ID: 916773435

View in Genome Browser
Species Human (GRCh38)
Location 1:167936152-167936174
Sequence TGCTGGCAGCGCGCTTGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916773429_916773435 13 Left 916773429 1:167936116-167936138 CCAAAATAATCACCTCACCAAGT 0: 1
1: 0
2: 0
3: 10
4: 194
Right 916773435 1:167936152-167936174 TGCTGGCAGCGCGCTTGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 54
916773428_916773435 28 Left 916773428 1:167936101-167936123 CCATGGCAACAGGTGCCAAAATA 0: 1
1: 0
2: 0
3: 28
4: 289
Right 916773435 1:167936152-167936174 TGCTGGCAGCGCGCTTGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 54
916773431_916773435 -4 Left 916773431 1:167936133-167936155 CCAAGTCTGCGCTGCGCCCTGCT 0: 1
1: 0
2: 0
3: 25
4: 196
Right 916773435 1:167936152-167936174 TGCTGGCAGCGCGCTTGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 54
916773430_916773435 1 Left 916773430 1:167936128-167936150 CCTCACCAAGTCTGCGCTGCGCC 0: 1
1: 0
2: 0
3: 10
4: 103
Right 916773435 1:167936152-167936174 TGCTGGCAGCGCGCTTGCGCAGG 0: 1
1: 0
2: 0
3: 3
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916773435 Original CRISPR TGCTGGCAGCGCGCTTGCGC AGG Intronic
903022023 1:20401335-20401357 TGCTGCCAGCTTGCTTGAGCAGG - Intergenic
903349796 1:22710843-22710865 TGCTGGCTGCGCGGTGGCGGCGG + Intronic
911144697 1:94541451-94541473 GGCTGGCAGCGGGCTCGCCCTGG - Intronic
915142335 1:153775368-153775390 TCCAGGGAGCGCGCGTGCGCTGG - Exonic
916773435 1:167936152-167936174 TGCTGGCAGCGCGCTTGCGCAGG + Intronic
917480297 1:175406103-175406125 TGCTGGGAGTGCGTTTTCGCTGG + Intronic
1069348004 10:67492859-67492881 TGCTGGCAGGGCTGTTGAGCTGG + Intronic
1070634831 10:78116873-78116895 TGCTGGCCCCTCGCTTGAGCTGG - Intergenic
1088699250 11:112397469-112397491 TGCTGGCAGGGGGCTAGGGCAGG + Intergenic
1090004076 11:122984639-122984661 TGGTGCCAGCGCGCATGGGCGGG + Intergenic
1103998498 12:124845171-124845193 TGCTGGGAGCGCGCATGTTCGGG - Intronic
1106031595 13:26010150-26010172 TGCTGGCAGGGCTCCTGTGCTGG - Intronic
1117066307 14:52015651-52015673 TGCTGACAGAGCACTTGTGCAGG + Intronic
1131108632 15:89750759-89750781 TGCCGGCAGCGCGGTGACGCGGG - Exonic
1131635793 15:94231685-94231707 ACCTGGCAGCGCGCGTGGGCCGG + Intronic
1132882974 16:2170519-2170541 TGCTGCCCTCGCGCTTCCGCCGG + Intronic
1133111030 16:3548523-3548545 TGCTGGCAGCAGGCTAGCCCGGG + Intronic
1139650716 16:68360793-68360815 TGCGGGCAGCGTGCATGCGAGGG + Exonic
1141959193 16:87392828-87392850 CGCCCGCAGCGCGCTTGCGGGGG - Intronic
1145938287 17:28727441-28727463 TGCTGGAAGGGCGCTGGCTCAGG - Intronic
1147588397 17:41666098-41666120 GGGTGGCGGCGCGCGTGCGCAGG - Intergenic
1151320680 17:73350534-73350556 TCCTGGCAGCGCACCTGCTCTGG - Intronic
1163112581 19:15170428-15170450 TGCTGTGCTCGCGCTTGCGCCGG + Exonic
926148565 2:10411811-10411833 GGCTGGCTGCCCGCTTGCTCAGG + Intronic
930008410 2:46915835-46915857 GGCAGGGAGCGCGCGTGCGCAGG - Intronic
948422340 2:237867611-237867633 TGCTGGCAGGCCGCTGGCACTGG + Intronic
948844716 2:240677529-240677551 TGCTGGCAGCACCCCTGAGCAGG - Intronic
948849144 2:240697350-240697372 TGCTGGCAGCACCCCTGAGCAGG + Intronic
1168918727 20:1513294-1513316 TGCTGACACTGCGCTTGCTCAGG + Intergenic
1173075279 20:39812600-39812622 TGCTTGCAGTCCGCTTGCCCTGG - Intergenic
1176411613 21:6452195-6452217 TGCTGGCAGCACGGTGGCGGTGG - Intergenic
1179687107 21:43060517-43060539 TGCTGGCAGCACGGTGGCGGTGG - Exonic
1180139583 21:45885082-45885104 TGCTGCCAGCGTGCCTACGCTGG - Intronic
1180256864 21:46635649-46635671 TGCGTGCACTGCGCTTGCGCGGG + Exonic
1181678088 22:24470859-24470881 AGCTTGCAGTGAGCTTGCGCTGG + Intergenic
1184035909 22:41917960-41917982 TGCTGGCAGCTCGAGTGTGCGGG + Intergenic
1185028099 22:48427030-48427052 TGCTGGAAAAGCGCTTGGGCTGG + Intergenic
951030171 3:17872677-17872699 TGCTTGCAGCGCGCAGGCGCAGG - Intronic
954633160 3:52057618-52057640 CGCAGGCGGCGCGCTTGCGTAGG + Intergenic
968754834 4:2409817-2409839 TGCTGGCAGGGCCCTTGTCCTGG - Intronic
975870650 4:78775985-78776007 CGCGGGCAGCGCGCCTGCGCGGG + Intergenic
985777283 5:1851432-1851454 GGCTGGGAGCGCACCTGCGCAGG + Intergenic
990776361 5:59309847-59309869 TACTGGCAGCGGGTTTGGGCAGG - Intronic
993416268 5:87636883-87636905 TGCTGGCAGTGCTCTTGACCTGG + Intergenic
997364079 5:133314321-133314343 TGCTGGCAGGGCGGTTGCCCCGG + Intronic
997610470 5:135212427-135212449 TTCTGTCAGCGGGCCTGCGCTGG - Intronic
1002534814 5:179870313-179870335 TGCTGGCAGGGCGCATGTTCAGG - Exonic
1002712742 5:181204923-181204945 TGCTGGGAGCGCCCGGGCGCGGG - Exonic
1008629372 6:53348740-53348762 TCCCGGCCGCGCGCTCGCGCGGG + Intronic
1017705870 6:157122554-157122576 TGGTGGAAACGCGCTTGCCCGGG + Intronic
1019170793 6:170132238-170132260 TGCTGGAAGCCTGATTGCGCTGG + Intergenic
1034931505 7:155167290-155167312 TCCAGGCAGCGCCCTGGCGCAGG + Intergenic
1049752520 8:144291876-144291898 TGAGGGCAGCGCGCGGGCGCGGG + Intronic
1056701814 9:88917581-88917603 TGGTGGCAGCAGGCTTGGGCTGG - Intergenic
1057841532 9:98489359-98489381 TGCTGGCACAGCGCTGACGCAGG + Intronic
1057881640 9:98796651-98796673 TGCCGGGAGCGCGCTAGGGCCGG + Intronic
1203661298 Un_KI270753v1:46071-46093 TGCTGACAGCGTGCCTGCTCCGG - Intergenic
1201175692 Y:11307372-11307394 TGCTGGCAGGGCGCCTGCATAGG + Intergenic