ID: 916776040

View in Genome Browser
Species Human (GRCh38)
Location 1:167965495-167965517
Sequence TTGTACATCCAGCAGAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916776040_916776045 13 Left 916776040 1:167965495-167965517 CCCTCCCTCTGCTGGATGTACAA 0: 1
1: 0
2: 3
3: 21
4: 202
Right 916776045 1:167965531-167965553 TGAAATTTATTGTGAAAATCTGG 0: 1
1: 0
2: 5
3: 49
4: 602

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916776040 Original CRISPR TTGTACATCCAGCAGAGGGA GGG (reversed) Intronic
902273914 1:15325822-15325844 TTGGAGATACAGGAGAGGGAAGG - Intronic
902767724 1:18628429-18628451 TTTCACATCCAGCAGGGGAAAGG - Intergenic
904978819 1:34479578-34479600 TTGGACATTTAGCAGAGGAAGGG + Intergenic
905560301 1:38921257-38921279 CTGTACTTCCAGCTGAAGGAAGG + Intronic
906067473 1:42992387-42992409 TTGTGCTTTCAGCAGGGGGATGG - Intergenic
906666702 1:47627211-47627233 TACTCCAGCCAGCAGAGGGAAGG - Intergenic
906686265 1:47765372-47765394 GGGTGCATCCAGCAGAGGGGAGG + Exonic
909817935 1:80020082-80020104 TGCTACATCCTCCAGAGGGAAGG - Intergenic
909825728 1:80124746-80124768 TTGTACATCCAGAAAAGAGGTGG - Intergenic
910659082 1:89651392-89651414 TTGTACTTTCAGCAGAGACAGGG - Intronic
911016464 1:93338353-93338375 AGGTACATCCAGCTGATGGAAGG - Intergenic
911809258 1:102253092-102253114 TTATACTTCCTGCAGTGGGAGGG + Intergenic
913320995 1:117588306-117588328 TTGTTAACCCTGCAGAGGGATGG + Intergenic
914332058 1:146681142-146681164 TTGTAGATGGAGCAGAGGGAAGG - Intergenic
914354873 1:146875889-146875911 TAGAACATCCCACAGAGGGATGG - Intergenic
916776040 1:167965495-167965517 TTGTACATCCAGCAGAGGGAGGG - Intronic
920231539 1:204473865-204473887 TTGAAGATACAGGAGAGGGAAGG - Intronic
920788618 1:209066856-209066878 TTGTATTTCAAGGAGAGGGAAGG - Intergenic
921361143 1:214332131-214332153 TTGTACATGCAGGACTGGGAAGG + Exonic
921541643 1:216423469-216423491 TGGTACCTCAAGCAGTGGGAGGG + Intergenic
923314699 1:232768521-232768543 TTGTCCATCAAGCAGGAGGATGG - Intergenic
924548764 1:245054562-245054584 GTGAACATCCAGGAGAGGGCCGG - Intronic
1063832597 10:9972069-9972091 TTGTGCTCCCAGCAGTGGGAAGG + Intergenic
1066581659 10:36888387-36888409 TCTTACATCCAGAAAAGGGAGGG + Intergenic
1067092213 10:43273644-43273666 TGATAGCTCCAGCAGAGGGAGGG + Intergenic
1067531137 10:47074464-47074486 TTGTACATCTTGCAGAGGACAGG - Intergenic
1067570037 10:47365010-47365032 TTCCACATCTAGAAGAGGGAAGG - Intergenic
1069612168 10:69781468-69781490 TGGAAGATCCAGGAGAGGGAAGG + Intergenic
1069843668 10:71355845-71355867 TTACAAGTCCAGCAGAGGGAGGG + Intronic
1069864627 10:71494352-71494374 ATGTGACTCCAGCAGAGGGAAGG + Intronic
1071044029 10:81351708-81351730 TTATACACCCAGTAAAGGGATGG - Intergenic
1073608235 10:104917036-104917058 AAGTACACCCAGCAAAGGGAGGG + Intronic
1073782664 10:106856602-106856624 TCGTACTTCCAGCAGGGAGAGGG - Intronic
1073835642 10:107438010-107438032 TTGGGTTTCCAGCAGAGGGAGGG - Intergenic
1073845101 10:107545294-107545316 TAGGACTACCAGCAGAGGGAGGG + Intergenic
1076160001 10:128236418-128236440 CTGTGCATGCAGCAGAGGAAGGG + Intergenic
1078439271 11:11350748-11350770 TTAAACATCCAGCAGATGGTGGG - Intronic
1083163688 11:60870900-60870922 GTGTCCATCCAGCACAGAGACGG - Intronic
1083487352 11:62991998-62992020 TTATGGATCCAGCACAGGGAGGG + Intronic
1083731243 11:64653788-64653810 TTTTACATCCTTCACAGGGAGGG + Intronic
1084282714 11:68109035-68109057 TCATGCTTCCAGCAGAGGGAGGG + Intronic
1085351069 11:75798113-75798135 TGGTACACCCAGCTGGGGGAGGG + Intronic
1086436241 11:86783721-86783743 TTGTATATTCAACAGAGGGATGG + Intergenic
1088494366 11:110418694-110418716 TTGAACATGCAGGAGAAGGAGGG - Intergenic
1091437755 12:486148-486170 TTCTACTTCCAGCAGGGGGAGGG + Intronic
1092900819 12:13057911-13057933 TGTTACATCCAGGAGAGGGTGGG + Intronic
1093968127 12:25348366-25348388 TAGAAAATACAGCAGAGGGAAGG + Intergenic
1096523061 12:52194877-52194899 TTGTACATCCAGGAGGGAGTTGG - Intergenic
1097512419 12:60560395-60560417 TTGTACATTCAGTAGAGATAGGG + Intergenic
1097949303 12:65408930-65408952 TTGTGATTCCAGCAGGGGGAAGG - Intronic
1098405804 12:70124411-70124433 GTGTATACCCAGCAGTGGGATGG - Intergenic
1101437106 12:104673087-104673109 GTGTACATGGAGCAGAGAGATGG - Intronic
1102790381 12:115639572-115639594 TTGTATATCCAAGAGAAGGAGGG + Intergenic
1102997745 12:117362709-117362731 TTGCACATCCAGCAGGGGAGGGG + Intronic
1105629879 13:22152556-22152578 TTGTCCCTCTAGGAGAGGGAGGG - Intergenic
1107278633 13:38707538-38707560 TAAAAAATCCAGCAGAGGGATGG - Intronic
1109969470 13:69748037-69748059 TTGTATCTCCAGTAGAGAGATGG - Intronic
1111591468 13:90352949-90352971 TTCTACTTCCAGCAGGGGGAGGG + Intergenic
1112377224 13:98854561-98854583 TAGTACTTCCGGCAGTGGGAGGG + Intronic
1113192590 13:107767340-107767362 TTGGACATACAGCAGCAGGAGGG - Intronic
1113208974 13:107952499-107952521 GTATATATCCAGCAGTGGGATGG - Intergenic
1115450186 14:33539040-33539062 TTGTGTATCCTGCGGAGGGAGGG + Intronic
1115963453 14:38862329-38862351 TTGCACATGAAGCAGAGGAAAGG - Intergenic
1117714420 14:58566083-58566105 TTGTTCATGCAGGAGGGGGAAGG + Intergenic
1118524989 14:66630070-66630092 TATTACATCCAGAGGAGGGATGG + Intronic
1125808211 15:42513421-42513443 TTGTTCATCCAGCATAGTGATGG - Exonic
1128494939 15:68192275-68192297 TGGTAAATCCACCAGAGGGCCGG - Exonic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1128904534 15:71455198-71455220 TTCTACATCAGGCAGAAGGAGGG - Intronic
1129625263 15:77191345-77191367 TTCTACATCCAGCGGAGGCCAGG + Intronic
1130049734 15:80473847-80473869 ATGGACAGCCAGCAGAGTGAAGG - Intronic
1131586576 15:93702127-93702149 TTTTAAATCCAGCAAAGTGATGG + Intergenic
1131669320 15:94602441-94602463 TTACACATCCAGCAAATGGAAGG - Intergenic
1131971769 15:97900724-97900746 TTTTAAATGCAGGAGAGGGAGGG + Intergenic
1133406840 16:5531243-5531265 TTGTGGCTCCAGCAAAGGGATGG + Intergenic
1133463620 16:6008634-6008656 TTGAAGATGGAGCAGAGGGAAGG + Intergenic
1134662668 16:15996155-15996177 TTGTACATTTAGTAGAGAGAGGG + Intronic
1135346302 16:21691455-21691477 CTCCACATCCAGGAGAGGGAAGG + Intronic
1136069486 16:27779273-27779295 GTGTGCATCCTGCAGAGGGAAGG + Exonic
1136545255 16:30950782-30950804 CTGCACAGCCTGCAGAGGGAAGG + Intronic
1136931969 16:34426792-34426814 ATGCACATCCAGAAGAGTGAAGG + Intergenic
1136972603 16:34985023-34985045 ATGCACATCCAGAAGAGTGAAGG - Intergenic
1140001492 16:71029776-71029798 TTGTAGATGGAGCAGAGGGAAGG + Intronic
1140507890 16:75485843-75485865 CTGGACATCCAGCCGCGGGAGGG + Intronic
1142792185 17:2275838-2275860 TTGAACATCCAGCCTGGGGAGGG - Intronic
1143569940 17:7750553-7750575 ATGTACAACAAGCAGAGGGCAGG - Intronic
1145228584 17:21152608-21152630 TTGTGCTTCCAGCAGAGGGAGGG + Intronic
1145883568 17:28368290-28368312 GAGCACAGCCAGCAGAGGGAGGG - Intronic
1148318967 17:46733036-46733058 TTGTACGTCCAGCTCAGGGAGGG - Intronic
1150200060 17:63345812-63345834 TTTAACATCCAGCTCAGGGATGG + Intronic
1153115254 18:1647207-1647229 TTGTATATCTAGCATAGGCAGGG - Intergenic
1153935912 18:9921247-9921269 TTGTACTTCCAGAAAAGGGGTGG + Intronic
1156173310 18:34512550-34512572 TGGTGAATCCAGCAGATGGATGG + Intronic
1157199044 18:45643358-45643380 ATGTACCTCTAGGAGAGGGAGGG + Intronic
1162298833 19:9832224-9832246 TTGTATTTCCAGCAGAGACAAGG + Intergenic
1163196054 19:15721033-15721055 TTGTGCACCAAGCAGAGGGAAGG - Intergenic
1165508528 19:36251221-36251243 TTGTATATTCAGTAGAGGCAGGG + Intergenic
1165742462 19:38211965-38211987 CTGAACATCCCGCAGGGGGAGGG - Exonic
1166107546 19:40604855-40604877 TTGTTCAGCCATCAGAGGTACGG - Intronic
925518274 2:4709318-4709340 TTGGATATCCACCACAGGGATGG - Intergenic
926958193 2:18325153-18325175 TTTCACATCCATCAGATGGACGG - Intronic
928183503 2:29088208-29088230 TTATACACCCAGTAGAGAGATGG + Intergenic
929648911 2:43657906-43657928 TTGTAGATACAGAAGAAGGAGGG - Intronic
930963201 2:57286183-57286205 CTCTATATACAGCAGAGGGATGG + Intergenic
932098487 2:68874074-68874096 TTGTCCACCCAGCACAGGTATGG - Intergenic
941177085 2:162211181-162211203 ATCAACATCCAGCTGAGGGATGG - Intronic
942114054 2:172710685-172710707 TGGCACCTCCAGCAGAGGGCAGG - Intergenic
942281470 2:174368208-174368230 TAGTACATCCAGTTGATGGATGG - Intronic
943099339 2:183469683-183469705 GTATACATCTAGCAGTGGGATGG + Intergenic
943582595 2:189702255-189702277 TCATACTTCCAGCAGGGGGAGGG - Intronic
947031167 2:225797489-225797511 TTGTACCTCCAGAACAGGGAAGG - Intergenic
948365254 2:237450562-237450584 TTCCGCATCCTGCAGAGGGAGGG + Intergenic
948877102 2:240835410-240835432 TTGTTCTTCTAGCAGAGGAATGG - Intergenic
1171337011 20:24394049-24394071 GGGCACAACCAGCAGAGGGAGGG - Intergenic
1173478313 20:43379012-43379034 TAGTTCATCTACCAGAGGGAGGG - Intergenic
1175942106 20:62542191-62542213 TGGGGCATCGAGCAGAGGGACGG + Intergenic
1178640926 21:34344316-34344338 CTGCACATGTAGCAGAGGGAAGG - Intergenic
1178697028 21:34802065-34802087 TTGTACATTAAGCAGAGTCAGGG + Intronic
1178853674 21:36233394-36233416 TGCCACATCCAGCAGAGGGGTGG + Intronic
1181716553 22:24734712-24734734 TAGTGCTTCCAGCAGGGGGAGGG + Intronic
1181890393 22:26057873-26057895 TTGAACACCTATCAGAGGGAGGG + Intergenic
1182862306 22:33570701-33570723 TTGGAGATCTACCAGAGGGAGGG - Intronic
1183685487 22:39359171-39359193 CTCTACACCCAGCAGAGGGAGGG - Intronic
1184894210 22:47397687-47397709 GTGTGCAGCCAGCAGAGGGTGGG - Intergenic
950439449 3:13000645-13000667 AGGTATATGCAGCAGAGGGAAGG + Intronic
951035043 3:17923503-17923525 CTGCACATCAAGCAGAGGGTGGG - Intronic
951177370 3:19617676-19617698 TTATATACCCAGCAGTGGGATGG + Intergenic
951537476 3:23752680-23752702 TTGTACTTTTAGCAGAGAGAGGG + Intergenic
951840061 3:27024648-27024670 CTGTAAGTGCAGCAGAGGGAAGG - Intergenic
957050414 3:75407416-75407438 TTTTACATGCTGCAGAGGGGAGG + Intergenic
957895776 3:86420001-86420023 TTTTAAATCCAGAAGATGGAGGG - Intergenic
958101879 3:89021927-89021949 TTGTACATCCTGCAGAAAGCTGG - Intergenic
958557650 3:95701097-95701119 GTATATATCCAGCAGTGGGATGG - Intergenic
960168566 3:114432034-114432056 TTATACAGACAGCAGAGAGAGGG + Intronic
960439692 3:117671498-117671520 TTGTATATCCAGAGGAGGGCTGG - Intergenic
961882714 3:130073860-130073882 TTTTACATGCTGCAGAGGGGAGG + Intergenic
963811374 3:149780014-149780036 TTGTAAGGCCAGGAGAGGGAGGG + Intronic
965930182 3:174032707-174032729 TTGTGCCCCCAGCAGAGGAAAGG + Intronic
966495248 3:180572831-180572853 TTGTCCATCTAGCAGAAGTAGGG - Intergenic
966891957 3:184413634-184413656 TAGCACATCAAGCAGAGTGAGGG - Intronic
967081013 3:186049519-186049541 CTGAACAACCAGCAGAGAGAAGG - Intronic
968072050 3:195790207-195790229 TTCCACACCCAGCAGAGTGAAGG - Exonic
969268724 4:6084143-6084165 TTGTACATTTAGTAGAGGCAGGG - Intronic
969623857 4:8292656-8292678 GTGTACATCCAGGGCAGGGAGGG - Intronic
969706360 4:8794303-8794325 TGGTCCAATCAGCAGAGGGAGGG + Intergenic
969872587 4:10114140-10114162 ATCTACATCCAGCCCAGGGAGGG + Intronic
971613688 4:28759780-28759802 TTGTACATTCAGGAGAGAAAGGG + Intergenic
972259619 4:37395270-37395292 TTGTACAACCAGCATACTGAAGG + Intronic
972259722 4:37396075-37396097 TTGTACAACCAGCATACTGAAGG - Intronic
973145293 4:46818229-46818251 TTGCACATCCAGCAGAAGGTGGG + Intronic
973875855 4:55217750-55217772 TTTTACTTCCAGCCCAGGGAGGG - Intergenic
975115538 4:70676731-70676753 TTGTAGCTGCAGCAGAGTGAGGG + Intronic
975180502 4:71338974-71338996 TTTTTCATACAGCAGTGGGAGGG - Intronic
979304545 4:119127354-119127376 TTGTACTTTTAGCAGAGGCAGGG + Intergenic
979928033 4:126592305-126592327 TCATGCTTCCAGCAGAGGGAGGG + Intergenic
983228081 4:165103838-165103860 TTGTATTTTCAGTAGAGGGAGGG + Intronic
984045785 4:174796707-174796729 TTGTACTTTCAGCAGAGACAGGG + Intronic
985313777 4:188632362-188632384 TTGTACTTCCAGCAGGGGGTGGG + Intergenic
986546465 5:8903468-8903490 TTGTACAACCTGCACGGGGAGGG - Intergenic
987396540 5:17430140-17430162 TGGTGCAGCCTGCAGAGGGATGG + Intergenic
992806591 5:80343846-80343868 TTGTATTTTCAGCAGAGGCAGGG - Intergenic
994869837 5:105333697-105333719 ATATACACCCAGCAGTGGGATGG + Intergenic
996837585 5:127810937-127810959 ATGGACATGGAGCAGAGGGAAGG - Intergenic
996924597 5:128809547-128809569 TTATCCTTCCAGCAGAAGGAGGG - Intronic
999546334 5:152632657-152632679 GTTTCCATCCAGCATAGGGAGGG + Intergenic
1001342143 5:170857121-170857143 TTGGGAATCCAGCAGAGGGCAGG - Intergenic
1001458311 5:171885224-171885246 TTGTGTTTCCAGCAGCGGGAAGG - Intronic
1003785893 6:9486677-9486699 TTGACCTTCCAGCAGAGTGAGGG + Intergenic
1004299183 6:14441738-14441760 CTGTTTATCCAGCACAGGGAAGG - Intergenic
1005128882 6:22480096-22480118 TAGTGCTTCTAGCAGAGGGAGGG + Intergenic
1007473830 6:42106618-42106640 TTGTAAACCCAGCAGGTGGATGG + Exonic
1007621310 6:43216471-43216493 TAGTGCATGCAGCAGAGAGAGGG - Exonic
1008851915 6:56032739-56032761 TTGTGCTTCCAGCAGAGGGAGGG - Intergenic
1009197201 6:60701473-60701495 TTCTCCATCCAAAAGAGGGAGGG + Intergenic
1009947882 6:70360919-70360941 GTGTATATCCAGTAAAGGGATGG - Intergenic
1012080456 6:94751216-94751238 TTGTACAGCCTGCAGAGCCAAGG + Intergenic
1013688860 6:112616589-112616611 TAGGACATCCAGCAGAGTGGGGG - Intergenic
1015881103 6:137870690-137870712 CTGTCCTTCCAGCATAGGGAGGG + Intronic
1018052879 6:160026904-160026926 TTGTACCTCAAGCAGAGGATGGG + Intronic
1018700244 6:166420569-166420591 TTGTCCAGCCTGCAGAAGGAAGG - Intronic
1018870944 6:167781669-167781691 GTGAACATCCAGAAGAGAGAAGG + Intergenic
1018946570 6:168350790-168350812 ATCTATATCCAGCAGAGGAAAGG + Intergenic
1019604711 7:1902702-1902724 CTGTACGTCCTGCAGTGGGAAGG + Intronic
1020062208 7:5160945-5160967 TCGTGCCTCCAGCAGGGGGAGGG + Intergenic
1020165936 7:5807732-5807754 TCGTGCCTCCAGCAGGGGGAGGG - Intergenic
1023333959 7:39149025-39149047 TTGAAGATCCAGGAGAGGGAGGG + Intronic
1023931223 7:44707802-44707824 AGGCACATGCAGCAGAGGGATGG + Intronic
1024185521 7:46944717-46944739 TTGTACTTCTAGCAGAGATAGGG + Intergenic
1027142192 7:75666340-75666362 TTGTACATTCAGTAGAGACAGGG + Intronic
1027982458 7:85243251-85243273 TTGTGGTTCCAGCAAAGGGAAGG - Intergenic
1028325441 7:89518515-89518537 TTGGTCATGCAGCAGAGGGATGG - Intergenic
1029204450 7:98860529-98860551 GTGTTCATGCAGCAGGGGGAGGG - Intronic
1034989151 7:155536647-155536669 CTGTTCATCCAGCAGGTGGATGG - Intergenic
1035927388 8:3743078-3743100 TTGTTTATCCAGCAGTGAGATGG - Intronic
1041305319 8:56451540-56451562 TTGTGCTTCAAGCAGTGGGAGGG + Intergenic
1047056805 8:121174134-121174156 TTATTCCTCCAGCCGAGGGATGG - Intergenic
1048083663 8:131155307-131155329 TTCTACTTCCTGCTGAGGGAGGG + Intergenic
1048727060 8:137398536-137398558 TCATACTTCCAGCAGGGGGAGGG - Intergenic
1050109779 9:2202202-2202224 TTGTATTTCCAGCAGTGGGAAGG + Intergenic
1051783247 9:20713268-20713290 ATGTGCATACAGCAGAGTGAAGG - Intronic
1051981393 9:23023803-23023825 TAGTATTTCCAGCAGAGGAAAGG - Intergenic
1053449515 9:38181306-38181328 TATCACATTCAGCAGAGGGAGGG - Intergenic
1053595907 9:39561368-39561390 TTGGAGACCCAGCAGAGGTAAGG - Intergenic
1053853874 9:42318009-42318031 TTGGAGACCCAGCAGAGGTAAGG - Intergenic
1054570353 9:66803647-66803669 TTGGAGACCCAGCAGAGGTAAGG + Intergenic
1054936047 9:70688727-70688749 TTGTTCACCAAGCAGAGGGAAGG - Intronic
1058365712 9:104206144-104206166 TTGTGCTTCCAGCAGAGGGAGGG + Intergenic
1058690248 9:107514305-107514327 TTGTAGAGACAGCAGGGGGAGGG - Intergenic
1061100265 9:128486814-128486836 TTGTACCCCCAGCAGGGGGCTGG - Intronic
1061712364 9:132497208-132497230 CTGGACTGCCAGCAGAGGGAAGG + Intronic
1062030417 9:134359655-134359677 CTATTTATCCAGCAGAGGGAGGG - Intronic
1187670267 X:21659110-21659132 TTGTTCATGCTGCAAAGGGATGG - Intergenic
1187791785 X:22958303-22958325 TTGTAGATCAGGGAGAGGGAGGG + Intergenic
1188265561 X:28068922-28068944 GTATATATCCAGCAGTGGGATGG + Intergenic
1189234691 X:39478027-39478049 TTGTAAAGCCCGCAGAGGGAAGG - Intergenic
1190400430 X:50028310-50028332 TTCTGCTTCCAGCAGGGGGAGGG - Intronic
1190832352 X:54070642-54070664 TTCTATATCCAGCAAAGGAAGGG - Exonic
1190883476 X:54510413-54510435 TTGTACTTCCAGCAAAGGAATGG - Intergenic
1192188467 X:68974885-68974907 TCATACTTCCAGCAGTGGGAGGG - Intergenic
1196609991 X:117701741-117701763 TTATATATTCAGCAGTGGGATGG - Intergenic
1196723759 X:118878058-118878080 TGGTACATCCACCAGAGGGTGGG + Intergenic
1197328539 X:125124388-125124410 CTGTACATCTAGTAGAAGGATGG + Intergenic
1198069137 X:133130578-133130600 CAGTACTTCCAGCAGTGGGAAGG - Intergenic
1199474970 X:148235065-148235087 GTGTATACCCAGCAGTGGGATGG - Intergenic
1200110854 X:153740221-153740243 TTCTACATCCCGCAGAGGTAAGG + Exonic
1200372283 X:155739648-155739670 TGTTACATCCAGGTGAGGGAGGG + Intergenic
1200855169 Y:7930178-7930200 TTGTACACCCTGCATAGAGAAGG - Intergenic