172650687 20:36499708-36499730 GCGGAGGGAGGGAGAGGAGAGGG - Intronic
1172970761 20:38871551-38871573 GTGTAGGGAGGTAGAGAGTAAGG + Intronic
1173313087 20:41917711-41917733 GGGAAGGGAGGGGGAGAAGAGGG + Intergenic
1173788249 20:45810964-45810986 TTGGAGGCAGGGAGAGGAGAAGG - Intronic
1173854486 20:46241256-46241278 ATCTGGGTAGGCAGAGAAGAAGG + Exonic
1174655359 20:52167490-52167512 AGGAAGGGAGGGAGAGAAGAAGG - Intronic
1174674956 20:52344791-52344813 GGGTAGGTTGAGAGAGAACATGG + Intergenic
1175273912 20:57754499-57754521 AGGAAGGGAGGGAGAGAAGAAGG - Intergenic
1175473652 20:59253030-59253052 TTGTGGGAAGGAAGAGAAGAAGG + Exonic
1175487372 20:59355682-59355704 GAGGAGGGAGGGAGAGAGGAGGG - Intergenic
1177073542 21:16542968-16542990 AGGGAGGGAGGGAGAGAAGAAGG + Intergenic
1177898861 21:26888609-26888631 GTGTACTTAGGAAGAGAAAAAGG + Intergenic
1178769239 21:35487249-35487271 GAGTGGGTAGGGAGGGCAGAAGG + Intronic
1178791556 21:35704989-35705011 GGGGAGGGAGGGAGGGAAGAAGG + Intronic
1179006549 21:37520279-37520301 ATGTAGATAGGAAGAGATGAGGG + Intergenic
1179218853 21:39389095-39389117 GTGAAGGAAGGAAGGGAAGAAGG - Intronic
1179226588 21:39459179-39459201 AGGTAGGTAGGGAGAGAGGGAGG - Intronic
1179351956 21:40620406-40620428 AGGGAGGGAGGGAGAGAAGAGGG + Intronic
1179714751 21:43280916-43280938 GTGGAGGTAGGGGGAGGGGAGGG + Intergenic
1179714772 21:43280959-43280981 GTGGAGGTAGGGGGAGGGGAGGG + Intergenic
1181042921 22:20201376-20201398 GGGTAGGGAGGGAGAGAGGGAGG - Intergenic
1181153643 22:20903209-20903231 GAAAAGGAAGGGAGAGAAGAGGG + Intergenic
1181523062 22:23460282-23460304 GTGTAGGGAGGGAGGGGAGAGGG + Intergenic
1181855950 22:25781715-25781737 TTGTCTGCAGGGAGAGAAGAGGG - Exonic
1181961013 22:26621912-26621934 TTATAGGCAGGGAGGGAAGAGGG - Intergenic
1182341054 22:29621054-29621076 AGGTAGGTAGTGAGAGAATAGGG + Intronic
1182709025 22:32308941-32308963 GTCTAGGTAGGTAGGTAAGAAGG - Intergenic
1182977637 22:34638226-34638248 CTGTAGGTGGGGAGTGCAGAGGG - Intergenic
1183085827 22:35486405-35486427 GTGGAGGTAAGGAGGGGAGAGGG - Intergenic
1183204311 22:36408089-36408111 GTGGAGGAGGGGAGAGGAGATGG - Intergenic
1183209726 22:36443396-36443418 GTGAAGGGAGGGAGGGAGGAAGG - Intergenic
1183266618 22:36830487-36830509 GTGTAGGCAGGGAGAGAGGAGGG - Intergenic
1183509611 22:38227179-38227201 GTGGAGGAAGGGAGGGAGGAAGG + Intronic
1183987861 22:41579153-41579175 GAGTAGGAAGGGCGAGGAGACGG + Intronic
1184396547 22:44245315-44245337 GTCTAGGTAGGTAGGTAAGAAGG - Exonic
1185375800 22:50482126-50482148 GTGTAGGGAGGCAGAGAAAGAGG - Intronic
949535014 3:4988848-4988870 CTGGAGGGAGGGAGAGAAGGAGG + Intergenic
949681960 3:6524265-6524287 GTGGAGGTAGGGATGGAAGTAGG + Intergenic
950096116 3:10331678-10331700 GGGTAGGCAGGGAGGGGAGATGG - Intronic
950634678 3:14306555-14306577 CTGCAGGGAGGGAGAGTAGAAGG - Intergenic
951191155 3:19773049-19773071 ATGTAGGGAGGGAAAGAAGAAGG + Intergenic
951355067 3:21656220-21656242 GTGTGGGTAGGCAGATCAGATGG + Intronic
951535116 3:23733542-23733564 GTGAAAGTAGGGAGGAAAGAAGG + Intergenic
951537209 3:23751025-23751047 GTGTGGGTAGGGAGAGAGGAAGG - Intergenic
951919153 3:27834552-27834574 GTGTGGGGAGGGAGAGAATCAGG - Intergenic
952155769 3:30641910-30641932 ATGTAGGGAGAGAGAGAGGAAGG - Intronic
952213920 3:31256594-31256616 ATTTAGGTAGGGAGAGAAGGGGG + Intergenic
952218333 3:31300094-31300116 GTGTAAGGAGGAAGAGAAGAAGG - Intergenic
952740742 3:36731798-36731820 GTGAGGGGAGGGAGAAAAGAAGG - Intronic
952744486 3:36764386-36764408 GCGGCGGGAGGGAGAGAAGAGGG - Intergenic
953108378 3:39908195-39908217 GGGAAGGAAGGGAGAGCAGAGGG + Intronic
953439268 3:42904167-42904189 GGGAAGGGAGGGAGAGAGGAAGG - Intronic
953856013 3:46499561-46499583 CAGGAGGTAGAGAGAGAAGAAGG - Intronic
953931011 3:47005653-47005675 GTGTAGGGATGGAGAGCAGATGG + Intronic
954330193 3:49885694-49885716 GTGTAGGGAGGAAGAGGAGGAGG + Intergenic
954437477 3:50503693-50503715 AGGGAGGGAGGGAGAGAAGAGGG - Intronic
954573548 3:51662372-51662394 GAGTGGCCAGGGAGAGAAGAAGG - Intronic
954697916 3:52437276-52437298 GTGATGGAAGAGAGAGAAGAGGG - Intronic
954773017 3:52990672-52990694 GGAAAGGGAGGGAGAGAAGAAGG + Intronic
955342478 3:58135814-58135836 TTTTTGGTAGGGAGAGTAGAGGG - Intronic
955446890 3:59021482-59021504 GTGTAGGCAGGGTGGGCAGATGG - Intronic
955522061 3:59784568-59784590 GTGTAGGTAGGCACAGAAGGTGG + Intronic
955874653 3:63476399-63476421 AGGGAGGGAGGGAGAGAAGAAGG + Intronic
956231580 3:67022592-67022614 GTGTAGGGTGGGATATAAGAAGG + Intergenic
956305606 3:67821086-67821108 ATGGAGGGAGGGAGGGAAGAAGG + Intergenic
956413492 3:69003107-69003129 ATGTAGGTAGGGAGAGAGAGGGG - Intronic
956732407 3:72208602-72208624 AGGGAGGGAGGGAGAGAAGAAGG + Intergenic
957167353 3:76692039-76692061 TTGAAGGTTGGGAGAGATGAAGG + Intronic
957449644 3:80362474-80362496 AGGTAGGAAGGGAGAAAAGAAGG - Intergenic
957831579 3:85528563-85528585 GTGTAGCTATGGTTAGAAGAGGG - Intronic
958491003 3:94773086-94773108 GTGTAGGGAAAGAGAGAATATGG + Intergenic
958537168 3:95418558-95418580 GTGTGGGTAGGGAGGGAACCCGG + Intergenic
958688859 3:97434884-97434906 GGGTAGGGAGGGTGGGAAGAAGG - Intronic
958721686 3:97851611-97851633 AGGTAGGGAGGGAGAGAGGAAGG + Intronic
958728758 3:97937560-97937582 ATGTAGATTGGGAGAGAAGGTGG - Intronic
958801023 3:98756028-98756050 GTGTATGTGTGGAGAGAAGCTGG + Intronic
959544242 3:107575229-107575251 GTGAAGGTAGAGAGAGGAAAAGG - Intronic
959958719 3:112271169-112271191 ATGTAGGGAGGAAGAGAATAGGG + Intronic
960246640 3:115407096-115407118 GTGTATGAAGGATGAGAAGATGG + Intergenic
960684212 3:120280698-120280720 GTGTGAGTAAGGAGAGAAGGTGG - Intronic
961479757 3:127172123-127172145 GTATGGGGAGGGAGAGCAGAGGG + Intergenic
961499438 3:127321368-127321390 GTGGAGGAAGGCGGAGAAGACGG - Intergenic
961521821 3:127471427-127471449 GGGGAGGCAGGGAGAGAAAAGGG + Intergenic
961705047 3:128778036-128778058 GTGTCAGGAGGGAAAGAAGATGG + Intronic
961999939 3:131285282-131285304 GAGTGGGTAGAGAGAGAAGGTGG + Intronic
962330764 3:134475945-134475967 GGGGAGGGTGGGAGAGAAGAGGG - Intergenic
962421751 3:135235002-135235024 TTCCAGGTATGGAGAGAAGAGGG - Intronic
962967790 3:140370478-140370500 AGGGAGGGAGGGAGAGAAGAAGG + Intronic
963044135 3:141090082-141090104 GAGAAGAGAGGGAGAGAAGAGGG - Intronic
963781836 3:149494212-149494234 GAGTTTGAAGGGAGAGAAGAAGG + Intronic
963819873 3:149878294-149878316 GTCTAGGTAAGGAGGAAAGATGG + Intronic
964755064 3:160085148-160085170 GTGCAGGTAAGGTGAGGAGAAGG - Intergenic
965514545 3:169606788-169606810 CTGCAGGAAGGGAGAAAAGAGGG + Intronic
965678961 3:171230831-171230853 GGGAAGGAAGGGAGAGAGGAAGG - Intronic
966142232 3:176769506-176769528 GAGGAGGGAGGGAGAGAGGAAGG + Intergenic
966626238 3:182020176-182020198 GAGTATGGAGGTAGAGAAGAAGG - Intergenic
966941866 3:184752991-184753013 GAGAAGGTGGTGAGAGAAGAAGG + Intergenic
967048908 3:185763976-185763998 GTGAGGGCAGAGAGAGAAGAGGG + Intronic
967568494 3:190999701-190999723 GTGAAGGGAGGGAGGGAGGAAGG + Intergenic
968107869 3:196015126-196015148 GTCTAGGTAAGGAGAGGAGATGG - Intergenic
968395698 4:234658-234680 GTGCATGCAGGGAGATAAGATGG - Intergenic
968399937 4:285314-285336 GTGTGTGCAGGGAGATAAGATGG + Intronic
968616147 4:1578767-1578789 GCGGAGGAGGGGAGAGAAGAGGG + Intergenic
968631979 4:1656525-1656547 GTGTAGGCAGGGAGAGCGGCCGG + Intronic
968663692 4:1809621-1809643 GCAGAGGTAGGGAGAGCAGAGGG - Intergenic
969493342 4:7512363-7512385 ATGGAGGGAGGGAGGGAAGAAGG + Intronic
969646307 4:8431483-8431505 GGGGAGGTAGGAAGAGAGGAAGG + Intronic
970014488 4:11498310-11498332 GTGGAGGGAGGTAGAGAAGTAGG + Intergenic
970064776 4:12080362-12080384 GTTAAGGTAGGAAGAGCAGATGG - Intergenic
970110258 4:12629820-12629842 GTGGAGGGAGAGAGTGAAGAGGG + Intergenic
970234292 4:13943312-13943334 GTGTAGTTGGGGAAAGGAGATGG + Intergenic
970479304 4:16457674-16457696 GGGGAGGGAGGGAGAGAGGAAGG - Intergenic
970522382 4:16898778-16898800 ATGGAGGAAGGGAGGGAAGAAGG + Exonic
971149994 4:24021515-24021537 GGGTAGGGAGGGTGAGAAGTGGG + Intergenic
971394416 4:26215143-26215165 ATGGAGGGAGGGAGAGAAGGAGG + Intronic
973929809 4:55780861-55780883 GAGGAGGGAGGGAGAGAGGAAGG + Intergenic
974503257 4:62732952-62732974 GTGTAGGGGGGGAGCCAAGATGG - Intergenic
974522186 4:62996058-62996080 AGGAAGGAAGGGAGAGAAGAAGG + Intergenic
974583015 4:63831554-63831576 GTGTAGGTAGTTCAAGAAGAAGG - Intergenic
975327418 4:73075455-73075477 GTAAAGGTAAGGAGAGAAAAAGG + Exonic
976047526 4:80968855-80968877 GTGGGGGGAAGGAGAGAAGAGGG - Intergenic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976633809 4:87267051-87267073 GTGAATGTAGGTAGACAAGACGG - Intergenic
977419408 4:96778953-96778975 GTAAAGACAGGGAGAGAAGATGG + Intergenic
978580752 4:110229108-110229130 GTAAAGGCAGGGGGAGAAGATGG - Intergenic
978619292 4:110622776-110622798 GGGGAGGGAGGGAGAGAAGAAGG - Exonic
979429109 4:120605438-120605460 GGGAAGGGAAGGAGAGAAGAAGG + Intergenic
979474463 4:121138850-121138872 GAGGGGGTAGGGAGAGATGATGG - Intronic
979821626 4:125180563-125180585 GGGGAGGGAGGGAGAGAGGAAGG + Intergenic
979838192 4:125401015-125401037 GTGTAGAAAGGCAGAGAGGATGG + Intronic
980607704 4:135113675-135113697 GTGCATCTAGGGTGAGAAGAGGG + Intergenic
980627177 4:135388817-135388839 GGGTATGCAGGGAGAGGAGAGGG - Intergenic
981205595 4:142035882-142035904 GGGTAGGTAGGGAGAGGGGCAGG + Intronic
981214225 4:142145216-142145238 GGGTAGGTAGGCAGATAGGAAGG - Intronic
981342496 4:143637906-143637928 TGGTGGGTGGGGAGAGAAGAAGG + Intronic
981362402 4:143862865-143862887 GGTTGGGTAGAGAGAGAAGATGG + Intergenic
981373132 4:143983633-143983655 GGTTGGGTAGAGAGAGAAGATGG + Intergenic
981382227 4:144086908-144086930 GGTTGGGTAGAGAGAGAAGATGG + Intergenic
982183941 4:152777637-152777659 GAGAAGGGAGGGAGACAAGAAGG + Intronic
982190214 4:152846203-152846225 GAGTAGGGAGGGAGAGAAGGGGG + Intronic
982460193 4:155660427-155660449 GGGGAGGGAGGGAGAGAGGAAGG - Intergenic
982916308 4:161213960-161213982 GTGTAGGGAAGTAGATAAGAAGG + Intergenic
983336100 4:166394549-166394571 GAGGGGGAAGGGAGAGAAGAGGG + Intergenic
983526532 4:168765884-168765906 GGGTTGGGAGGAAGAGAAGAGGG + Intronic
984486686 4:180379134-180379156 AGGAAGGTAGGGAGAGGAGAAGG - Intergenic
984556927 4:181225686-181225708 GTGTGGGGAGTGAGAAAAGAAGG - Intergenic
984703158 4:182831842-182831864 GAGAAGGAAGGGAGAGGAGAAGG - Intergenic
984703325 4:182832327-182832349 GAGAAGGAAGGGAGAGGAGAAGG - Intergenic
984703329 4:182832343-182832365 GAGAAGGAAGGGAGAGGAGAAGG - Intergenic
984703340 4:182832375-182832397 GAGAAGGAAGGGAGAGGAGAAGG - Intergenic
984762849 4:183377365-183377387 AGGGAGGGAGGGAGAGAAGAAGG - Intergenic
984885468 4:184445727-184445749 GTGGAGGAAGGAAGGGAAGAAGG - Intronic
985469787 5:33058-33080 GTCTAGGTAAGCAGAGGAGATGG - Intergenic
985469805 5:33193-33215 GTCTAGGTAAGGAGAGGAGATGG - Intergenic
985829507 5:2217735-2217757 GTGAAGGTTGAAAGAGAAGACGG - Intergenic
985999113 5:3616323-3616345 GTCTACGAATGGAGAGAAGAAGG + Intergenic
986768779 5:10952605-10952627 GTGAAGGTAGAGTGAGAAGACGG + Intergenic
986793716 5:11189178-11189200 ATGGAGGAAGGGAGAAAAGAAGG - Intronic
986885526 5:12229656-12229678 GTTGAGGTAGGTAGGGAAGAGGG + Intergenic
987066610 5:14296117-14296139 GTGTGGGAAGTGAGAGAAGGGGG + Intronic
988346416 5:30042655-30042677 GTGAAGAGAAGGAGAGAAGAGGG + Intergenic
988453959 5:31371095-31371117 GTATTGGTAGGGAAAGGAGAAGG - Intergenic
988615108 5:32767954-32767976 GTGGAGGCAGGGAAAGAGGAGGG - Intronic
988809796 5:34773228-34773250 TTGTATATAGGGAGAGAGGAGGG - Intronic
989437281 5:41429385-41429407 GGGGAGGGAGGGAGAGAAGGCGG + Intronic
989559097 5:42830525-42830547 AGGTAGGTAGGGAGGGAAGTAGG - Intronic
989966551 5:50471920-50471942 ATGTAGGTAGTGAAAGAAGAAGG - Intergenic
990033719 5:51293452-51293474 TTTTAGGAATGGAGAGAAGAAGG - Intergenic
990910486 5:60846584-60846606 GGGTATGGAGGCAGAGAAGAAGG + Intergenic
991091722 5:62699999-62700021 GTGTAGGTAAGGGGATGAGATGG + Intergenic
991260970 5:64667657-64667679 ATGAAGGAAGGGAGAAAAGAAGG + Intergenic
991337634 5:65566730-65566752 AGGGAGGGAGGGAGAGAAGAAGG - Intronic
992056124 5:72992591-72992613 CTATAGATAGGGAGAAAAGAAGG + Intronic
992176559 5:74154945-74154967 CTGTAGGTGGGGAGCAAAGAGGG + Intergenic
992437688 5:76771068-76771090 GAGGAGGTAGGGAGAGAGAAGGG + Intergenic
993012655 5:82501073-82501095 GGGAAGGAAGGGAGGGAAGAAGG - Intergenic
993095383 5:83473478-83473500 GGGAAGGGAGGCAGAGAAGATGG - Intronic
993140820 5:84031027-84031049 GTGAAGACATGGAGAGAAGATGG - Intronic
993504539 5:88693782-88693804 GAGAAGGTAGAGAGAGATGAGGG + Intergenic
993969357 5:94397980-94398002 GGGGAGGGAGGGAGAGAGGAAGG - Intronic
994352668 5:98764836-98764858 ATGAAGAGAGGGAGAGAAGAGGG + Intergenic
995414915 5:111898909-111898931 TTGTAGGCTGGGAGAGAATAAGG + Intronic
995429554 5:112058921-112058943 AGGGAGGTAGGGAGAGAGGAAGG + Intergenic
995685632 5:114769019-114769041 GGGTTGGTAGGGAGAAAAGGGGG - Intergenic
995863423 5:116664916-116664938 GTCTAACTAGGGAGATAAGATGG + Intergenic
999361506 5:150990040-150990062 GTGTTGGAAGGGGGAGAAGAGGG + Intergenic
1000189843 5:158899861-158899883 GGGGTGGTAGGAAGAGAAGAGGG - Intronic
1000419582 5:161023041-161023063 GACTAGGAAAGGAGAGAAGAGGG + Intergenic
1001106612 5:168859968-168859990 GGATAGGTAGGGAAAGAGGAAGG - Intronic
1001140104 5:169137283-169137305 ATGTAGATAGAAAGAGAAGAGGG - Intronic
1001606179 5:172961333-172961355 GGATAGGTAGGGATAGAAAATGG + Intronic
1001795042 5:174495048-174495070 GGGGAGGGAGGGAGAGCAGAAGG - Intergenic
1002054896 5:176593182-176593204 GTCTAGCAAAGGAGAGAAGATGG + Intronic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002439172 5:179255529-179255551 GTGGAGGCAGAGAGGGAAGATGG - Intronic
1002924297 6:1595851-1595873 GTGGAGGCGGGGAGAGAAGAGGG - Intergenic
1003199711 6:3947820-3947842 ATGTAGGGAGGGAGGGAGGAGGG + Intergenic
1003448450 6:6207149-6207171 GTGGAGGTGGGGTGAGAATAAGG - Intronic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1003560686 6:7177371-7177393 GGGGAGGGAGGGAGAGAAAAGGG - Intronic
1003564931 6:7214805-7214827 GTGTTGGTGGGGAGTGGAGAAGG - Intronic
1003644001 6:7899518-7899540 ATGTAGGCAGGGAGAGAGGGAGG + Intronic
1003744532 6:8985355-8985377 CGGGAGGTAGGGGGAGAAGATGG - Intergenic
1004328808 6:14702270-14702292 GTGTAAGGAGAGAGAGGAGAGGG + Intergenic
1004751490 6:18566237-18566259 AGATAGGGAGGGAGAGAAGAAGG - Intergenic
1005164796 6:22907375-22907397 GTGTGTGTAGGGAGTGAGGATGG - Intergenic
1005610218 6:27516702-27516724 GTTTAGGCAGGGATTGAAGATGG - Intergenic
1006043621 6:31274357-31274379 GGGGAGGTAAGGGGAGAAGAAGG - Intronic
1007183502 6:39947941-39947963 GTGTAGGGAGGGAGGGAGGGGGG + Intergenic
1007436916 6:41820361-41820383 GTGGTGGTAGGGAGGGAAGCTGG - Intronic
1007737667 6:43991667-43991689 GAGCAGGCAGGGAGACAAGACGG + Intergenic
1007910961 6:45513652-45513674 GGGTGAGTAGGGAAAGAAGAGGG + Intronic
1008592696 6:53009972-53009994 GTCCAGGTCGGGTGAGAAGATGG - Intronic
1010128738 6:72466315-72466337 GTGTAGGGAGAGTGAGTAGAGGG + Intergenic
1010367715 6:75071436-75071458 GTGTAGGTAGGGGGTAGAGATGG - Intergenic
1011036881 6:82986940-82986962 GTGAAGGAAGGAAGAGAGGAAGG - Intronic
1011182476 6:84636344-84636366 GTGAAGCCAGGTAGAGAAGAAGG - Intergenic
1011277234 6:85643079-85643101 GTGGTGGTAGGGGGAGAAGGAGG - Exonic
1011283866 6:85704058-85704080 GAGCAGGAAGAGAGAGAAGAGGG - Intergenic
1011629497 6:89310492-89310514 GAGAGGGTAGAGAGAGAAGATGG - Intronic
1011765905 6:90619372-90619394 GTGTAACCAGGAAGAGAAGAGGG - Intergenic
1012480676 6:99663675-99663697 GGGAAGGAAGGGAGTGAAGAAGG - Intergenic
1012949488 6:105503051-105503073 GTTTAGTAAGGGAGAGAAGAAGG - Intergenic
1013346242 6:109263380-109263402 GTGAAGGCAGAGGGAGAAGATGG + Intergenic
1013629037 6:111967342-111967364 GTGAAGGATGGGAGAGCAGACGG - Intergenic
1014725818 6:124970692-124970714 GTGTCAGTAGCTAGAGAAGAAGG + Intronic
1014732320 6:125047532-125047554 TTGTAGGTAAGAAGAGAAGCAGG + Intronic
1015427936 6:133093920-133093942 AGGTAGGGAGGGAGAGAAAAAGG + Intergenic
1016143039 6:140636993-140637015 GTCTATATAAGGAGAGAAGAAGG + Intergenic
1016434322 6:144020097-144020119 GTGGAGAGAGGGAGAGAAGGAGG - Intronic
1016793968 6:148097773-148097795 GAATAGGTAGGAATAGAAGAGGG - Intergenic
1016804967 6:148203373-148203395 AGGAAGGGAGGGAGAGAAGACGG - Intergenic
1016979915 6:149844439-149844461 GTGAATGTTGGGAGAGCAGAGGG - Intronic
1017027207 6:150191918-150191940 GTGTAGATAGGGAAAGAAGAGGG + Intronic
1017254487 6:152317514-152317536 GTGAAGGAAGGGATAGAGGAAGG - Intronic
1017371316 6:153712524-153712546 GTGTAGGTAGCTATGGAAGATGG + Intergenic
1018352523 6:162975761-162975783 AAGAAGGGAGGGAGAGAAGAAGG - Intronic
1018441921 6:163821424-163821446 GTTGAGGGAGGGAGAGGAGATGG + Intergenic
1018773565 6:166993656-166993678 GGGTAGGTAGGTAGAGTAGCAGG + Intergenic
1018781939 6:167076169-167076191 GGGGAGGGAGGGAGAGAGGAAGG - Intergenic
1018781953 6:167076212-167076234 GGGGAGGGAGGGAGAGAGGATGG - Intergenic
1019588268 7:1816281-1816303 GTGTAGGGAGGGAGGGGAGAGGG - Intronic
1019908578 7:4083592-4083614 GAGAAGGGAGGGAGAGAAGAAGG - Intronic
1019963991 7:4484302-4484324 GTAGAGGGAGAGAGAGAAGAGGG + Intergenic
1020988402 7:15165233-15165255 GGGGAGGGAGGGAGAGAATAAGG + Intergenic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021315998 7:19147692-19147714 GGGGAGGGAGGGAGAGAGGAAGG - Intergenic
1021376536 7:19914721-19914743 GTGAAGGCTGAGAGAGAAGAGGG - Intergenic
1022396472 7:29991470-29991492 GTGTGGGTAGGGAGAGCATTAGG + Intergenic
1022413265 7:30155856-30155878 GTGGAGGGAGTGAGAGAGGAAGG + Intronic
1022519400 7:30996291-30996313 GTGTAGGGAGGAAGAGGAGGAGG - Intergenic
1022527844 7:31049838-31049860 GGGTGGGGAGGCAGAGAAGAGGG + Intergenic
1022580260 7:31545880-31545902 GGATAGGGAGGGAGAGCAGAAGG + Intronic
1022783819 7:33615007-33615029 GTGGAGGTGGGGAGCTAAGAAGG + Intergenic
1023403915 7:39811809-39811831 GGGCAGGGAGGGAGAGAAGGAGG + Intergenic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1023778201 7:43630769-43630791 GTGTTGGTAGGAAGATAAAATGG - Intronic
1023782872 7:43673997-43674019 GTGGAGGGAGGGAGGGAGGAAGG + Intronic
1024294098 7:47829059-47829081 ATGAAGGCAGGGAGAGAGGAAGG + Intronic
1024317784 7:48036976-48036998 CTGTAGGAGGGTAGAGAAGAGGG + Intronic
1024326762 7:48114900-48114922 GTGGAGGTTGGGAGAGAGGCAGG + Intergenic
1024994273 7:55260264-55260286 GTGAAGGGAGGAAGAGCAGAAGG + Intergenic
1026137774 7:67678551-67678573 TTGAAGGCAGGGAGAGAAGAGGG - Intergenic
1026466669 7:70660436-70660458 GCGTAGATTTGGAGAGAAGAAGG + Intronic
1026588897 7:71679909-71679931 GAGGAGGAAGGGAGAGAAGGAGG - Intronic
1026957853 7:74389116-74389138 GTGTAAGTCAGGCGAGAAGAAGG + Exonic
1027002437 7:74662902-74662924 GTGTAGGTGGGGAAAGGAGGGGG - Intronic
1027232235 7:76279555-76279577 GTGTAGGGAGGGAGACAGGGAGG + Intronic
1027518486 7:79172105-79172127 GTGTAAGAAGGAAGGGAAGAGGG + Intronic
1028208828 7:88048835-88048857 TGGGAGGTAGGGAGAGAAAAGGG - Intronic
1028416511 7:90586341-90586363 GTGAAGGAAGTGAGAAAAGATGG + Intronic
1028705582 7:93841189-93841211 GTGGGAGTAGGGAGAGGAGAGGG - Intronic
1028851522 7:95543339-95543361 GTGTAGGTAGGGAGCCAGGAAGG - Intergenic
1028976648 7:96922164-96922186 GTATAGTTAGGGAGACAAGTTGG + Intergenic
1029204904 7:98863767-98863789 GAGGAGGGAGGGAGAGAGGAAGG - Intronic
1029327103 7:99819229-99819251 GAGGAGGGAGAGAGAGAAGAGGG - Intergenic
1029580603 7:101434614-101434636 GTGTTGGTGAGGAGAGAAGGCGG + Intronic
1030082716 7:105791293-105791315 GTGGCAGTAGGGAGAGATGAGGG - Intronic
1030104188 7:105973055-105973077 GAGTGGGTAGGGACAGTAGAAGG - Intronic
1030226375 7:107156116-107156138 GTGAAGGTAGGGAGAGTATTAGG + Intronic
1030250865 7:107442551-107442573 GTGAAAGTAGGGAGGGAACATGG - Intronic
1030346280 7:108436185-108436207 TTGAAGGTTGGGAGAGAGGAAGG - Intronic
1030964233 7:115969768-115969790 GTGGCTGTAGGGAGAGATGATGG + Intronic
1031993368 7:128212039-128212061 GGGTAGGCGGGGAGAGAAGAGGG - Intergenic
1032000025 7:128259210-128259232 GAGGAGGTGGGGAGAGAAGAGGG + Intergenic
1032421885 7:131787428-131787450 GTGTAGGTAGGAAGAGAAAGAGG - Intergenic
1032625157 7:133583975-133583997 GTGTGGGTCGGGGAAGAAGAAGG + Intronic
1034820403 7:154211655-154211677 GTGTATGGAGGTGGAGAAGAGGG - Intronic
1035241620 7:157534292-157534314 GAGTAGGGAGGGAGAGGAAAGGG - Intergenic
1035280623 7:157776072-157776094 GAGGAGGGAGGAAGAGAAGAGGG - Intronic
1035850635 8:2915819-2915841 GGGTAGGAGGAGAGAGAAGAAGG + Intergenic
1036546120 8:9771456-9771478 AAGAAGGGAGGGAGAGAAGAAGG + Intronic
1037233308 8:16686535-16686557 GTGTAGGCAAGCAAAGAAGAAGG + Intergenic
1037295370 8:17394523-17394545 GTGTAGGGAGAGAGAAAGGAGGG + Intronic
1037367027 8:18133951-18133973 GTGTTGGTGGGGATAGAAAATGG + Intergenic
1038096478 8:24317808-24317830 GTCTAGGTAGGGACAGGAAATGG + Intronic
1038240528 8:25803682-25803704 GAGCAGGTAGGGAGGGATGAGGG + Intergenic
1038350435 8:26771466-26771488 GTTTGGGTAGGTAGAGAAGGTGG - Intronic
1038524494 8:28261424-28261446 GTGAAGACATGGAGAGAAGACGG + Intergenic
1038845207 8:31222633-31222655 GGGTAGATAGGGAGAGAAAGAGG + Intergenic
1039116228 8:34094264-34094286 GTGTAGTTAGGGTGAGAATGAGG - Intergenic
1039734957 8:40321936-40321958 GGGTGGATAGGAAGAGAAGAGGG - Intergenic
1039822843 8:41148870-41148892 GTGATGGTAGGGGCAGAAGAGGG + Intergenic
1039845106 8:41320532-41320554 GGGTAGAAAGGGAGAGAACAAGG - Intergenic
1040903598 8:52441883-52441905 AAGGAGGGAGGGAGAGAAGAGGG + Intronic
1041212146 8:55563371-55563393 GTGTAGGTAAGGTGAGAGGAGGG + Intergenic
1041551147 8:59102777-59102799 GTGGTGGAAGGAAGAGAAGAAGG + Intronic
1041592533 8:59605692-59605714 GTGTAAGAAGAGAGGGAAGAAGG + Intergenic
1041593528 8:59619767-59619789 GAGAAGGAAGGGAGAGAGGATGG - Intergenic
1041609908 8:59833491-59833513 GAGTAGGGAGGGAGAGGAGGAGG + Intergenic
1041627739 8:60049941-60049963 GTGGAGGTGGGGAGAAAAAAGGG - Intergenic
1042014469 8:64292813-64292835 GAGGAGGGAGGGAGAGAGGAAGG - Intergenic
1042190839 8:66185595-66185617 GTCTTTGTAGGCAGAGAAGATGG - Intergenic
1042356725 8:67836538-67836560 ATGGAGGTAGGGAGGAAAGAAGG - Intergenic
1043148917 8:76688386-76688408 GGCTGGGAAGGGAGAGAAGAGGG + Intronic
1043322664 8:79009389-79009411 GAGAAGGGAGGGAGGGAAGAGGG - Intergenic
1043322674 8:79009416-79009438 GGGAAGGGAGGGAGGGAAGAGGG - Intergenic
1043476706 8:80612045-80612067 GTGGAGGTAGGGGGTGAGGATGG + Intergenic
1043540727 8:81259295-81259317 GAGTAGGTAGAGAGAGGAAATGG + Intergenic
1044241648 8:89894703-89894725 GAGTAGGTAGAGAGAGAAATAGG + Intergenic
1044289110 8:90446948-90446970 GTGGAGGGAGGGAGAGGAGAAGG - Intergenic
1044554871 8:93552412-93552434 GGGTAGGAAGGGAAAGAAGAAGG - Intergenic
1045900467 8:107273252-107273274 GGGTAGATAGAGAGAGGAGAGGG + Intronic
1046097482 8:109578592-109578614 GTGTATTTATGGAGAGAATAGGG + Intronic
1046130987 8:109968634-109968656 GGGAAGGAAGAGAGAGAAGAGGG - Intronic
1046242647 8:111516881-111516903 GTGTAAGTAGGGAGAAAATGAGG + Intergenic
1046409903 8:113828125-113828147 ATATAGGTAGGGAAAGAAGAAGG - Intergenic
1046605332 8:116365481-116365503 GGGGAGGGAGGGAGGGAAGAAGG + Intergenic
1046662262 8:116961023-116961045 GGGGAGGAAGGGAGAAAAGAAGG + Intronic
1046681809 8:117178889-117178911 GTGGGGGAAGAGAGAGAAGAAGG + Intergenic
1046873024 8:119224686-119224708 GAGTGGGTGGGGAGAGGAGAAGG - Intronic
1047135956 8:122078709-122078731 GGGAAGGGAGGGAGGGAAGAGGG + Intergenic
1047405991 8:124586321-124586343 GTGCAGATAGGCAGGGAAGATGG - Intronic
1048246027 8:132800931-132800953 CTGTAGGTAGGGAGAAAAAGAGG - Intronic
1048282014 8:133112592-133112614 GTGAGGGAAGGGAGAGAAAAGGG + Intronic
1048726594 8:137392572-137392594 GTGTAGGGAGAGAGAGTATATGG - Intergenic
1049083113 8:140457869-140457891 GAGGAGCGAGGGAGAGAAGAGGG + Intronic
1049143928 8:140983707-140983729 AAGGAGGGAGGGAGAGAAGAAGG + Intronic
1049315537 8:141965052-141965074 GTGTTGGGAGGAAGAGAAAATGG + Intergenic
1050172456 9:2836136-2836158 AAGGAGGTAGGGAGAGAGGAAGG - Intronic
1050313353 9:4375342-4375364 GTGTGGGTACAGAGAGAAAAGGG + Intergenic
1051130065 9:13850856-13850878 GTGGGGGCAGGCAGAGAAGAAGG - Intergenic
1051433223 9:17002039-17002061 ATGGAGGTAGGGAGAGAGGCAGG + Intergenic
1051747150 9:20305927-20305949 GTGAAGGCAGAGGGAGAAGATGG - Intergenic
1051968340 9:22857153-22857175 GTGGAAGAATGGAGAGAAGAGGG - Intergenic
1052195761 9:25712779-25712801 GAGAAGGTAGGGAAAGGAGATGG + Intergenic
1052730071 9:32275050-32275072 GTTGAGGTAGTGAGAGAAGCTGG - Intergenic
1052821228 9:33139190-33139212 GTTGAGGTAGGGAGGGAGGATGG + Intronic
1053178709 9:35949165-35949187 GTGGAGGAGGGGAGAGAAGGTGG + Intergenic
1054454038 9:65420439-65420461 GGGAAGGGAGGGAGGGAAGAAGG + Intergenic
1055354740 9:75426342-75426364 GAGAAGGGAGGGAGGGAAGAAGG - Intergenic
1055430327 9:76237038-76237060 GTGTAGGTAGGAAGATTTGAGGG - Intronic
1055641114 9:78319732-78319754 GTGGAATTAGGCAGAGAAGAGGG + Intronic
1056084642 9:83134173-83134195 GAGTAGGGAGGGAGAGAAGAGGG - Intergenic
1056501823 9:87217124-87217146 ATGGAGGTTGGGAGAGGAGAGGG + Intergenic
1056523174 9:87418830-87418852 GAGAAGGGAGGGAGAGAAGGAGG - Intergenic
1056666383 9:88584025-88584047 GTGCAGGCATGGAGAGAAGGTGG - Intronic
1056897272 9:90562697-90562719 GAGAAGGGAGGGAGAGAAGAAGG - Intergenic
1057124786 9:92608583-92608605 GTACAGGTGGGGAGAGAAGATGG - Intronic
1057496281 9:95563910-95563932 AGGAAGGAAGGGAGAGAAGAAGG - Intergenic
1057565084 9:96160213-96160235 GGGAGGGAAGGGAGAGAAGAAGG + Intergenic
1057735497 9:97655666-97655688 GGGGAGGTAGGCAGAGAAAAAGG - Intronic
1057743784 9:97735283-97735305 CTGTGGGAGGGGAGAGAAGAGGG + Intergenic
1058212254 9:102183790-102183812 ATGTAGAGAGGAAGAGAAGAAGG - Intergenic
1058698893 9:107584852-107584874 GTGAAGGTTTGGAGAGGAGAGGG - Intergenic
1058929814 9:109708050-109708072 GTGGAGGGAGGGAGAGGAGTGGG - Intronic
1059064841 9:111072420-111072442 GTGGAGGTAGGGAGAGCATCAGG - Intergenic
1059291597 9:113230055-113230077 ATTTATGTAGGGAGTGAAGATGG + Intronic
1059347828 9:113643542-113643564 AAGAAGGCAGGGAGAGAAGAAGG - Intergenic
1059354276 9:113687227-113687249 GAGGAGGAAGGCAGAGAAGAGGG + Intergenic
1059635275 9:116164277-116164299 GAGTAGGAAGAGAGAGAAGAAGG - Intronic
1059669337 9:116478113-116478135 GGGTAGGGAGGGAGAAAGGAAGG + Intronic
1060025605 9:120168228-120168250 GGGTGGGTATGCAGAGAAGAGGG - Intergenic
1060031197 9:120216425-120216447 GTGAAGGTGGGGAGAGAACGGGG + Intergenic
1060054702 9:120403458-120403480 GTGCAGGGAGGGAGAGAACAGGG + Intronic
1060919268 9:127409006-127409028 GGGGAGGTAGGGAGAGATGACGG + Intergenic
1060919284 9:127409052-127409074 GGGGAGGTAGGGGGAGATGATGG + Intergenic
1060919356 9:127409239-127409261 GGGGAGGTAGGGGGAGATGATGG + Intergenic
1061079327 9:128360771-128360793 GTGAGGGTAGGGAGAGGACAAGG + Exonic
1061083258 9:128384902-128384924 GGGGAGGTAGGGAGGGAAGGAGG - Intronic
1061634867 9:131901106-131901128 GGGAAGGAGGGGAGAGAAGAAGG + Intronic
1062010837 9:134265821-134265843 ATGAAGGTAGGGAGGGAAGGAGG - Intergenic
1062315569 9:135965468-135965490 TTCGAGGTAGGGAGAGAAGCAGG - Intergenic
1203553021 Un_KI270743v1:180108-180130 GTATAGAGAGGGAGAGAAGTAGG + Intergenic
1185493465 X:536867-536889 TTGTAGGTAGGAAGCAAAGAAGG + Intergenic
1185571476 X:1138068-1138090 GTGAAGGAAGTGAGAGAAAAGGG - Intergenic
1185631085 X:1516258-1516280 ATGGAGGGAGGGAGAGAAGGAGG - Intronic
1186047111 X:5548582-5548604 GTGGACGGAGGGAGAGAAGGAGG - Intergenic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186490810 X:9970570-9970592 AAGTAGGGAGGGAGAGAAGGAGG - Intergenic
1186729564 X:12394626-12394648 GTGAAGGAAGGGAGAAAAGGAGG - Intronic
1187444050 X:19344978-19345000 GTGTAGGTAAGGGGAGGGGAGGG - Intronic
1187526231 X:20057637-20057659 GTGGAGATAGGGAGAGGAGTTGG - Intronic
1187743609 X:22384295-22384317 GCTTAGGTAGGGAGAGTAGACGG - Intergenic
1188734578 X:33696705-33696727 ATGAGGGGAGGGAGAGAAGAAGG + Intergenic
1188740213 X:33769151-33769173 GAGGAGGGAGGGAGAGAGGAAGG + Intergenic
1189187341 X:39065578-39065600 GTGGAGGGAGGGGGAGCAGAGGG + Intergenic
1189212711 X:39298222-39298244 GTGTATGTAGTGAAAGAGGATGG + Intergenic
1189545477 X:42037964-42037986 GTCTAGGTATGGAGTGAAAAGGG + Intergenic
1189732359 X:44034458-44034480 GTGTTGGTGGGGAGAGAAGAGGG - Intergenic
1190454773 X:50616909-50616931 GTGAAGGTCGGGAGAGAGGCAGG - Intronic
1190478740 X:50853345-50853367 GTGCAGATAGAGAGAGAAGAAGG - Intergenic
1190554123 X:51616645-51616667 AGGTAGGGAGGGAGAGAGGAAGG - Intergenic
1190915685 X:54809512-54809534 GTGGAGGGAGGGAGAGAAGGTGG + Intronic
1191047335 X:56152649-56152671 GTGAAGGTAGAGAGAGGGGAAGG + Intergenic
1192182391 X:68924353-68924375 GTGGAGCTGGAGAGAGAAGAGGG - Intergenic
1192709877 X:73569309-73569331 GTATAGGGAGGGAGACAAAAGGG + Intronic
1193273600 X:79557796-79557818 ATGAAGGTAGGGAGGAAAGAAGG + Intergenic
1193971856 X:88065122-88065144 TTGTAGGAAGGGAAAGAAGAGGG - Intergenic
1194326016 X:92517753-92517775 GTGAAGCTGGGAAGAGAAGATGG - Intronic
1194400066 X:93431392-93431414 GAGGAGGTCGGCAGAGAAGAAGG - Intergenic
1194673394 X:96764383-96764405 GTGTGTGGAGGCAGAGAAGAAGG + Intronic
1194815164 X:98432031-98432053 GTAAAGGTAGGGAGTGAAAAGGG + Intergenic
1195000928 X:100642619-100642641 GTTTAGTAGGGGAGAGAAGAGGG - Intergenic
1195597664 X:106711165-106711187 GAGTAGGTGGGGAGAGAGGCTGG - Intronic
1196048816 X:111283433-111283455 GGTGAGGTAGGGAGAAAAGAGGG + Intergenic
1196750026 X:119107754-119107776 GTGTAAGTGGGAAGAGAACAAGG - Intronic
1197095706 X:122592096-122592118 TTGTAGCCAGGGAGAGAAGAAGG + Intergenic
1197825808 X:130589137-130589159 GTGGGGGTGGGGAGAGCAGAAGG - Intergenic
1198034033 X:132783524-132783546 GTGTGGGTGGGTAGAGATGAAGG - Intronic
1198041777 X:132859832-132859854 GGGAAGGAAGGGAGAGAAGGAGG + Intronic
1198146171 X:133859517-133859539 GTGTGGGTAGGGAGAGATGAAGG + Intronic
1198317099 X:135478855-135478877 GTGTTGATGGGGAGAGGAGAGGG + Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1198546966 X:137702399-137702421 GTGTGGGGAGCTAGAGAAGAGGG - Intergenic
1199093625 X:143716980-143717002 GTGTTGGAAGGGGGAGGAGAGGG - Intronic
1199214709 X:145251180-145251202 GTGTTGGAAGGGGGAGGAGAGGG + Intronic
1199288368 X:146078563-146078585 GAGTGGGTAGGGAGAGAATAGGG + Intergenic
1199441573 X:147874542-147874564 ATGGAAGTAGGGAGAGAAGAAGG + Intergenic
1199518731 X:148710316-148710338 ATGTAGGGAGGCAGAGAGGAAGG - Intronic
1200634737 Y:5636927-5636949 GTGAAGCTGGGAAGAGAAGATGG - Intronic
1200695775 Y:6357891-6357913 GAGAAGGGAGGGAGGGAAGAAGG - Intergenic
1200783797 Y:7240850-7240872 GAAAAGGGAGGGAGAGAAGAAGG - Intergenic
1201039502 Y:9816819-9816841 GAGAAGGGAGGGAGGGAAGAAGG + Intergenic
1201438609 Y:13985520-13985542 GTGTAGGGAGGGAGGGAGGGAGG - Intergenic
1201445964 Y:14057188-14057210 GTGTAGGGAGGGAGGGAGGGAGG + Intergenic
1201451168 Y:14116258-14116280 ATGGAGGGAGGGAGAGAGGAAGG + Intergenic
1201849535 Y:18462748-18462770 GTGAAGGTAAGCAGAGAAGATGG - Intergenic
1201883783 Y:18857627-18857649 GTGAAGGTAAGCAGAGAAGATGG + Intergenic
1202334205 Y:23789805-23789827 GTGAAGGTAAGCAGAGGAGAGGG + Intergenic
1202379274 Y:24261556-24261578 GGGGAGAAAGGGAGAGAAGAAGG - Intergenic
1202491508 Y:25408565-25408587 GGGGAGAAAGGGAGAGAAGAAGG + Intergenic
1202536563 Y:25880254-25880276 GTGAAGGTAAGCAGAGGAGAGGG - Intergenic