ID: 916772447

View in Genome Browser
Species Human (GRCh38)
Location 1:167925002-167925024
Sequence CATACTAAGCAAAAATTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 215}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916772447 Original CRISPR CATACTAAGCAAAAATTGGA GGG (reversed) Intronic
901442876 1:9290186-9290208 GATACTATCCAAAAATTTGAAGG - Intergenic
905113686 1:35618134-35618156 CAAACTAAGGAAAAAGTAGAGGG + Intronic
907228707 1:52974781-52974803 AACACTTTGCAAAAATTGGATGG + Exonic
910409721 1:86927678-86927700 CATACCAAGCAAAAATCGAAGGG - Intronic
912440930 1:109697397-109697419 CAAAGTAACCAAAAATGGGAAGG - Intronic
912604940 1:110980515-110980537 CATTCTCAGCAAAAAATGTATGG + Intergenic
913495468 1:119424301-119424323 CATTGTAAGCAAAAACAGGATGG + Intergenic
913579609 1:120213234-120213256 CAAACTAAGCACAAAAGGGAAGG + Intergenic
913628564 1:120685154-120685176 CAAACTAAGCACAAAAGGGAAGG - Intergenic
914561543 1:148824661-148824683 CAAACTAAGCACAAAAGGGAAGG + Intronic
914611289 1:149305547-149305569 CAAACTAAGCACAAAAGGGAAGG - Intergenic
916772447 1:167925002-167925024 CATACTAAGCAAAAATTGGAGGG - Intronic
918781429 1:188704645-188704667 ATTACTAAGCAAAATTTAGAAGG - Intergenic
919556500 1:199061540-199061562 CATAATTACCAAAAGTTGGAAGG + Intergenic
921290295 1:213650723-213650745 CAAACTAAACAAAAATGGAATGG - Intergenic
924741140 1:246794836-246794858 CATATACAGTAAAAATTGGAAGG - Intergenic
1062905600 10:1177700-1177722 CATCCTAAGCCAAGGTTGGAGGG - Exonic
1063361728 10:5464917-5464939 CATACTTGCCAAAACTTGGAAGG + Intergenic
1064700612 10:18016464-18016486 CATAATTACCAAAATTTGGAAGG - Intronic
1065686963 10:28295166-28295188 CATACTAAGCATAATGTGAAAGG + Intronic
1066099817 10:32107727-32107749 CATACTGAGCAAAAATAGCAGGG - Intergenic
1068014686 10:51501142-51501164 CATATTAAGCAAAAATAAAAGGG - Intronic
1070212521 10:74340349-74340371 CATACTACTCAAAAATTATATGG - Intronic
1072147012 10:92650614-92650636 CATCCTAAGGAATAATTGAAAGG - Intronic
1073365843 10:102940358-102940380 CATAATAAGCACAAATAAGAGGG - Intronic
1073744340 10:106448344-106448366 TTTGCAAAGCAAAAATTGGAAGG + Intergenic
1074200477 10:111230348-111230370 CAAACAGAGCCAAAATTGGAGGG - Intergenic
1077976606 11:7253195-7253217 CATCTCAAGCAAACATTGGAAGG - Intronic
1078975419 11:16469424-16469446 CAGACAAAGCAAAAATTCTAGGG + Intronic
1079211316 11:18462890-18462912 GATGCTAAGGAAAGATTGGATGG - Intronic
1079507954 11:21175857-21175879 CATTGTAAGGCAAAATTGGACGG - Intronic
1080182154 11:29438352-29438374 CATAATAAGCTCAAACTGGAAGG + Intergenic
1084115141 11:67038686-67038708 CATATTAAGAAAAAGTTGAAGGG + Intronic
1086408365 11:86519119-86519141 GCTACTACACAAAAATTGGATGG - Intronic
1088088185 11:106006099-106006121 CAAACTGATCAAAAATTTGATGG - Intronic
1089357762 11:117866313-117866335 CATACTAAAAAAAAACTGGGGGG + Intronic
1090562892 11:127951900-127951922 GAGACTAAGAAAAAATTGAATGG - Intergenic
1093954528 12:25201177-25201199 AATACATAGCAAAAATGGGAAGG - Intronic
1094573372 12:31661753-31661775 CATAATAAGAAAATATTGGCCGG - Intronic
1095257197 12:40052393-40052415 CATGCTAAGCAAAAAAAGGGTGG + Intronic
1098379166 12:69850653-69850675 TATAATCAACAAAAATTGGAAGG - Intronic
1098451723 12:70626493-70626515 CATATTAGGAAAAAAATGGATGG + Intronic
1099812321 12:87599282-87599304 TTTGCTAAGCCAAAATTGGAGGG + Intergenic
1099970310 12:89493528-89493550 CATATTAAACAAAAATTAGGAGG + Intronic
1101670813 12:106870954-106870976 GAAACCAAGCAAAAAATGGATGG - Intronic
1102733837 12:115139641-115139663 GATACTGAGCAAACATTGGTAGG + Intergenic
1102863375 12:116355415-116355437 GATTCTAAGAAAAAATTAGAAGG + Intergenic
1105424261 13:20281678-20281700 CATGCTCAGTAAAAATGGGAAGG + Intergenic
1106719577 13:32424626-32424648 CATCCTAAGAAATAATTGGAGGG - Intronic
1109513639 13:63412290-63412312 CATATTTTGTAAAAATTGGAAGG + Intergenic
1114418578 14:22560444-22560466 CATGGTAAGCAAAAATTTAAAGG + Intergenic
1115919702 14:38359034-38359056 TAGACTAAGCAAAAAAAGGATGG + Intergenic
1116018637 14:39435152-39435174 CATGCTAAGAGATAATTGGAAGG - Intergenic
1116174622 14:41451555-41451577 CATTCAAAGAAAAAACTGGATGG + Intergenic
1116600400 14:46915057-46915079 CATAGTAAACATAACTTGGATGG - Intronic
1117332168 14:54723975-54723997 GATGCTCAGCAAATATTGGATGG + Intronic
1117802669 14:59461437-59461459 CATGGTAGGCAAGAATTGGAGGG - Exonic
1118540636 14:66820181-66820203 TATAATAAACAGAAATTGGAAGG - Intronic
1120113680 14:80588426-80588448 CATACTAGGCCAAATTTGGTAGG - Intronic
1121748183 14:96319613-96319635 CATATTAAGTAAAACTTGAATGG + Intronic
1122382750 14:101321301-101321323 CATCCTCATCAAAAGTTGGAGGG + Intergenic
1122708573 14:103638221-103638243 CACATTAAGGAAAAATGGGATGG - Intronic
1125260481 15:37818824-37818846 CCCAATAAGCAAAAATGGGATGG + Intergenic
1126355709 15:47793768-47793790 CATTCTAAGCAAGAATTGCAAGG - Intergenic
1127020445 15:54740993-54741015 CATTCTAAGCAAAAATAAAAAGG + Intergenic
1127278640 15:57469726-57469748 CACACACAGCCAAAATTGGAGGG - Intronic
1127590233 15:60415323-60415345 CACAATAAGGAAAAATGGGACGG + Intergenic
1130192363 15:81749462-81749484 AATACAAAGAAAAAATTGGCTGG - Intergenic
1130211051 15:81922651-81922673 CATATGAAGCAAAAATTGACAGG + Intergenic
1134377864 16:13695169-13695191 CAGACTAAGGAAAAAGAGGAGGG + Intergenic
1135224441 16:20643279-20643301 AATTCTAAGGAAAAATAGGAAGG + Intronic
1135962379 16:27007293-27007315 CAGACTAAAGAAAAATTGCATGG + Intergenic
1137705326 16:50531669-50531691 CAAACTGAGAAAAAAATGGACGG - Intergenic
1138732178 16:59207383-59207405 CATACTAGGCAAGCACTGGAGGG + Intergenic
1139126695 16:64087039-64087061 CATATTAACCAAAAACTGAATGG - Intergenic
1140994760 16:80248061-80248083 CAGTCTGAACAAAAATTGGAGGG + Intergenic
1141624079 16:85252371-85252393 CATCCTAAGCAACAAGGGGAGGG - Intergenic
1144164736 17:12599204-12599226 CATACTGAGAAAAGATTAGAAGG + Intergenic
1148530190 17:48382753-48382775 CATCTTAACCAAAAGTTGGAAGG + Intronic
1148709594 17:49668417-49668439 CATACTAAGCAAAAATATTAAGG + Intronic
1150310282 17:64122718-64122740 CCTATTAAGCAAAGACTGGAAGG + Intronic
1151241410 17:72761106-72761128 AAAACAAAACAAAAATTGGAAGG - Intronic
1155084481 18:22444209-22444231 CATACTAAGCTGAAATCAGATGG + Intergenic
1155111447 18:22719253-22719275 CATAAAAAGAAAATATTGGATGG + Intergenic
1155721410 18:29017299-29017321 CATACTAAGCAGAGAGTTGATGG + Intergenic
1156198544 18:34804065-34804087 CATAATAAGTAAAAAGTGAAGGG + Intronic
1158091082 18:53714406-53714428 CATACTAACCTATAATTTGAAGG - Intergenic
1158377834 18:56891923-56891945 CATACTAAGTTCAGATTGGATGG + Intronic
1158437671 18:57444853-57444875 CAAACCAAACAAAAATGGGAAGG + Intronic
1160326397 18:77953125-77953147 AATACTAAGGGAAAATAGGATGG + Intergenic
1160486846 18:79300691-79300713 CATACTGAGCAAGGACTGGATGG + Intronic
1165223263 19:34335344-34335366 AAAACTAAGCATATATTGGAAGG + Intronic
1168476939 19:56683129-56683151 CATACAAAGAAAAAATTTTAGGG + Intergenic
925578445 2:5384876-5384898 CAAAATTAGCAAAAATTAGAAGG - Intergenic
926950847 2:18241564-18241586 CATACTAAGCCCAAAGTGAAAGG + Intronic
927009445 2:18887581-18887603 CATACTAAGCAAACTATGGTTGG - Intergenic
927426133 2:22983537-22983559 CATATTTAGCAAAGACTGGATGG + Intergenic
928267825 2:29826816-29826838 CATAAGGAACAAAAATTGGAGGG + Intronic
928679254 2:33682316-33682338 CATATTTTGCAAAAATTGGCTGG + Intergenic
929716893 2:44321205-44321227 TAGACTAAGCAAAATTTAGATGG + Exonic
930231417 2:48847558-48847580 CTTACTCAGCAAAACTGGGATGG + Intergenic
930262528 2:49164387-49164409 CAGAGTAAGCAGAAATTGAAGGG + Intergenic
931073974 2:58688744-58688766 TATATTAAGCAAAAATTGGCAGG - Intergenic
935526523 2:104175836-104175858 GATACTAAACAAAAATTAGCAGG + Intergenic
936877650 2:117211781-117211803 CATGTTAAGCAAAAAGTGCAAGG + Intergenic
939724397 2:145698235-145698257 CATGTTAAGGAGAAATTGGAGGG + Intergenic
941541259 2:166788028-166788050 CATTCTACTCAAAAAATGGAAGG - Intergenic
942665183 2:178310105-178310127 CCTTCTATGAAAAAATTGGAAGG + Intronic
943952058 2:194142991-194143013 CATAATTATCAAAACTTGGAAGG - Intergenic
947128122 2:226893542-226893564 TATACTATGCAAAAATTCCAAGG - Intronic
1171001376 20:21419232-21419254 CACAATAAAAAAAAATTGGATGG + Intergenic
1172787157 20:37476110-37476132 CATACTTAAAAAAAATTTGATGG + Intergenic
1175012027 20:55747579-55747601 ATTACTTAGCAAAAATTGGTTGG - Intergenic
1175602755 20:60288288-60288310 AATAAGAAGCTAAAATTGGATGG - Intergenic
1176667449 21:9700571-9700593 CAGACTAACCAAAAATTACAAGG + Intergenic
1177056767 21:16315378-16315400 GATACTCAACAAAAATAGGAAGG - Intergenic
1178135039 21:29617690-29617712 AATACTAAGCAAAATATTGATGG - Intronic
949200143 3:1367529-1367551 CATACTAAACACAAATTGAGAGG + Intronic
949359149 3:3213507-3213529 AATGATAAGCAAAATTTGGACGG + Intergenic
952555337 3:34523775-34523797 AATTCTAAGGAAAAATAGGACGG + Intergenic
955015963 3:55069386-55069408 AATACTAGCTAAAAATTGGAGGG - Intronic
955892796 3:63667871-63667893 CACACAAAGGAAAAATGGGAGGG + Intronic
956235602 3:67067712-67067734 CATAATCATAAAAAATTGGAAGG + Intergenic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
959499293 3:107087140-107087162 CCCAGTGAGCAAAAATTGGAGGG + Intergenic
959914029 3:111795886-111795908 CAAACAAAACAAAAATTAGATGG - Intronic
960658370 3:120031098-120031120 CATACAATGCAAAAATTACATGG + Intronic
962338939 3:134564554-134564576 GATCCTAAGCAAATATTGGGTGG + Exonic
965332644 3:167395739-167395761 CAAAATAAGCTAAAATTGAAGGG - Intergenic
966400148 3:179539577-179539599 CCTCCTAAGCAAAAATTTGAAGG - Intergenic
966745564 3:183272929-183272951 TATTCTAAGCAAAAATTAAAAGG - Exonic
967313258 3:188126527-188126549 CAGACTAAGCACCAGTTGGACGG + Intergenic
967448181 3:189591907-189591929 CAGACTAAGAAAAAATGAGAGGG + Intergenic
971154865 4:24070708-24070730 CAGACTATGCAAAAATAGGTAGG - Intergenic
971901142 4:32659282-32659304 AATACTAAGAGAAAAATGGATGG - Intergenic
972512682 4:39784498-39784520 CATACAAAACAAAAATTAGCCGG + Intergenic
975485918 4:74933885-74933907 CATCCTAAGCATAACTAGGAAGG - Intronic
976622741 4:87145499-87145521 CATACAGAGCAAAAAGTGAAAGG + Intergenic
978343639 4:107742684-107742706 CAAAATATGCAAAAATTGGCTGG + Intergenic
978578880 4:110213073-110213095 CATACAAAGCAAGACTTGGAAGG + Intergenic
978995459 4:115145354-115145376 AATACTAAACTAAAATTGGGTGG + Intergenic
980288009 4:130806315-130806337 CATACGAAGATAAAAGTGGAGGG - Intergenic
980854453 4:138422970-138422992 AATATTAAAAAAAAATTGGATGG - Intergenic
981466464 4:145077915-145077937 CATACCGAGCAAAAACTGGAAGG + Intronic
981596767 4:146433089-146433111 CACACAAAACAAAAATTAGAAGG + Intronic
982148756 4:152428280-152428302 CATACCAAGCAGAAATTTCAAGG + Intronic
985407361 4:189651034-189651056 CAGACTAACCAAAAATTACAAGG - Intergenic
987160976 5:15142108-15142130 CATAATAAGCAAAAGTTGGGTGG - Intergenic
988156155 5:27451846-27451868 CCTAGTAAGCTAAAATTTGATGG - Intergenic
988243442 5:28644540-28644562 CATATTAAGAAAAAATTACAAGG + Intergenic
989564730 5:42890709-42890731 CATTTTAAGGAAAAAGTGGAGGG - Intergenic
990264300 5:54059108-54059130 CAGATTAAGGAAAAATAGGAGGG - Intronic
990610492 5:57452145-57452167 CAAAAAAAGAAAAAATTGGAGGG - Intergenic
990953813 5:61324153-61324175 CAAACTAAATAAAAAATGGAGGG + Intergenic
991081729 5:62608239-62608261 CAAAGTAAGGAAAAATTGTAGGG - Intronic
992974825 5:82104109-82104131 CATAATAGCCAAAAAATGGAAGG - Intronic
993664349 5:90677192-90677214 CATCCAAAGGAAAAATTGGTAGG + Intronic
994224294 5:97234521-97234543 CATTCTAAGCAACTATTGCAAGG - Intergenic
996214564 5:120851069-120851091 CATACTAGAAAAAAATAGGAAGG - Intergenic
996542201 5:124642202-124642224 GAGACTAAACAAAAATAGGATGG - Intronic
996568281 5:124905036-124905058 CATACTTAGCAAAAATAAAAAGG - Intergenic
998893933 5:146777931-146777953 GATACTAATAAAAAATTGTATGG + Intronic
1000395519 5:160770915-160770937 CATACTCAGCATATATTGGGTGG + Intronic
1008335659 6:50301773-50301795 CATAGTAAACAGAAATGGGATGG - Intergenic
1009493474 6:64321762-64321784 TAGACTAAGAAAAAATTGGATGG + Intronic
1011894386 6:92205737-92205759 TATACTAATCAACAATTGAAAGG - Intergenic
1012789310 6:103673695-103673717 CATCATAGGCAAATATTGGAGGG + Intergenic
1012910190 6:105109371-105109393 CATATTGAGCAGAAAGTGGAGGG + Intronic
1015756599 6:136613166-136613188 TATACAAAGCAAATACTGGAAGG - Exonic
1016300468 6:142624829-142624851 CATACTACTCAAAAATTCTATGG + Intergenic
1016450624 6:144178758-144178780 CATTCAAAGCAAAATTTGAAAGG - Intronic
1016547601 6:145241740-145241762 CATACTAATTAAAAATGGGTGGG + Intergenic
1017557504 6:155587751-155587773 CATACTAAGAGAAAGTTAGAGGG - Intergenic
1019803642 7:3106541-3106563 CATTCTAAGCAGAAAAGGGAGGG - Intergenic
1019803771 7:3107586-3107608 CATTCTAAGCAGAAAAGGGAGGG - Intergenic
1024201204 7:47108041-47108063 CATACTAAACAAAATAGGGATGG - Intergenic
1024429753 7:49273394-49273416 CATACTAAGGAAAAATTTCTAGG - Intergenic
1024865539 7:53901314-53901336 CTTACAAAGCGAAAATTGTAAGG - Intergenic
1027640364 7:80725700-80725722 ATTACTAAGCAAAGATTGGTGGG + Intergenic
1030148198 7:106377770-106377792 CATAAGAACCAAAAATTAGACGG - Intergenic
1031263549 7:119553741-119553763 CATATTAAGTAACAATAGGACGG - Intergenic
1033857454 7:145581718-145581740 CATTCCAATAAAAAATTGGATGG - Intergenic
1037915646 8:22771562-22771584 AACACTAAGCAATCATTGGATGG + Intronic
1038818145 8:30927561-30927583 CTTTTTAAACAAAAATTGGATGG - Intergenic
1039174481 8:34787295-34787317 CCTACTAAGCAAAGAGTAGAGGG - Intergenic
1039550994 8:38442699-38442721 CAAACTCAGCAGAAATTGTATGG + Intronic
1041535802 8:58924339-58924361 CATACTAAGCAGAAGTAGGGAGG + Intronic
1041675015 8:60529534-60529556 CATACTAAGAAACAAATGAAGGG - Intronic
1042668726 8:71235994-71236016 CATACTAAAGAAAAACTGGAAGG - Intronic
1043303596 8:78765895-78765917 CATAATGACCAAAACTTGGAAGG + Intronic
1043612959 8:82088864-82088886 AATAGCAAGGAAAAATTGGAAGG + Intergenic
1044055223 8:87561353-87561375 CATACCTAGAAAAAAATGGACGG + Intronic
1044371531 8:91417957-91417979 CATATTATGTAAAATTTGGAAGG - Intergenic
1045031658 8:98142744-98142766 CATACTACCCAAAACATGGAAGG + Intronic
1045647898 8:104317201-104317223 CATAGTAGGCATAAATTGTAAGG - Intergenic
1047030633 8:120875592-120875614 TATAATAAGAAAAAATTGGCGGG - Intergenic
1047161911 8:122390072-122390094 CATAATTGCCAAAAATTGGAAGG + Intergenic
1048111785 8:131475240-131475262 CTGACTGAGCAAAAATTGGATGG + Intergenic
1048298282 8:133232492-133232514 CATAAAAAGCAAAAATTTAAGGG - Intergenic
1048954323 8:139522682-139522704 CAAACCAACCAAAAATTAGAAGG - Intergenic
1049119918 8:140726528-140726550 CATACAAAGTAACAATTGTATGG + Intronic
1051556198 9:18385100-18385122 CATTACAAGCAAAATTTGGATGG + Intergenic
1052579249 9:30332891-30332913 AATACAAAGCAATAGTTGGAAGG - Intergenic
1053545168 9:39015374-39015396 CATAATTGCCAAAAATTGGAAGG - Intergenic
1053809569 9:41838567-41838589 CATAATTGCCAAAAATTGGAAGG - Intergenic
1054621023 9:67348861-67348883 CATAATTGCCAAAAATTGGAAGG + Intergenic
1055670247 9:78597739-78597761 CATACTGAGAAAAAATTGTTTGG + Intergenic
1055832925 9:80404099-80404121 CACACTAAAGAAAATTTGGAGGG - Intergenic
1057281645 9:93716921-93716943 AATACTAAGCAGAGAATGGAAGG + Intergenic
1060145737 9:121250840-121250862 CATGATAAGCAAAAAAGGGAAGG - Intronic
1060231485 9:121828571-121828593 CATAGAAGGCAAAAATTTGATGG - Intronic
1061870898 9:133519882-133519904 CATACAAAGGAAAAAGTGAAAGG - Intronic
1203658366 Un_KI270753v1:20127-20149 CAGACTAACCAAAAATTACAAGG - Intergenic
1187121506 X:16411954-16411976 CATACTTTGCAAAAAGTGCAAGG - Intergenic
1187308616 X:18119902-18119924 CTAACTAAGAAAAAATTTGAAGG + Intergenic
1188220831 X:27539421-27539443 AATACAAAGCAAAAACTAGAGGG + Intergenic
1188227282 X:27615432-27615454 CTGACAAAGCAAAAATTTGAAGG - Intronic
1188790052 X:34396919-34396941 CATAATAAACAAAGATTAGATGG - Intergenic
1189267628 X:39729134-39729156 CAAACAAAGCAGAAATTGCATGG + Intergenic
1194105440 X:89761714-89761736 CATAAAAAGGAAAAATTGGAAGG + Intergenic
1194607606 X:96000681-96000703 CATACTAAAGAACAATTGGCTGG + Intergenic
1194719295 X:97321892-97321914 GATTCTCAGCCAAAATTGGAAGG - Intronic
1195372188 X:104187560-104187582 CATACTAATGAAAAATTTGCTGG - Intronic
1195712376 X:107783995-107784017 CATACCAAACACAGATTGGAAGG + Intronic
1197328801 X:125127804-125127826 CATATTGAGCACAAATTGGAAGG - Intergenic
1198543475 X:137666061-137666083 CATACTAAGCAAAATATGGCTGG - Intergenic
1200457405 Y:3409531-3409553 CATAAAAAGGAAAAATTGGAAGG + Intergenic
1201458072 Y:14193092-14193114 CCTATTCAGCAAAAGTTGGAAGG - Intergenic
1201733693 Y:17234147-17234169 CTTACTAATTAAAAATTTGAAGG + Intergenic
1201793940 Y:17874387-17874409 CATACAAAGAAGAAATAGGAGGG + Intergenic
1201807614 Y:18031598-18031620 CATACAAAGAAGAAATAGGAGGG - Intergenic
1202355324 Y:24042202-24042224 CATACAAAGAAGAAATAGGAGGG + Intergenic
1202515454 Y:25627907-25627929 CATACAAAGAAGAAATAGGAGGG - Intergenic