ID: 916779601

View in Genome Browser
Species Human (GRCh38)
Location 1:168010389-168010411
Sequence ATCTAGAGGGGTCACAGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 108}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916779596_916779601 -7 Left 916779596 1:168010373-168010395 CCCTGAAGAATGGTAAATCTAGA 0: 1
1: 0
2: 0
3: 11
4: 191
Right 916779601 1:168010389-168010411 ATCTAGAGGGGTCACAGTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 108
916779597_916779601 -8 Left 916779597 1:168010374-168010396 CCTGAAGAATGGTAAATCTAGAG 0: 1
1: 0
2: 1
3: 13
4: 127
Right 916779601 1:168010389-168010411 ATCTAGAGGGGTCACAGTGTTGG 0: 1
1: 0
2: 0
3: 5
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916779601 Original CRISPR ATCTAGAGGGGTCACAGTGT TGG Intronic
901662869 1:10809643-10809665 ATCTAGAGGATTTAAAGTGTTGG - Intergenic
904494885 1:30880942-30880964 ACCTGGAGGGGGCACAGTGAGGG - Intronic
905781177 1:40711156-40711178 ATCTAGAGGGTTCTTAGTGAAGG + Intronic
909022353 1:70446244-70446266 ATCTAGTCTGGTCACAGTGATGG + Intergenic
916779601 1:168010389-168010411 ATCTAGAGGGGTCACAGTGTTGG + Intronic
917452427 1:175158147-175158169 AACTAGAGGAGTCCCAGTGCAGG - Intronic
919129001 1:193431020-193431042 ATCTATAGGGGTGGCAGTGGTGG + Intergenic
921188591 1:212690689-212690711 AGCTAGAGGGGTCATATTTTTGG - Intronic
921862592 1:220055117-220055139 AGATAGATGGGTTACAGTGTAGG + Intergenic
922988310 1:229883962-229883984 GACTAAAGGGGACACAGTGTTGG + Intergenic
1070288305 10:75099384-75099406 ACCTGGAGAGGTCACAGTGGGGG - Intronic
1070797639 10:79226163-79226185 ATCTGGAGGAGTCATAGGGTTGG - Intronic
1072501926 10:96026276-96026298 AGAGAGAGGGGACACAGTGTGGG - Intronic
1073842736 10:107516604-107516626 ATCTAGAGGAATCACAGTAGAGG - Intergenic
1075219463 10:120572136-120572158 TTTTGGAGGGGTCACAGTGGTGG + Intronic
1077544678 11:3164338-3164360 GTATGGAGGGGTCACAGGGTGGG - Intronic
1078440307 11:11359573-11359595 AACTGGAGGGGTAACAGTGGAGG - Intronic
1081078139 11:38701741-38701763 ATCTTGAGAGATCACAGTATGGG - Intergenic
1084936948 11:72592013-72592035 ATCTAGAGGGGGGAAGGTGTGGG - Intronic
1089302530 11:117507331-117507353 ATCCAGAGTGGCCACAGTGGGGG + Intronic
1109129259 13:58560581-58560603 ATCAAGAGAGGTTACAGTGAGGG - Intergenic
1109769775 13:66955498-66955520 AACAAAAGGGGTCACATTGTTGG + Intronic
1111775808 13:92659979-92660001 TTCTAGAGGGCTAACAGTGATGG - Intronic
1112234041 13:97619188-97619210 AGCAAGAGGGTTCACAGTTTGGG - Intergenic
1112461322 13:99606199-99606221 ATCTAGAGTGGTCAAAGTGCAGG - Intergenic
1115753122 14:36509552-36509574 ATATAGCTGGGTCACAGTGATGG - Intronic
1117147723 14:52852061-52852083 TTCCAAATGGGTCACAGTGTTGG - Intergenic
1118924289 14:70177835-70177857 ACCTAGAGTGATGACAGTGTGGG + Intronic
1120382270 14:83795567-83795589 ATTTCCAGGGGTCACAGGGTGGG + Intergenic
1123467928 15:20529916-20529938 ATCCAGAGTGCTCACAGTGCAGG - Intergenic
1123650185 15:22471126-22471148 ATCCAGAGTGCTCACAGTGCAGG + Intergenic
1123728242 15:23125125-23125147 ATCCAGAGTGCTCACAGTGCAGG - Intergenic
1123740591 15:23279968-23279990 ATCCAGAGTGCTCACAGTGCAGG + Intergenic
1123746407 15:23322590-23322612 ATCCAGAGTGCTCACAGTGCAGG - Intergenic
1124278674 15:28345907-28345929 ATCCAGAGTGCTCACAGTGCAGG - Intergenic
1124304026 15:28565701-28565723 ATCCAGAGTGCTCACAGTGCAGG + Intergenic
1124532907 15:30522176-30522198 ATCCAGAGTGCTCACAGTGCAGG + Intergenic
1124765749 15:32485468-32485490 ATCCAGAGTGCTCACAGTGCAGG - Intergenic
1124969588 15:34473278-34473300 TTCTAGAGGGCTAACAGTGATGG - Intergenic
1125522700 15:40357075-40357097 ATCTAGAGGTGTAGAAGTGTTGG - Intergenic
1135716268 16:24770983-24771005 TTCCAGAGGTGACACAGTGTGGG + Intronic
1138008617 16:53358620-53358642 ATCCAGAGTGCTCACAGTGCAGG - Intergenic
1138113528 16:54342633-54342655 ACCTAGAGGGGTCATGGGGTGGG + Intergenic
1139285434 16:65809276-65809298 ATTTTGAAGGGTCTCAGTGTGGG - Intergenic
1141779817 16:86152052-86152074 TTCTAGAGGGGACACAGTCTAGG + Intergenic
1142513236 17:410855-410877 ATCTGTAGGGGTCTCTGTGTGGG - Intronic
1146940224 17:36839335-36839357 CTCCTGAGGGGTCACAGTGAGGG - Intergenic
1148498994 17:48074750-48074772 ATCTAGAGTGGAAAGAGTGTGGG - Intronic
1149577323 17:57723603-57723625 AGCCAGAGAGGTCACAGTGGAGG + Intergenic
1161014505 19:1977095-1977117 ATCCAGCTGGGTCACCGTGTTGG - Intronic
1164916501 19:32056503-32056525 TACAAGAGAGGTCACAGTGTAGG - Intergenic
927554211 2:24021273-24021295 ATCCACAGGGCTCAGAGTGTGGG - Intronic
928394843 2:30935638-30935660 ATTTATAGGGATGACAGTGTGGG + Intronic
933482236 2:82871941-82871963 ATCTGGAGGGGTCACATTACTGG - Intergenic
935953730 2:108353848-108353870 ATCTAAAGATGCCACAGTGTGGG - Intergenic
939164214 2:138622585-138622607 ATCTTAAGGGGAAACAGTGTAGG + Intergenic
1169750041 20:8982329-8982351 ATCACAAGGGGTCACAGTCTAGG - Intergenic
1170899391 20:20446132-20446154 ATCCAAAGAGGTCACAGTTTGGG - Intronic
1172590304 20:36113043-36113065 AGCTAAAGGGGTTGCAGTGTGGG + Intronic
1174181875 20:48680062-48680084 AGCCAGAGGGGTCCCAGTGCAGG - Intronic
1178995996 21:37400345-37400367 ATTTATAGGTTTCACAGTGTAGG + Intronic
1179256781 21:39723580-39723602 ATTCAGAGAGGTCACAGAGTGGG + Intergenic
1179320160 21:40283849-40283871 ATCCAGAGGGGTCCCCTTGTAGG + Intronic
1180978914 22:19869510-19869532 ACCTACAAGGGTCACAATGTGGG - Intergenic
1182397256 22:30045572-30045594 ACCTACTGAGGTCACAGTGTGGG + Intergenic
1182784217 22:32893148-32893170 ATGAAGAAGGGTCAGAGTGTTGG - Intronic
952062929 3:29532437-29532459 ATGTACAGTGGGCACAGTGTTGG - Intronic
952458769 3:33501963-33501985 ATATAGAGGGCTAACAGTGAGGG - Intronic
954090022 3:48276835-48276857 TTCTAAAGGGGGCACAGGGTTGG - Intronic
957414327 3:79881587-79881609 ATCTGTAGGGTGCACAGTGTGGG + Intergenic
957744518 3:84321716-84321738 ATCTAGAGGGGTAAAATTATTGG - Intergenic
958970332 3:100603865-100603887 TTCCAGTGGGGTCACAGTGCAGG + Intergenic
962382329 3:134908227-134908249 ATCTAGAGGCTTCAGTGTGTCGG + Intronic
964290859 3:155178736-155178758 ATCTAGAGGTGACAAAGTATAGG - Intronic
964612000 3:158624938-158624960 TTCTAAAGGGGTCGCAGGGTTGG + Intergenic
968128207 3:196175685-196175707 GTGTTGAGGGGTCACAGGGTGGG + Intergenic
971482767 4:27128829-27128851 AGCCAGAGGGGTATCAGTGTAGG - Intergenic
973310682 4:48706432-48706454 ACCTAGAGGGGTCAAACTCTTGG + Intronic
977836039 4:101647413-101647435 AGCAAGAGGGGCCACAGTGTGGG + Intronic
978061505 4:104345226-104345248 CTCTAGAGGAGACCCAGTGTGGG - Intergenic
990137408 5:52663276-52663298 ATCTGGAGTGGTCAGACTGTGGG + Intergenic
990701731 5:58481787-58481809 CTCTATAGGGGTAACAGTGAGGG + Intergenic
996312713 5:122124933-122124955 ATCCAGAGAGCTGACAGTGTTGG - Intergenic
996840485 5:127842728-127842750 ATCTAGAGGGGTGAACATGTTGG - Intergenic
1002854058 6:1022229-1022251 ACCTAAAGGGTGCACAGTGTTGG - Intergenic
1005843054 6:29757036-29757058 ATGGAGAGGGGTGACAGTGCAGG - Intergenic
1006398906 6:33804543-33804565 ATGCAGAGGGGTGACAGTGTAGG + Intergenic
1012134659 6:95541319-95541341 CTATAGAGAGGACACAGTGTTGG + Intergenic
1014733683 6:125066369-125066391 GACTAGAGGAGTCACAGAGTGGG - Intronic
1015691090 6:135924348-135924370 ATCTAGAGGGAGCAGAATGTGGG - Intronic
1022456996 7:30566257-30566279 ATCTAGATGGGTCCAAGTGCTGG + Intergenic
1023920623 7:44626770-44626792 GTCTCCAGGGGGCACAGTGTGGG + Intronic
1024707133 7:51972793-51972815 ATCTAGAGTGGTCAATGGGTGGG + Intergenic
1026209872 7:68294680-68294702 GTCTGGAGGGGTCACACTGTGGG - Intergenic
1031509476 7:122631713-122631735 ATTTGGAGGGGGTACAGTGTAGG + Intronic
1032343390 7:131096922-131096944 ATCAAGACTGGTCTCAGTGTAGG - Intergenic
1033781464 7:144675294-144675316 GTCTACAGGGGACACGGTGTGGG + Intronic
1038307059 8:26414429-26414451 ATATAGAGGGGCCAATGTGTAGG + Intronic
1039180896 8:34864834-34864856 ATCTAGTGTGGTGACAGTGAGGG - Intergenic
1039945294 8:42123590-42123612 AACTGGAGGGGTCACAGTAAGGG - Intergenic
1047703546 8:127474003-127474025 TTCTAGAGGCCTCACAGTGAAGG - Intergenic
1048083452 8:131153246-131153268 ATGTTGAAGGCTCACAGTGTGGG - Intergenic
1048660739 8:136598266-136598288 ATCTATAGATATCACAGTGTTGG + Intergenic
1049342329 8:142119816-142119838 GTCTAGCGGGGTCACAGAGATGG - Intergenic
1051358386 9:16260665-16260687 TTCTATAGTGGTCACAGTTTAGG + Intronic
1186038029 X:5445736-5445758 ATCTAGATGGGTCCAAGTGCTGG - Intergenic
1187056035 X:15742216-15742238 ATCCAGAGATGTCACAGTGGAGG - Intronic
1188895247 X:35659358-35659380 ATCCTGAGGGGTCCCAGTCTCGG - Intergenic
1189444398 X:41067229-41067251 ATCCACTGGGATCACAGTGTGGG + Intergenic
1196982659 X:121232053-121232075 ATCTGGCGGGGTCACAGGGGTGG + Intergenic
1199494603 X:148439133-148439155 AGCTAGAGGGATCACAGTAGAGG + Intergenic
1199668028 X:150117510-150117532 CTCTAGAGGGATGACAGTGAGGG - Intergenic
1200355060 X:155540227-155540249 ATTTTGATGGGTCTCAGTGTAGG - Intronic
1201737775 Y:17288056-17288078 ATCTAGATGGGTCCAAGTGCTGG - Intergenic