ID: 916785822

View in Genome Browser
Species Human (GRCh38)
Location 1:168086457-168086479
Sequence CCTACTTTCCAGAAAATGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1271
Summary {0: 1, 1: 0, 2: 1, 3: 78, 4: 1191}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916785822_916785832 17 Left 916785822 1:168086457-168086479 CCTTACATTTTCTGGAAAGTAGG 0: 1
1: 0
2: 1
3: 78
4: 1191
Right 916785832 1:168086497-168086519 TCCAAGAGGGAAAGACTGGAGGG 0: 1
1: 0
2: 2
3: 40
4: 356
916785822_916785825 3 Left 916785822 1:168086457-168086479 CCTTACATTTTCTGGAAAGTAGG 0: 1
1: 0
2: 1
3: 78
4: 1191
Right 916785825 1:168086483-168086505 CCTGTACCCCACTCTCCAAGAGG 0: 1
1: 0
2: 0
3: 19
4: 211
916785822_916785830 13 Left 916785822 1:168086457-168086479 CCTTACATTTTCTGGAAAGTAGG 0: 1
1: 0
2: 1
3: 78
4: 1191
Right 916785830 1:168086493-168086515 ACTCTCCAAGAGGGAAAGACTGG 0: 1
1: 0
2: 0
3: 17
4: 205
916785822_916785826 4 Left 916785822 1:168086457-168086479 CCTTACATTTTCTGGAAAGTAGG 0: 1
1: 0
2: 1
3: 78
4: 1191
Right 916785826 1:168086484-168086506 CTGTACCCCACTCTCCAAGAGGG 0: 1
1: 0
2: 1
3: 11
4: 151
916785822_916785831 16 Left 916785822 1:168086457-168086479 CCTTACATTTTCTGGAAAGTAGG 0: 1
1: 0
2: 1
3: 78
4: 1191
Right 916785831 1:168086496-168086518 CTCCAAGAGGGAAAGACTGGAGG 0: 1
1: 0
2: 4
3: 22
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916785822 Original CRISPR CCTACTTTCCAGAAAATGTA AGG (reversed) Intronic
900062454 1:699484-699506 CCTAGATTTCAGAGAATGTATGG - Intergenic
900817348 1:4858686-4858708 CCTAGATTTCAGAAGATGTATGG + Intergenic
901124680 1:6920658-6920680 CCTAGATTTCAGAAGATGTATGG - Intronic
901767388 1:11511852-11511874 CCTACATTTCAGAAGATATATGG - Intronic
903875196 1:26469211-26469233 CCTCCTTTCCTGATAATGAATGG + Exonic
904057399 1:27680441-27680463 CCTAGATTTCAGAAGATGTATGG - Intergenic
904228288 1:29043584-29043606 TCTAGATTCCAGAAAATGAAGGG + Intronic
904386154 1:30143477-30143499 CCTAGATTTCAGAAGATGTATGG - Intergenic
904561032 1:31397475-31397497 CCAACATTCCAGAAAGTGGATGG - Intergenic
904572033 1:31473443-31473465 CCTAGATTTCAGAAGATGTATGG - Intergenic
904965047 1:34365515-34365537 CCTGCATTCCAGACAAAGTAAGG + Intergenic
905262724 1:36730855-36730877 CCTCCTTCCCAGAAAAAGTGGGG - Intergenic
906040925 1:42787279-42787301 CCTACTTTCCAGGTAAAGCAAGG - Intronic
906372936 1:45269897-45269919 CCTAGATTTCAGAAGATGTATGG + Intronic
906736250 1:48131916-48131938 CCTAATATCCAGAATATATAAGG - Intergenic
906760472 1:48372722-48372744 CCTAGTTTTCAGAAGATGTATGG - Intronic
907555903 1:55344115-55344137 CCTAGATTTCAGAAGATGTATGG + Intergenic
907616764 1:55934086-55934108 CCTAGATTTCAGAAGATGTATGG - Intergenic
907625128 1:56022276-56022298 CTTAGATTTCAGAAAATGTATGG - Intergenic
907925668 1:58953315-58953337 CCTAGATTTCAGAAGATGTATGG + Intergenic
908004338 1:59712561-59712583 CCTAGATTTCAGAAGATGTATGG - Intronic
908542515 1:65135304-65135326 CCTCCTTTCTACAAAAAGTAAGG + Intergenic
908729208 1:67208641-67208663 CCTAGATTTCAGAAGATGTATGG + Intronic
908853389 1:68396026-68396048 CCTAGATTTCAGAAGATGTATGG - Intergenic
908879048 1:68710178-68710200 CCTAGATTTCAGAAGATGTATGG + Intergenic
908933052 1:69340430-69340452 CCTAGATTTCAGAAGATGTATGG + Intergenic
909063442 1:70905173-70905195 CCTAGATTTCAGAAGATGTATGG + Intronic
909081239 1:71115212-71115234 CCTACTGTGCAGAAAATGGTTGG + Intergenic
909104530 1:71392043-71392065 CCTAGGTTTCAGAAGATGTATGG + Intergenic
909192604 1:72573091-72573113 CCTAGATTTCAGAAGATGTATGG + Intergenic
909257211 1:73439183-73439205 CCTAGATTTCAGAAGATGTAGGG + Intergenic
909274415 1:73666264-73666286 CCTAGATTTCAGAAGATGTATGG + Intergenic
909632932 1:77786033-77786055 CCTAGATTTCAGAAGATGTATGG - Intronic
909755532 1:79220921-79220943 CCTAGATTTCAGAAGATGTATGG + Intergenic
910055843 1:83032258-83032280 CCTAGTTTTCAGAAGATGTATGG + Intergenic
910166880 1:84337350-84337372 CCTAGATTTCAGAAGATGTATGG - Intronic
910205568 1:84745786-84745808 ACTACTTTCTAGAAACTATAGGG - Intergenic
910256124 1:85249009-85249031 CCTAGATTTCAGAAGATGTATGG - Intergenic
910409393 1:86924536-86924558 CCTAGATTTCAGAAGATGTATGG - Intronic
910460602 1:87444581-87444603 CCTAGATTTCAGAAGATGTATGG - Intergenic
910492937 1:87793060-87793082 CCTACTTATCAGATAATGTTTGG + Intergenic
911358506 1:96849225-96849247 CCTAGATTTCAGAAGATGTATGG + Intergenic
911514223 1:98847289-98847311 CCTACTATCCAGAATCTATAAGG - Intergenic
911530367 1:99036752-99036774 CCTAGATTTCAGAAGATGTATGG - Intergenic
911840495 1:102675741-102675763 CCTAGATTTCAGAAGATGTATGG - Intergenic
911855717 1:102872426-102872448 CCTAGATTTCAGAAGATGTATGG - Intergenic
912043061 1:105416719-105416741 CCTAGATTTCAGAAGATGTATGG + Intergenic
912052062 1:105541886-105541908 CCTAGATTTCAGAAGATGTATGG - Intergenic
912112751 1:106363573-106363595 CCTAGATTTCAGAAGATGTATGG + Intergenic
912165675 1:107039910-107039932 CCTAGATTTCAGAAGATGTATGG + Intergenic
912182700 1:107237809-107237831 CCTAGATTTCAGAAGATGTATGG + Intronic
912263574 1:108132362-108132384 CCTAGATTTCAGAAGATGTATGG - Intergenic
912579137 1:110704557-110704579 CCTAGATTTCAGAAGATGTAAGG - Intergenic
912610133 1:111034381-111034403 CCTAGATTTCAGAAGATGTATGG + Intergenic
913081849 1:115395477-115395499 CCTAGATTTCAGAAGATGTATGG - Intergenic
913215741 1:116618853-116618875 CCTTCTTTGCAGGAGATGTATGG - Intronic
913459005 1:119063780-119063802 CCTAGATTTCAGAAAATGTATGG + Intronic
913709991 1:121473196-121473218 CCTAGATTCCAGAGGATGTATGG - Intergenic
914230521 1:145761591-145761613 CCTAGATTTCAGAAGATGTATGG + Intronic
914317837 1:146530849-146530871 CCTAGATTTCAGAAGATGTATGG - Intergenic
914496519 1:148202509-148202531 CCTAGATTTCAGAAGATGTATGG + Intergenic
915804347 1:158828843-158828865 CCTAGATTTCAGAAGATGTATGG - Intergenic
916411504 1:164551213-164551235 CCTAGATTTCAGAAGATGTATGG - Intergenic
916734799 1:167598177-167598199 CCTAGATTTCAGAAGATGTACGG - Intergenic
916785822 1:168086457-168086479 CCTACTTTCCAGAAAATGTAAGG - Intronic
916959228 1:169872376-169872398 CCTAGATTTCAGAAGATGTATGG + Intronic
917396618 1:174600998-174601020 CCTAGATTTCAGAAGATGTATGG - Intronic
917777455 1:178352749-178352771 CCTAGATTTCAGAGAATGTACGG - Intronic
917932671 1:179834137-179834159 CCTTGTTTCCAGAAAATGGAAGG + Intergenic
918049187 1:180959566-180959588 CCTAGATTTCAGAAGATGTATGG - Intergenic
918166050 1:181948782-181948804 CCTAGATTTCAGAAGATGTATGG + Intergenic
918314278 1:183309980-183310002 AGTACTTTCCTGAAAATATAGGG + Intronic
918831573 1:189405336-189405358 CCTAGATTACAGAATATGTATGG - Intergenic
919156792 1:193776001-193776023 CCTACATTTCAGAGGATGTATGG - Intergenic
919175164 1:194010474-194010496 CCTAGATTTCAGAAGATGTATGG + Intergenic
919194357 1:194264245-194264267 CCTAGATTCCAGAAGATGTATGG + Intergenic
919209083 1:194455878-194455900 CCTAGATTTCAGAAGATGTATGG - Intergenic
919290481 1:195623755-195623777 CCTAGTTTTCAGAAGATGTATGG + Intergenic
919314924 1:195960220-195960242 CCTACGTTTGAGAAAATATAGGG - Intergenic
919460550 1:197872041-197872063 CCTAGATTTCAGAAGATGTATGG - Intergenic
919554297 1:199031628-199031650 CCTAGATTTCAGAAGATGTATGG - Intergenic
919606475 1:199690279-199690301 CCTGCTAGCCAAAAAATGTAGGG - Intergenic
919933705 1:202237623-202237645 CCCACTTCCCAGAAAGTGTAGGG - Intronic
920734295 1:208516851-208516873 CCTAGATTTCAGAAGATGTATGG - Intergenic
920860313 1:209700270-209700292 CCTAGATTTCAGAAGATGTATGG - Intronic
920895925 1:210049344-210049366 CCTAGATTTCAGAAGATGTATGG - Intronic
921128037 1:212195537-212195559 CCTAAATTTCAGAGAATGTATGG + Intergenic
921424355 1:214984917-214984939 CCTAGATTTCAGAAGATGTATGG + Intergenic
921465085 1:215477596-215477618 CCTAGATTTCAGAAGATGTATGG - Intergenic
921792721 1:219308723-219308745 CCTAGATTTCAGAAGATGTATGG + Intergenic
922047733 1:221963045-221963067 CCCAAGTTCCAGAAAGTGTAGGG + Intergenic
922229632 1:223674375-223674397 CCTAGATTTCAGAAGATGTATGG - Intergenic
922320174 1:224480071-224480093 CCTAGATTTCAGAAGATGTATGG - Intronic
923072299 1:230577153-230577175 CCAGCTTTCTAGAAAATGTTTGG - Intergenic
923687379 1:236162765-236162787 CCTAGATTCCAGAAGATGTATGG + Intronic
923919336 1:238546092-238546114 CCTAGATTTCAGAAGATGTATGG - Intergenic
924830589 1:247590204-247590226 CCTTATTTCCAGAAAAAGAATGG - Intergenic
1063014706 10:2064339-2064361 CCTACATTTCAGATGATGTATGG - Intergenic
1063808982 10:9681700-9681722 CCTAGATTTCAGAGAATGTATGG + Intergenic
1064571863 10:16702161-16702183 CCTAGATTTCAGAGAATGTAGGG + Intronic
1064777926 10:18800345-18800367 CCTAATATCCAGAATCTGTAAGG + Intergenic
1064793725 10:18988321-18988343 CCTAGATTTCAGACAATGTATGG - Intergenic
1065409328 10:25406284-25406306 CTGACTTTCCAGAAGATGGAAGG - Intronic
1066040761 10:31546263-31546285 CCTAGATTTCAGAGAATGTATGG - Intergenic
1066451863 10:35537230-35537252 CCTAGATTTCAGAAGATGTATGG + Intronic
1067151046 10:43734876-43734898 AATCTTTTCCAGAAAATGTAAGG + Intergenic
1067659902 10:48226930-48226952 CCTCATTGCCAGAAACTGTAAGG - Intronic
1067782143 10:49215762-49215784 ACCACTTTCCATACAATGTAAGG - Intergenic
1067911456 10:50350760-50350782 CCTAAATTTCAGAAGATGTATGG + Intronic
1068055667 10:52010285-52010307 TCTAATTTCCAGAATCTGTAAGG + Intronic
1068175159 10:53447874-53447896 CCTAGATTTCAGAAGATGTATGG - Intergenic
1068198060 10:53744649-53744671 CCTAGATTTCAGAAGATGTATGG - Intergenic
1068264271 10:54626593-54626615 CCTAGATTTCAGAAAATATATGG + Intronic
1068374799 10:56164815-56164837 CCTAGATTTCAGAAGATGTATGG + Intergenic
1068416815 10:56734018-56734040 CCTAGATTTCAGAGAATGTATGG - Intergenic
1069173601 10:65262740-65262762 CCTAGATTTCAGAAGATGTATGG - Intergenic
1069175742 10:65286384-65286406 CCTACATTTCAGAAGATGTATGG - Intergenic
1069211030 10:65760489-65760511 CCTAGATTTCAGAAGATGTATGG - Intergenic
1069274864 10:66577205-66577227 CCTATTATCCAGAATCTGTAAGG - Intronic
1069368006 10:67713989-67714011 CCTAGATTTCAGAAGATGTACGG + Intergenic
1069471921 10:68700982-68701004 CATAATTTACATAAAATGTAAGG - Intergenic
1069577564 10:69541663-69541685 CCTAAATTTCAGACAATGTATGG - Intergenic
1070633508 10:78105635-78105657 CCTAGATTTCAGAAGATGTATGG + Intergenic
1070651862 10:78243268-78243290 CCTAGATTTCAGAAGATGTATGG + Intergenic
1071018948 10:81029595-81029617 CCTACATTTCAGAAGATGTATGG - Intergenic
1071098908 10:82012119-82012141 CCTAGATTTCAGAAGATGTATGG - Intronic
1071395410 10:85218725-85218747 CCTAGATTTCAGAAGATGTATGG + Intergenic
1072403687 10:95130023-95130045 CCTAAATTTCAGAAGATGTATGG + Intergenic
1072741253 10:97911282-97911304 CCTGCTTTGTAGAAAATGAAGGG - Intronic
1072788497 10:98300920-98300942 CCAACTATCCAGAGAATGGAAGG + Intergenic
1073401325 10:103259985-103260007 CCTAGATTTCAGAAAATGTATGG + Intergenic
1073922117 10:108470968-108470990 CCTAGGTTTCAGAAGATGTATGG - Intergenic
1073922959 10:108480610-108480632 CCTAGATTTCAGAGAATGTATGG + Intergenic
1074041412 10:109793296-109793318 CCTAGATTTCAGAAGATGTATGG - Intergenic
1074594671 10:114850775-114850797 TCTACTATGCAGAATATGTAAGG - Intronic
1074836809 10:117303849-117303871 CCTAGATTTCAGAAGATGTATGG + Intronic
1075277339 10:121106024-121106046 TCTACTTCCCAGAAAATTTGCGG + Intergenic
1075289620 10:121217185-121217207 CCTCCACTCCAGGAAATGTAGGG - Intergenic
1075810476 10:125221319-125221341 CCCACTTTCCAGAGAAAGTGGGG + Intergenic
1076926807 10:133494858-133494880 CCTAGATTTCAGAAGATGTATGG - Intergenic
1076967296 11:100738-100760 CCTAGATTTCAGAGAATGTATGG - Intergenic
1077735124 11:4782932-4782954 CCTAGATTTCAGAAGATGTATGG + Intronic
1077759806 11:5081521-5081543 ACTAATATCCAGAATATGTAAGG + Intergenic
1077942553 11:6859024-6859046 CCTAGATTTCAGAAGATGTATGG - Intergenic
1079147597 11:17867739-17867761 CCTAGGTTTCAGAAGATGTATGG - Intronic
1079457225 11:20646881-20646903 CAGACTTTCCAGAAGATGTTAGG - Exonic
1079559423 11:21803855-21803877 CCTAGATTTCAGAAGATGTATGG - Intergenic
1079644336 11:22844469-22844491 CCTAGATTTCAAAAAATGTATGG + Intergenic
1079657833 11:23003925-23003947 CCTAAATTTCAGAAGATGTATGG - Intergenic
1079673643 11:23198983-23199005 CCTAGATTTCAGAAGATGTATGG - Intergenic
1079686263 11:23363138-23363160 CCTAGATTTCAGAAGATGTAAGG - Intergenic
1079880571 11:25921892-25921914 CCTAGATTTCAGAAGATGTATGG - Intergenic
1079886828 11:26000816-26000838 CCTAGATTTCAGAAGATGTATGG - Intergenic
1079903996 11:26222622-26222644 CCTAATTTTCAGAGAATATACGG - Intergenic
1079980839 11:27150024-27150046 CCTAGATTTCAGAGAATGTATGG - Intergenic
1080088527 11:28315915-28315937 CCTAGATTTCAGAAGATGTATGG + Intronic
1080966219 11:37217721-37217743 CCTAGATTTCAGAGAATGTATGG - Intergenic
1080978954 11:37377294-37377316 CCTAGATTTCAGAAGATGTATGG - Intergenic
1080997258 11:37619128-37619150 CCTAGATTTCAGAAGATGTATGG + Intergenic
1081157786 11:39716225-39716247 CCTAGATTTCAGAAGATGTATGG + Intergenic
1081249676 11:40814208-40814230 CCTAGATTTCAGAAGATGTATGG - Intronic
1081309544 11:41553620-41553642 CCTAGATTTCAGAAGATGTATGG + Intergenic
1081315571 11:41625511-41625533 CCTAGATTTCAGAGAATGTATGG - Intergenic
1081437281 11:43040948-43040970 CCTAGATTTCAGAAGATGTATGG - Intergenic
1081479903 11:43476503-43476525 CCTAGATTTCAGAAGATGTACGG - Intronic
1081491940 11:43576062-43576084 CCTACTTTCCTCAGCATGTAGGG + Intronic
1081939439 11:46928345-46928367 CCTAGATTTCAGAAGATGTATGG + Intergenic
1082270696 11:50166726-50166748 CCTAGATTTCAGAGAATGTATGG + Intergenic
1082734268 11:56838878-56838900 CCTATATTTCAGAAGATGTAAGG - Intergenic
1082748497 11:56994017-56994039 CCTAGATTTCAGAGAATGTATGG - Intergenic
1082948859 11:58789099-58789121 CATAGTTTCCAGAGGATGTATGG - Intergenic
1083065239 11:59916952-59916974 CCTACATTTCAGAAGATGTGTGG - Intergenic
1084200195 11:67551924-67551946 CCTAGATTTCAGAAGATGTATGG + Intergenic
1084880731 11:72169762-72169784 CCTAGATTTCAGAAGATGTATGG + Intergenic
1085000339 11:73027963-73027985 CCTAGATTTCAGAGAATGTATGG + Intronic
1085194324 11:74659083-74659105 CCTAGATTTCAGAAGATGTATGG - Intronic
1085476385 11:76791790-76791812 CCTAGATTTCAGAAGATGTATGG + Exonic
1085588214 11:77731809-77731831 CCTAGATTTCAGAAGATGTATGG + Intronic
1085593957 11:77791149-77791171 CCTAGATTTCAGAAGATGTATGG - Intronic
1085755043 11:79195153-79195175 CCTAGATTTCAGAAGATGTATGG + Intronic
1085941829 11:81214093-81214115 CCTAGATTTCAGAAGATGTATGG - Intergenic
1086083989 11:82936422-82936444 CCTAATTTTCAGGAAATGTGGGG - Intronic
1086231724 11:84578105-84578127 CCTAGATTTCAGAAGATGTATGG + Intronic
1086750722 11:90490267-90490289 CCTAGTCTTCAGAAGATGTATGG + Intergenic
1086860443 11:91919111-91919133 TCTACTTTCCAGAAAATACTAGG + Intergenic
1087255556 11:95948681-95948703 CCTAGATTTCAGAAGATGTATGG - Intergenic
1087496286 11:98894219-98894241 CCTAGATTTCAGAAGATGTACGG - Intergenic
1088021971 11:105130627-105130649 CCTAGATTTCAGAAGATGTATGG - Intergenic
1088048384 11:105480611-105480633 CCTAGATTTCAGAAGATGTATGG + Intergenic
1088304029 11:108389274-108389296 CCTTCTTTCCAGCACATTTATGG - Intronic
1089284792 11:117398577-117398599 CCTAGATTTCAGAAGATGTATGG - Intronic
1089424130 11:118356772-118356794 CCTAGTTTCCCAAATATGTAAGG - Intergenic
1090431454 11:126649941-126649963 CCTAGATTTCAGAAAATGTATGG - Intronic
1090727380 11:129539997-129540019 CCTAGTTTTCAGAAGATGTCTGG - Intergenic
1091009424 11:131985076-131985098 CCTATTTTCAAGCAAATGAAGGG - Intronic
1091065699 11:132509725-132509747 CCTAGATTTCAGAAGATGTATGG + Intronic
1091982724 12:4879464-4879486 CCTAGATTTCAGAAGATGTATGG - Intergenic
1092093604 12:5823842-5823864 CCTAGATTTCAGAAGATGTATGG - Intronic
1092485808 12:8901227-8901249 CCTAGATTTCAGAAGATGTATGG - Intergenic
1092729888 12:11521006-11521028 AATATTTTCCAGAAACTGTATGG + Intergenic
1092853081 12:12648235-12648257 CCTAGATTTCAGAAGATGTATGG - Intergenic
1093141833 12:15518097-15518119 CCTAGATTTCAGAAAATGTATGG - Intronic
1093192574 12:16091963-16091985 CCTAGTTTTCAGAGGATGTATGG - Intergenic
1093202235 12:16202210-16202232 CCTAATATCCAAAACATGTAAGG + Intronic
1093207068 12:16263875-16263897 CCTAGGTTTCAGAAGATGTATGG + Intronic
1093581341 12:20787014-20787036 CCTAGATTTCAGAAGATGTATGG + Intergenic
1093590439 12:20895873-20895895 CCTAGATTTCAGAAGATGTATGG - Intronic
1094044259 12:26149982-26150004 CCTACCTTTCAGAAGATGTGAGG - Intronic
1094420266 12:30263745-30263767 CCTAGATTTCAGAAAATGTATGG + Intergenic
1094421996 12:30280573-30280595 CCTAGATTTCAGAAAATGTATGG + Intergenic
1094706069 12:32915564-32915586 CCTAGATTTCAGAAGATGTATGG + Intergenic
1095282095 12:40364605-40364627 CATAATTTCCTGAAAATGAAGGG + Intronic
1095623220 12:44283087-44283109 CCTAGATTTCAGAAGATGTATGG + Intronic
1096063317 12:48720119-48720141 CCTAGATTTCAGAAGATGTATGG - Intergenic
1096519473 12:52176101-52176123 GCCTCTTTCCAGAAAATGTCTGG - Intronic
1096988323 12:55777274-55777296 CCTAGTTTACAGTAAATATAGGG + Intronic
1097065127 12:56315351-56315373 TCTACTTTCCAGGAAATGGCCGG + Intronic
1097609918 12:61807372-61807394 CCTAGATTTCAGAAGATGTACGG + Intronic
1097618072 12:61907480-61907502 CCTAGATTTCAGAAGATGTATGG + Intronic
1097668827 12:62512834-62512856 CCTAGATTTCAGAAGATGTATGG - Intronic
1097966157 12:65583610-65583632 CCTAATCTCCAAAAAATGTAAGG - Intergenic
1098185109 12:67888595-67888617 AGTACCTTCCAGAAAATGAAAGG - Intergenic
1098238631 12:68443040-68443062 CCTAGATTTCAGAAGATGTATGG - Intergenic
1098253198 12:68590128-68590150 CCTAGATTCCAGAGGATGTATGG + Intergenic
1098478127 12:70929095-70929117 CCTACTTTCTAGAAATAGTGAGG - Intergenic
1098509176 12:71291737-71291759 CCTAGATTTCAGAAGATGTATGG - Intronic
1098649915 12:72952189-72952211 CCTAGATTTCAGAAGATGTATGG - Intergenic
1098679953 12:73340587-73340609 GCTAATTTCCAAAATATGTAAGG + Intergenic
1098683778 12:73394078-73394100 CATACTTTCCAGGAATTGTGTGG - Intergenic
1098837718 12:75442019-75442041 CCTAGATTTCAGAAGATGTATGG + Intergenic
1099008211 12:77260262-77260284 CCTAGATTTCAGAAGATGTATGG - Intergenic
1099060399 12:77901102-77901124 CCTAATATCCAGAATCTGTAAGG - Intronic
1099076305 12:78113422-78113444 CCTAGATTCCAGAGGATGTAAGG - Intronic
1099407901 12:82285405-82285427 CCTAGATTTCAGAAGATGTATGG + Intronic
1099707868 12:86180237-86180259 CCTAGATTTCAGAAGATGTATGG + Intronic
1100205494 12:92345096-92345118 CCTAAATTTCAGAACATGTATGG + Intergenic
1100427692 12:94502259-94502281 CCTAGATTTCAGAAGATGTATGG - Intergenic
1101113265 12:101506823-101506845 CCTAGATTTCAGAAGATGTATGG + Intergenic
1101340293 12:103837064-103837086 CCTAGATTTCAGAAGATGTATGG - Intronic
1101359028 12:104008936-104008958 CCTACATTTCAGAAGATGTATGG + Intronic
1102523186 12:113492203-113492225 CCTAGATTTCAGAAGATGTATGG + Intergenic
1102794721 12:115678957-115678979 CCTAGATTTCAGAAGATGTATGG + Intergenic
1103251314 12:119502341-119502363 CCTACTTCACAGAAAGTGTAAGG + Intronic
1103880771 12:124164213-124164235 CCTAGATTTCAGAAGATGTATGG - Intronic
1104209725 12:126677105-126677127 CCTATTTTCCACTAAATTTATGG - Intergenic
1105227341 13:18448340-18448362 CCTAGATTTCAGAAGATGTAAGG + Intergenic
1105609439 13:21955124-21955146 CCTAGATTTCAGAAGATGTATGG - Intergenic
1105682237 13:22740805-22740827 CCTACTATCCAGAATATACAGGG + Intergenic
1106614454 13:31314081-31314103 CCTAGATTTCAGAAGATGTATGG + Intronic
1106614726 13:31316019-31316041 CCTAGATTTCAGAGAATGTACGG + Intronic
1106678317 13:31984757-31984779 CCTAGATTTCAGAAGATGTATGG + Intergenic
1107105358 13:36636968-36636990 CCTAGATTTCAGAAGATGTATGG - Intergenic
1107188366 13:37549903-37549925 CCTAGTTTTCAGAGGATGTATGG + Intergenic
1107554767 13:41508000-41508022 CCTAGATTTCAGAAGATGTATGG - Intergenic
1108155889 13:47584285-47584307 CCTAGATTTCAGAAGATGTATGG - Intergenic
1108175781 13:47791167-47791189 CCTAGATTTCAGAAGATGTATGG + Intergenic
1108828919 13:54452708-54452730 CCTAGATTTCAGAAAATGTATGG - Intergenic
1108927408 13:55769972-55769994 CCTAGATTCCAGAGGATGTATGG + Intergenic
1108944381 13:56002924-56002946 CCTAGATTTCAGAAGATGTATGG - Intergenic
1109076768 13:57845871-57845893 CCTAGATTTCAGAATATGTATGG - Intergenic
1109189528 13:59308101-59308123 CCTAGATTTCAGATAATGTATGG - Intergenic
1109301785 13:60596905-60596927 CCTCCTTTCCTTTAAATGTAAGG + Intergenic
1109315049 13:60740325-60740347 CCTAGATTTCAGAAGATGTATGG - Intergenic
1109482455 13:62973829-62973851 CCTAGATTTCAGAAGATGTATGG - Intergenic
1109641969 13:65202903-65202925 CCTAGATTTCAGAAAATGTATGG + Intergenic
1109721086 13:66277325-66277347 CTTAGATTTCAGAAAATGTATGG + Intergenic
1109857825 13:68156366-68156388 CCTACATTTCAGAAGCTGTATGG - Intergenic
1109859556 13:68179556-68179578 CCTAGATTTCAGAAGATGTATGG + Intergenic
1109863006 13:68224944-68224966 CCTAGATTTCAGAAGATGTATGG - Intergenic
1110062683 13:71062447-71062469 CCTAGATTTCAGAGAATGTATGG - Intergenic
1110440564 13:75521236-75521258 CCTAGATTTCAGAGAATGTATGG + Intergenic
1110543137 13:76728045-76728067 CCTAGATTTCAGAAGATGTATGG + Intergenic
1110924342 13:81131685-81131707 CCTAGATTTCAGAAGATGTATGG + Intergenic
1110926863 13:81164599-81164621 CCTAGATTTCAGAAGATGTATGG - Intergenic
1110955332 13:81546536-81546558 CCTAGATTTCAGAGAATGTATGG - Intergenic
1111042541 13:82768127-82768149 CCTAGATTTCAGAAGATGTACGG + Intergenic
1111072565 13:83187829-83187851 GCTAGTTTTCAGAAGATGTATGG + Intergenic
1111092742 13:83468136-83468158 ACCAGTTACCAGAAAATGTAAGG + Intergenic
1111143833 13:84155966-84155988 CCTAGATTTCAGAAGATGTATGG + Intergenic
1111218811 13:85178694-85178716 CCTAGATTTCAGAAGATGTATGG - Intergenic
1111314302 13:86532627-86532649 GCTACTTACTAGAAAATTTAGGG + Intergenic
1111332936 13:86784192-86784214 TCTCCATTCGAGAAAATGTAAGG + Intergenic
1111360185 13:87166011-87166033 CTTTCCTTCCTGAAAATGTACGG + Intergenic
1111479946 13:88811197-88811219 CCTAGATTTCAGAAGATGTATGG + Intergenic
1111716648 13:91887108-91887130 CCTAGATTTCAGAGAATGTATGG - Intronic
1111819309 13:93194085-93194107 CCTAGATTTCAGAAGATGTATGG + Intergenic
1111873830 13:93868052-93868074 CCTACTCTGCAGAAAATCCATGG - Intronic
1111889935 13:94069119-94069141 CCTAGATTTCAGAAGATGTATGG - Intronic
1111955766 13:94756735-94756757 CCTAATATCCAGAATATGTAAGG - Intergenic
1111984392 13:95051181-95051203 CCTGCTTTCCAGCAACTGTGGGG - Intronic
1112101849 13:96198022-96198044 CCTAGATTTCAGAAGATGTATGG - Intronic
1112252227 13:97792841-97792863 CCTAGATTTCAGAAGATGTATGG - Intergenic
1112259313 13:97863797-97863819 CCTAGATTTCAGAAGATGTATGG - Intergenic
1112529246 13:100184400-100184422 CCTACTTAACAGAGAATTTATGG - Intronic
1112582715 13:100690402-100690424 CCTAGATTTCAGAAGATGTATGG + Intergenic
1112864142 13:103872602-103872624 CCTATATTTCAGAGAATGTATGG - Intergenic
1114171074 14:20273089-20273111 CCTAGATTTCAGAAGATGTATGG + Intronic
1114380515 14:22198691-22198713 CCTAGATTTCAGAAGATGTATGG + Intergenic
1114390328 14:22301299-22301321 TCTATTATCCAGAATATGTAAGG + Intergenic
1114893871 14:26961241-26961263 ACTACTTTCGAGAGAATTTAGGG - Intergenic
1114948413 14:27715966-27715988 CCTAGTTTTCAGAGGATGTATGG + Intergenic
1114991871 14:28298068-28298090 CCTAGATTTCAGAAGATGTACGG + Intergenic
1115050020 14:29047786-29047808 TTTACTTTCCAGACAATGCAGGG + Intergenic
1115134332 14:30090867-30090889 CCTAGTTTACAGAAGATGTGTGG - Intronic
1115199117 14:30834359-30834381 CCTAGATTTCAGAGAATGTATGG - Intergenic
1115840288 14:37462129-37462151 CCTAGATTTCAGAAGATGTATGG - Intronic
1115916548 14:38321399-38321421 CCTAGATTTCAGAAGATGTATGG - Intergenic
1115919381 14:38355577-38355599 CCTAGATTTCAGAAGATGTATGG + Intergenic
1115942226 14:38622284-38622306 CCTAGATTTCAGAAGATGTATGG + Intergenic
1115990017 14:39141619-39141641 CCTAGATTTCAGAAGATGTATGG - Intergenic
1116120524 14:40717485-40717507 CCTAGATTTCAGAAGATGTATGG + Intergenic
1116147942 14:41099668-41099690 CCTAGATTTCAGAAGATGTACGG + Intergenic
1116195162 14:41715947-41715969 CCTAGATTTCAGAAGATGTATGG - Intronic
1116523917 14:45881559-45881581 GCTACTTTCAAAAAAATGCAAGG + Intergenic
1116762097 14:49027128-49027150 CCTAGATTTCAGAAGATGTATGG + Intergenic
1117085489 14:52196429-52196451 CCTAGATTTCAGAAAATGTATGG + Intergenic
1117181962 14:53200507-53200529 CCTAGATTTCAGAAGATGTATGG + Intergenic
1117751668 14:58930143-58930165 CCTAGATTTCAGAAGATGTATGG - Intergenic
1117977274 14:61310825-61310847 CCTAGATTTCAGAAGATGTATGG - Intronic
1118069607 14:62231870-62231892 CCTACATTTCAGAAGATGTATGG + Intergenic
1118070893 14:62245775-62245797 CCTAGATTTCAGAAGATGTATGG + Intergenic
1118496089 14:66309220-66309242 CCTAGATTTCAGAAGATGTATGG - Intergenic
1118598019 14:67451160-67451182 CCTAGATTTCAGAAAATGTAGGG + Intronic
1118790472 14:69086973-69086995 CCTACTTTCAGCAAGATGTAGGG + Intronic
1119104255 14:71909151-71909173 TCTACTTACTAGAAACTGTAAGG - Intergenic
1119200554 14:72748861-72748883 CCTAGATTTCAGAAGATGTATGG + Intronic
1120060692 14:79978813-79978835 CCTAGATTTCAGAGAATGTATGG + Intergenic
1120104655 14:80480303-80480325 CCTAGATTTCAGAAGATGTATGG - Intronic
1120166655 14:81208382-81208404 CCTAGATTTCAGAAGATGTATGG + Intronic
1120393951 14:83944284-83944306 CCTAGGTTTCAGAACATGTATGG - Intergenic
1120556574 14:85935187-85935209 CCTAATATCCAGAATCTGTAAGG - Intergenic
1120731385 14:88006171-88006193 ATTTCTTTTCAGAAAATGTAGGG + Intronic
1122597525 14:102903646-102903668 CCTACTTTCTACACCATGTAGGG - Intronic
1123737556 15:23200138-23200160 CCTAGATTTCAGAGAATGTATGG - Intergenic
1123826999 15:24092373-24092395 CCTAGATTTCAGAGAATGTATGG - Intergenic
1123841600 15:24253237-24253259 CCTAGGTTTCAGAGAATGTATGG - Intergenic
1123851483 15:24361831-24361853 CCTAGGTTTCAGAGAATGTATGG - Intergenic
1123905571 15:24917226-24917248 CCTACTTACCTGGAAATTTATGG - Intronic
1124240671 15:28025274-28025296 CCTACCTTTCAGAAAACTTAGGG - Intronic
1124288769 15:28428800-28428822 CCTAGATTTCAGAGAATGTATGG - Intergenic
1124294456 15:28488513-28488535 CCTAGATTTCAGAGAATGTATGG + Intergenic
1124461385 15:29895399-29895421 TCTACCTTCCACAAAATGTGAGG + Intronic
1124695824 15:31863435-31863457 CCTAGATTTCAGAAGATGTATGG - Intronic
1125304219 15:38291564-38291586 CCTACATTTCAGAAGATATATGG - Intronic
1126411484 15:48377001-48377023 CCTAGATTTCAGAAGATGTATGG + Intergenic
1126528345 15:49683861-49683883 CCTACTTTCTCAAAAGTGTATGG - Intergenic
1127123929 15:55794161-55794183 CCTAGATTTCAGAAGATGTATGG + Intergenic
1127145006 15:56014654-56014676 CCTAGATTTCAGAAGATGTATGG - Intergenic
1127466991 15:59253797-59253819 ATTAATTTACAGAAAATGTAGGG + Intronic
1127576256 15:60295231-60295253 GCTAGATTCCAGAAGATGTATGG - Intergenic
1127955202 15:63847258-63847280 CCTAGATTTCAGAAGATGTATGG + Intergenic
1128124170 15:65178880-65178902 AGTAATTTACAGAAAATGTAGGG + Intronic
1128688831 15:69707723-69707745 CCTAGATTTCAGAAGATGTATGG - Intergenic
1128871411 15:71158685-71158707 GCTAATATCCAGAATATGTAAGG - Intronic
1130738972 15:86577857-86577879 CCTAGATTTCAGAAGATGTATGG + Intronic
1131470051 15:92688955-92688977 CCTAGATTTCAGAAGATGTATGG + Intronic
1131700923 15:94934677-94934699 CCTAGATTTCAGAAGATGTATGG - Intergenic
1131743647 15:95421371-95421393 CCTAGATTTCAGAAGATGTATGG - Intergenic
1131794422 15:95999800-95999822 CCTACTCTCTAGAGATTGTAGGG + Intergenic
1132303799 15:100793938-100793960 CCTAGATTTCAGAAGATGTATGG - Intergenic
1132440877 15:101863096-101863118 CCTAGATTTCAGAGAATGTATGG + Intergenic
1132599313 16:766955-766977 CTTGCTTTCCAGAACATGAACGG + Exonic
1133375452 16:5283185-5283207 CCTAGATTTCAGAAGATGTATGG + Intergenic
1134476084 16:14575063-14575085 CCTAGATTTCAGAAGATGTATGG + Intronic
1136602586 16:31304344-31304366 ACTACTATCCAGAAACTATAAGG - Intronic
1136709949 16:32228861-32228883 CCTACATTTCAGAGAATGTATGG + Intergenic
1136757960 16:32700550-32700572 CCTACATTTCAGAGAATGTATGG - Intergenic
1136810146 16:33169825-33169847 CCTACATTTCAGAGAATGTATGG + Intergenic
1136816622 16:33279905-33279927 CCTACATTTCAGAGAATGTATGG + Intronic
1137265855 16:46868428-46868450 CCTAGATTTCAGAGAATGTATGG - Intergenic
1138355901 16:56380125-56380147 CCTAGATTTCAGAAGATGTATGG - Intronic
1138921574 16:61536629-61536651 CCTAATTTCCAGAATCTATAAGG - Intergenic
1139263098 16:65614141-65614163 CCTAATATCCAGAATATATAAGG - Intergenic
1139356239 16:66368493-66368515 CCAACTTTGCAGAAAATGTGTGG - Intronic
1139812543 16:69634940-69634962 ACTACTTGTCAGAAAATGTTCGG - Intronic
1140623377 16:76763380-76763402 CCTAGATTTCAGAAGATGTACGG + Intergenic
1140723606 16:77792067-77792089 CCCACTTTGCAGATAATGTATGG - Intronic
1140854382 16:78964993-78965015 CCTAGTTTTCAGAAAATATATGG + Intronic
1141037811 16:80643586-80643608 CCTAGATTTCAGAAGATGTATGG - Intronic
1141273060 16:82558331-82558353 CCTAGATTTCAGAAGATGTATGG + Intergenic
1203060111 16_KI270728v1_random:960899-960921 CCTACATTTCAGAGAATGTATGG - Intergenic
1142905828 17:3041208-3041230 CCTTCCTCCCAGAAAATGTGAGG + Intergenic
1142909896 17:3079948-3079970 CCTAGGTTCCAGAGGATGTATGG - Intergenic
1142924606 17:3223861-3223883 CCTAGGTTCCAGAGGATGTATGG + Intergenic
1146149356 17:30453771-30453793 CCTAGATTTCAGAAGATGTATGG - Intronic
1146697374 17:34920003-34920025 CCTAGATTTCAGAAGATGTATGG + Intergenic
1146924919 17:36737625-36737647 GTTACTCTCCAGAAGATGTAAGG + Intergenic
1149037709 17:52154660-52154682 CTCACTTTTCTGAAAATGTAAGG - Intronic
1149110217 17:53019365-53019387 CCTAGATTTCAGAAGATGTATGG - Intergenic
1149201430 17:54190196-54190218 CCTTCTTTACTGAAAATGTTAGG + Intergenic
1149260712 17:54877125-54877147 CCTAGATTTCAGAAGATGTATGG + Intergenic
1149366791 17:55953147-55953169 CCTAGATTTCAGAAGATGTATGG + Intergenic
1149452228 17:56758797-56758819 CCTAGATTTCAGAAGATGTATGG + Intergenic
1150014555 17:61540520-61540542 TCTAATATCCAGAATATGTAAGG - Intergenic
1152700003 17:81814009-81814031 CCTGCTTTCCAGGACATGCACGG - Exonic
1153011941 18:547327-547349 CCTAGATTTCAGAAGATGTATGG - Intergenic
1153426871 18:4974880-4974902 CCTAGATTTCAGAATATGTATGG - Intergenic
1154313147 18:13282882-13282904 CCTAGATTTCAGAAGATGTATGG - Intronic
1154504354 18:15020750-15020772 CCTAGATTTCAGAAGATGTATGG - Intergenic
1154526037 18:15291136-15291158 CCTAGATTTCAGAAGATGTAAGG - Intergenic
1155384912 18:25266929-25266951 CCCACTTTCCAGGGAATGAACGG - Intronic
1155632129 18:27906181-27906203 CCTAGATTTCAGAAGATGTATGG - Intergenic
1155661957 18:28259811-28259833 TCTAATTTCCAGAATATATAAGG + Intergenic
1155809045 18:30208449-30208471 CCTAGATTTCAGAGAATGTATGG - Intergenic
1156153066 18:34266442-34266464 CCTAGATTTCAGAAGATGTACGG + Intergenic
1156265901 18:35488352-35488374 CCTACATTTCAGAGGATGTATGG - Intronic
1156283163 18:35661725-35661747 CCTAATTTACAGGAAATATACGG - Intronic
1156467570 18:37357430-37357452 CCTAGATTTCAGAAGATGTATGG + Intronic
1156516842 18:37687421-37687443 CCTGCTCTCCAGAAGCTGTAGGG - Intergenic
1156615006 18:38772655-38772677 CCTACATTTCAGAGGATGTATGG - Intergenic
1156809071 18:41225003-41225025 CCTAGATTTCAGAAGATGTATGG + Intergenic
1156817525 18:41328712-41328734 CCTAGATTTCAGAAGATGTATGG + Intergenic
1156940991 18:42766967-42766989 CCTAGATTTCAGAAGATGTATGG + Intronic
1157003084 18:43550384-43550406 CCTAGATTTCAGAAAATATATGG - Intergenic
1157400846 18:47385428-47385450 CCTAATATCCAGAATCTGTAAGG - Intergenic
1158056360 18:53285495-53285517 CCTAGATTTCAGAAAATGTATGG + Intronic
1158108234 18:53909432-53909454 TCTTCTTTCCAGATAATGGATGG - Intergenic
1158833275 18:61303497-61303519 CCTAGATTTCAGAAGATGTATGG + Intergenic
1159215574 18:65387030-65387052 CCTACATTTCAGAGGATGTATGG + Intergenic
1159410860 18:68073117-68073139 CCTAGATTTCAGAAGATGTATGG + Intergenic
1159705431 18:71679912-71679934 CCTAGATTTCAGAAGATGTATGG + Intergenic
1159761298 18:72430021-72430043 CCTAGATTTCAGAAGATGTATGG - Intergenic
1159838809 18:73372714-73372736 CCTAGATTTCAGAAGATGTATGG + Intergenic
1159962410 18:74565959-74565981 ACTAGATTTCAGAAAATGTATGG - Intronic
1159996625 18:74970933-74970955 CCTAGATTTCAGAAGATGTATGG - Intronic
1160010168 18:75101200-75101222 CCTAGATTTCAGAGAATGTATGG - Intergenic
1160090153 18:75819241-75819263 CCTACTTTCCAAAAATTCAAGGG - Intergenic
1160601346 18:80014863-80014885 CCTAGATTTCAGAAGATGTATGG - Intronic
1160644099 19:170361-170383 CCTAGATTTCAGAGAATGTATGG - Intergenic
1162596507 19:11633640-11633662 CCTAGATTTCAGAAGATGTATGG + Intergenic
1163539707 19:17900562-17900584 CCTAGATTTCAGAAGATGTATGG + Intergenic
1164178400 19:22798171-22798193 CATAGTTTCCAGACATTGTATGG - Intergenic
1164210100 19:23091242-23091264 CCTAGATTTCAGAAAATGTATGG + Intronic
1164499424 19:28803152-28803174 CCTAATTTCCAGAATTTATAGGG + Intergenic
1164666505 19:30042415-30042437 CCTAGATTTCAGAAGATGTATGG + Intergenic
1165549364 19:36570777-36570799 CTTGATTTACAGAAAATGTATGG + Intronic
1165804040 19:38569570-38569592 CCTGCTTTACAGAAGATGAAAGG - Intronic
1165888386 19:39095778-39095800 CCTAGATTTCAGAAGATGTATGG - Intronic
1168702439 19:58449247-58449269 CCTAGATTTCAGAAGATGTATGG + Intergenic
925257099 2:2499549-2499571 CCTATATTTCAGAAGATGTATGG - Intergenic
925277307 2:2659463-2659485 CCTAGATTTCAGAGAATGTAGGG - Intergenic
925393135 2:3512637-3512659 CCTAGATTTCAGAGAATGTATGG + Intronic
925456184 2:4018527-4018549 CCTAGATTTCAGAAGATGTATGG - Intergenic
925560210 2:5183452-5183474 CCTAAATTTCAGAGAATGTATGG + Intergenic
925805628 2:7645106-7645128 CCTAGATTTCAGAAGATGTATGG - Intergenic
925973525 2:9124801-9124823 CCTATTATTCAGAAAAAGTAAGG - Intergenic
926769020 2:16351543-16351565 CCTAGATTTCAGAGAATGTATGG + Intergenic
926870234 2:17408002-17408024 CCTAGATTTCAGAAGATGTATGG + Intergenic
927030571 2:19116903-19116925 CCTAGATTTCAGAAGATGTATGG - Intergenic
927127033 2:20021381-20021403 CCTAGATTTCAGAAAATATATGG - Intergenic
927340977 2:21982707-21982729 CCTAGATTTCAGAAGATGTATGG - Intergenic
927360201 2:22223904-22223926 CCTAGATTTCAGAAGATGTATGG + Intergenic
927389819 2:22582517-22582539 CCTAGATTTCAGAAGATGTATGG + Intergenic
927611858 2:24549118-24549140 CCTAGATTTCAGAAGATGTATGG - Intronic
927641093 2:24846029-24846051 CCTAGATTTCAGAAGATGTATGG + Intronic
928594277 2:32845600-32845622 CCTAGATTTCAGAAGATGTATGG + Intergenic
928731471 2:34237611-34237633 CCTAGATTTCAGAAGATGTATGG + Intergenic
929260734 2:39864074-39864096 CCTAGATTCCAGAGGATGTATGG + Intergenic
929358126 2:41050834-41050856 CCTAGATTTCAGAAGATGTATGG + Intergenic
929382499 2:41369049-41369071 CCTACATTTCAGAGGATGTATGG - Intergenic
929420218 2:41782706-41782728 CCTCCTTACCTGAAAATGCAGGG + Intergenic
929685033 2:44026184-44026206 CCTCCTGTCCAGGAAATGTCTGG - Intergenic
930006776 2:46904150-46904172 CCTAGTTTTCAGAAGATGTATGG + Exonic
930178293 2:48323073-48323095 CTTACTTTCCCCAAAGTGTAGGG + Intronic
930254750 2:49077198-49077220 CCTAGATTTCAGAAGATGTATGG - Intronic
930456725 2:51615162-51615184 CCTAGATTTCAGAGAATGTACGG - Intergenic
930503698 2:52255711-52255733 CGTAGATTTCAGAAAATGTATGG - Intergenic
930939760 2:56999064-56999086 CCTAGATTTCAGAGAATGTATGG - Intergenic
931023851 2:58085174-58085196 ACTACTTTACATAAAATGTTAGG + Intronic
931033504 2:58211183-58211205 CCTAGATTTCAGAAGATGTATGG - Intronic
931145056 2:59508203-59508225 CCTAGATTTCAGAAAATGTATGG + Intergenic
931469407 2:62523180-62523202 ACTACTTCCAAGACAATGTAAGG + Intergenic
931529657 2:63199620-63199642 CCTACATTTCAGAGGATGTATGG + Intronic
931967121 2:67546398-67546420 CCTAGATTTCAGAAGATGTATGG - Intergenic
932318015 2:70799034-70799056 CCTAGATTTCAGAAGATGTATGG - Intergenic
933008244 2:77023042-77023064 CCTAGATTTCAGAAGATGTATGG - Intronic
933123776 2:78576905-78576927 CCTTATTGCCAGAAAATGTGAGG - Intergenic
933350385 2:81145838-81145860 CCTAGATTTCAGAAGATGTATGG - Intergenic
933418770 2:82022331-82022353 CCTAGATTTCAGAAGATGTATGG - Intergenic
933578103 2:84092798-84092820 CCTAGATTCCAGAGGATGTAAGG - Intergenic
933790765 2:85882145-85882167 CCTAGATTTCAGAAGATGTATGG + Intronic
933819466 2:86096980-86097002 CTTAATATCCAGAATATGTAAGG + Intronic
933985819 2:87591454-87591476 CCTAGATTTCAGAGAATGTATGG + Intergenic
934610576 2:95732363-95732385 CCTAGATTTCAGAAGATGTATGG - Intergenic
935519984 2:104092822-104092844 TTTACTTTCCAGAAAATTTCAGG - Intergenic
935625965 2:105172541-105172563 CCTAGATTTCAGAAAATGTATGG - Intergenic
936238366 2:110766389-110766411 CCAACTTTGTTGAAAATGTATGG + Intronic
936308021 2:111359350-111359372 CCTAGATTTCAGAGAATGTATGG - Intergenic
936543916 2:113373945-113373967 CCTAGATTTCAGAAGATGTATGG - Intergenic
936738494 2:115475413-115475435 CCTAGATTTCAGAGAATGTATGG + Intronic
936788558 2:116124080-116124102 CCTAGATTGCAGAAGATGTATGG + Intergenic
936827921 2:116604218-116604240 CCTAGATTTCAGAAGATGTATGG + Intergenic
937536069 2:122888937-122888959 CCTACATTGTTGAAAATGTATGG - Intergenic
937589023 2:123591498-123591520 CCTAGATTTCAGAGAATGTATGG - Intergenic
938525137 2:132122501-132122523 CCTAGATTTCAGAAGATGTAAGG - Intergenic
939137625 2:138315609-138315631 CCTAGATTTCAGAAGATGTATGG - Intergenic
939190608 2:138912708-138912730 CCTAGATTTCAGAAGATGTATGG - Intergenic
939272615 2:139959963-139959985 CCTAGATTTCAGAAGATGTATGG + Intergenic
939498284 2:142949444-142949466 CCTAGATTTCAGAAGATGTATGG - Intronic
940372498 2:152918542-152918564 CCTATTTTCCAGAAACAGTGAGG - Intergenic
940542984 2:155045818-155045840 CCTAGATTTCAGAAGATGTATGG - Intergenic
940814975 2:158287943-158287965 CCTAGGTTCCAGAAGATGTATGG - Intronic
941123733 2:161561676-161561698 CCTAGATTTCAGAAAATGTATGG + Intronic
941490623 2:166138585-166138607 CCTAGATTTCAGAAGATGTATGG + Intergenic
941560300 2:167036039-167036061 CCTAGATTTCAGAAGATGTATGG + Intronic
941803595 2:169687901-169687923 CCTAGATTTCAGAAGATGTATGG - Intronic
942054289 2:172168061-172168083 CCTAGATTTCAGAAGATGTATGG + Intergenic
942283382 2:174389924-174389946 CCTAGATTTCAGAAGATGTATGG + Intronic
942387828 2:175460816-175460838 CCTAGATTTCAGAAGATGTATGG + Intergenic
942637632 2:178024849-178024871 CTTATTTTCCAGAAAATGCTTGG + Intronic
942653354 2:178191647-178191669 CATACTTTGCAGACAAGGTATGG - Intergenic
942805799 2:179929955-179929977 CCTAGATTTCAGAAGATGTATGG - Intergenic
942950088 2:181712283-181712305 CCTAGATTTCAGAATATGTATGG + Intergenic
943072200 2:183153927-183153949 CCTAGATTTCAGAAGATGTATGG - Intronic
943124781 2:183782781-183782803 CCTAGGTTTCAGAAGATGTATGG + Intergenic
943141514 2:183988585-183988607 TCTAATGTCCAGAACATGTAAGG - Intergenic
943193971 2:184719052-184719074 GCTAGTTTTCAGAAGATGTACGG - Intronic
943205300 2:184886601-184886623 CCTAGATTTCAGAAGATGTATGG - Intronic
943251217 2:185523524-185523546 CCTAGATTTCAGAAGATGTATGG + Intergenic
943313228 2:186353483-186353505 CCTACATTTCAGAAGATGTATGG + Intergenic
943417793 2:187630480-187630502 CCTAGATTTCAGAAGATGTATGG + Intergenic
943478185 2:188385196-188385218 CCTAGATTTCAGAAGATGTATGG - Intronic
943491368 2:188559378-188559400 CCTAGATTTCAGAAGATGTATGG + Intronic
943708667 2:191063836-191063858 CCTACTTGTCAAGAAATGTAAGG - Intronic
943709298 2:191072480-191072502 CCTACTATTCAGATAATATATGG + Intronic
943776747 2:191774406-191774428 CCTAGATTTCAGAAGATGTACGG + Intergenic
943871690 2:193008257-193008279 CCTAGATTTCAGAAGATGTAGGG - Intergenic
944010142 2:194965100-194965122 CCTAGATTTCAGAAGATGTATGG - Intergenic
944101356 2:196031100-196031122 CCTAGATTTCAGAAGATGTATGG - Intronic
944293841 2:198039868-198039890 GCTATGTTCTAGAAAATGTATGG + Intronic
944307447 2:198194394-198194416 CCTAGATTTCAGAAGATGTATGG - Intronic
944943074 2:204651782-204651804 CCTAGATTTCAGATAATGTAAGG - Intronic
945324947 2:208471572-208471594 CCTAAATTTCAGAAAATGTATGG + Intronic
945331523 2:208545441-208545463 CCTACTTTTCAGTTAATGTGAGG - Intronic
945644082 2:212467590-212467612 CCTAGATTTCAGAAGATGTATGG + Intronic
946562486 2:220928268-220928290 CCTAGATTTCAGAAGATGTATGG - Intergenic
946635819 2:221724535-221724557 CCTAGATTTCAGAGAATGTATGG + Intergenic
946657977 2:221969624-221969646 CCGTTTTTCCACAAAATGTAAGG + Intergenic
946930118 2:224662646-224662668 CCTAGATTTCAGAAGATGTATGG - Intergenic
946988622 2:225302816-225302838 CCTAGATTTCAGAAGATGTATGG + Intergenic
947008439 2:225538353-225538375 CCTAGTTTTCAGAAGATGTATGG - Intronic
947072126 2:226300832-226300854 CCTGCTTTCTATAAACTGTAAGG + Intergenic
947176377 2:227371627-227371649 CCGATTTCCCAGAAATTGTATGG + Intronic
947249836 2:228089873-228089895 CCTAGATTCCAGAGGATGTATGG + Intronic
947276286 2:228395973-228395995 CCTAGATTTCAGAGAATGTATGG - Intergenic
948209881 2:236185132-236185154 CTTAGATTCCAGAGAATGTATGG + Intergenic
948296643 2:236865465-236865487 CCTAGATTTCAGAAGATGTATGG - Intergenic
948346550 2:237303653-237303675 CCTAGATTTCAGAAGATGTATGG + Intergenic
1169609682 20:7364802-7364824 CCTAGATTTCAGAAGATGTATGG + Intergenic
1169766420 20:9152576-9152598 CCTAGATTTCAGAAGATGTACGG + Intronic
1170037521 20:12004756-12004778 CCTAGATTTCAGAAGATGTATGG + Intergenic
1170318634 20:15069755-15069777 CCTACATTTCAGAGACTGTATGG + Intronic
1170364928 20:15588086-15588108 CCTAGATTTCAGAAGATGTATGG - Intronic
1170551074 20:17476880-17476902 CCTGCTTTCCACCAAATGGATGG + Intronic
1170643875 20:18179425-18179447 CCTAGATTTCAGAAGATGTATGG - Intronic
1171081566 20:22191368-22191390 TCTAATGTCCAGAATATGTAAGG + Intergenic
1171094152 20:22315608-22315630 TCTACTTTACAGAAGATCTAAGG + Intergenic
1172200484 20:33122669-33122691 CCTAGATTTCAGAAGATGTATGG + Intergenic
1172963050 20:38812247-38812269 CCTACTTTCCAGATAAAGACGGG - Intronic
1175195373 20:57239688-57239710 CCTAGATTTCAGAAAATGTATGG - Intronic
1175546744 20:59783162-59783184 CCAACTTTCAAGAAAAGGCAGGG - Intronic
1176677961 21:9798699-9798721 CCTGCTTTCCAAAACATGTGTGG + Intergenic
1176695991 21:9978549-9978571 CCTAGATTTCAGAAGATGTATGG + Intergenic
1176771386 21:13077352-13077374 CCTAGATTTCAGAAGATGTAAGG + Intergenic
1176879677 21:14175866-14175888 CCTTCTTTCCATACAATGAAAGG - Intronic
1176884115 21:14233627-14233649 GCTACATTACTGAAAATGTATGG + Intergenic
1176935366 21:14860793-14860815 CCTAGATTTCAGAAGATGTATGG - Intergenic
1177238736 21:18428707-18428729 CCTAGATTTCAGAATATGTATGG + Intronic
1177271092 21:18850390-18850412 CCTACGTTTCAGAGAATGCATGG + Intergenic
1177419871 21:20842755-20842777 CCTAGATTTCAGAAGATGTATGG + Intergenic
1177473087 21:21584105-21584127 CCTACATTTCAGAGGATGTATGG + Intergenic
1177478165 21:21651116-21651138 CCTACATTTCAGAGGATGTATGG + Intergenic
1177504298 21:22000720-22000742 TCTACATTTCAGAAGATGTATGG - Intergenic
1177522093 21:22239189-22239211 CCTAGATTTCAGAAGATGTATGG + Intergenic
1177529434 21:22340771-22340793 CCTAGATTTCAGAATATGTATGG - Intergenic
1177740295 21:25146195-25146217 CCTAGATTTCAGAAGATGTATGG - Intergenic
1177839286 21:26218303-26218325 CCTAGATTTCAGAAGATGTATGG + Intergenic
1177992876 21:28059180-28059202 CCTAGATTTCAGAAGATGTATGG + Intergenic
1179235301 21:39540375-39540397 CCTAGATTTCAGAAGATGTATGG - Intergenic
1179450183 21:41463290-41463312 CCTAGATTTCAGAAGATGTATGG + Intergenic
1179946339 21:44680148-44680170 ACTAATATCCAGAATATGTAAGG + Intronic
1179964187 21:44791581-44791603 CCTACATTTCAGAGGATGTAGGG + Intronic
1180251392 21:46592482-46592504 CCTAGATTCCAGAAGATGTATGG + Intergenic
1180524951 22:16249666-16249688 CATACTTTAAAGAAAGTGTAAGG + Intergenic
1180685685 22:17664675-17664697 CCTAGATTTCAGAAGATGTATGG - Intronic
1182913381 22:34006131-34006153 CCTAGATTTCAGAAGATGTATGG - Intergenic
1182940292 22:34270223-34270245 CCTAGATTTCAGAAGATGTATGG - Intergenic
1183275684 22:36896112-36896134 CCTAGTTTCCAGAGGATATATGG + Intergenic
1185240494 22:49740605-49740627 CCTAGATTTCAGAAGATGTATGG + Intergenic
949635964 3:5981678-5981700 CCTAGTTTTCAGAGGATGTATGG - Intergenic
949692975 3:6662113-6662135 CCTAGATTTCAGAAGATGTATGG - Intergenic
949707961 3:6840573-6840595 CCTTATTACCAGAAACTGTAGGG + Intronic
950179027 3:10897916-10897938 CCTAGATTTCAGAAGATGTATGG - Intronic
950245005 3:11407619-11407641 CCTAGATTTCAGAAGATGTATGG - Intronic
950776091 3:15351788-15351810 CCTAGATTTCAGAGAATGTATGG + Intergenic
951127020 3:18996183-18996205 CCTAGATTTCAGAAGATGTATGG - Intergenic
951177569 3:19619156-19619178 CCTAGATTTCAGAAGATGTATGG - Intergenic
951433158 3:22631574-22631596 TCTAGCTTCCAGAAAATGTAGGG + Intergenic
951598615 3:24346229-24346251 ACTACTTTCCAGAAAATGCAAGG - Intronic
951936097 3:28024748-28024770 CCTAGATTTCTGAAAATGTATGG + Intergenic
952113465 3:30152083-30152105 CCTACTTTCTAGAACATTTTAGG + Intergenic
952397088 3:32930574-32930596 CCTAGATTTCAGAAAATGTATGG + Intergenic
952401223 3:32965961-32965983 CCTAGATTTCAGAAGATGTATGG + Intergenic
952435247 3:33267062-33267084 CCTAGATTTCAGAAAATTTATGG - Intergenic
952541287 3:34370744-34370766 CCTAGATTTCAGAAGATGTATGG + Intergenic
952715076 3:36472080-36472102 CCTAGATTTCAGAAGATGTAGGG - Intronic
953249934 3:41235967-41235989 CTTACTGACCAAAAAATGTAGGG - Intronic
954591573 3:51787950-51787972 CCTAGATTTCAGAAGATGTATGG + Intergenic
954759566 3:52864221-52864243 CCTAGATTTCAGAACATGTATGG - Intronic
955573696 3:60334886-60334908 CCTGCATTCAAGAAATTGTATGG + Intronic
956185685 3:66559907-66559929 CCTAGATTTCAGAAGATGTATGG - Intergenic
956252953 3:67253783-67253805 CCTAGATTTCAGAGAATGTATGG + Intergenic
956347802 3:68299906-68299928 CCTAGATTTCAGAAGATGTATGG + Intronic
956412403 3:68992785-68992807 CCTAGATTTCAGAAGATGTATGG - Intronic
956910040 3:73807688-73807710 CCTAGATTTCAGAAGATGTATGG + Intergenic
956938187 3:74127761-74127783 CCTATTTTCCAGACAATGCCAGG - Intergenic
956938592 3:74131865-74131887 CCTAGATTTCAGAAGATGTACGG - Intergenic
957113542 3:75995467-75995489 CCTAGATTTCAGAAAATGTATGG + Intronic
957300602 3:78387722-78387744 CCTAGATTTCAGAAGATGTATGG - Intergenic
957300916 3:78390352-78390374 CCTACATTTCAGAGGATGTATGG + Intergenic
957470618 3:80653741-80653763 CCTAGATTTCAGAAGATGTATGG + Intergenic
957471831 3:80668486-80668508 CCTAGATTTCAGAGAATGTATGG + Intergenic
957557522 3:81780783-81780805 CCTACATTTCAGAGGATGTATGG - Intergenic
957621159 3:82594878-82594900 CCTAGATTTCAGAAGATGTATGG - Intergenic
957625213 3:82646651-82646673 CCTAGATTTCAGAAGATGTATGG + Intergenic
957669396 3:83281075-83281097 CCTAGATTTCAGAAGATGTATGG - Intergenic
957787466 3:84901154-84901176 CCTAGATTTCAGAAGATGTATGG + Intergenic
957920932 3:86747933-86747955 CCTAGATTTCAGAAGATGTATGG + Intergenic
957945466 3:87057603-87057625 CCTAGATTTCAGAAGATGTATGG - Intergenic
957953152 3:87150145-87150167 CCTAGATTTCAGAAGATGTAGGG - Intergenic
957981735 3:87519675-87519697 CCTAGATTTCAGAAGATGTATGG + Intergenic
958149401 3:89670833-89670855 CCTAGATTTCAGAAGATGTATGG + Intergenic
958175309 3:89989560-89989582 CCTACATTTCAGAGAATGTATGG + Intergenic
958256576 3:91332206-91332228 CCTAGATTTCAGAAGATGTATGG + Intergenic
958469397 3:94498664-94498686 CCTAGATTTCAGAAGATGTATGG + Intergenic
958646576 3:96882298-96882320 CCTAGATTTCAGAAGATGTATGG - Intronic
958650067 3:96927046-96927068 CCTGCATTTCAGAGAATGTATGG - Intronic
958931015 3:100208144-100208166 CCCACTTTCAAAAAACTGTATGG + Intergenic
958955156 3:100458793-100458815 CCTAGATTTCAGAAGATGTATGG - Intergenic
959141040 3:102487013-102487035 CCTAGATTTCAGAGAATGTATGG + Intergenic
959161028 3:102724706-102724728 CCTAGATTTCAGAAGATGTACGG + Intergenic
959214794 3:103437650-103437672 CCTAGATTTCAGAAGATGTAAGG - Intergenic
959267950 3:104167805-104167827 CCTACATTTCAGAGGATGTATGG - Intergenic
959319097 3:104848296-104848318 CCTAGATTTCAGAAGATGTATGG + Intergenic
959390105 3:105762621-105762643 CCTAGATTTCAGAAGATGTATGG + Intronic
959512879 3:107233801-107233823 CCTAGATTTCAGAAGATGTATGG + Intergenic
959695684 3:109246515-109246537 CCTAGATTTCAGAAGATGTATGG - Intergenic
959742559 3:109737446-109737468 CCTAGATTTCAGAAGATGTATGG - Intergenic
959809181 3:110594894-110594916 CCTAGATTCCAGAGAATGTCTGG - Intergenic
959851811 3:111096807-111096829 CCTAGATTTCAGAAGATGTATGG + Intronic
959894126 3:111587695-111587717 CCTACATTTCAGAAGATGTATGG - Intronic
960366078 3:116774375-116774397 CCTATTTTCCAGATGCTGTATGG - Intronic
960396851 3:117147840-117147862 TCATCTTTCCAGAAAATGTATGG + Intergenic
960486511 3:118259331-118259353 CCTAGATTTCAGAAAATGTATGG + Intergenic
960626515 3:119686815-119686837 CCTAGATTTCAGAATATGTATGG - Intergenic
960842943 3:121978696-121978718 CCTAGGTTTCAGAAGATGTATGG + Intergenic
961257792 3:125571746-125571768 CCTAGATTTCAGAGAATGTAAGG + Intronic
961789359 3:129364765-129364787 CCTAGATTTCAGAAGATGTATGG - Intergenic
961961974 3:130864794-130864816 CCTAGATTTCAGAAGATGTATGG + Intronic
962045777 3:131757968-131757990 CCTAGATTTCAGAAGATGTATGG + Intronic
962162171 3:133011664-133011686 CCTAGATTTCAGAAGATGTATGG - Intergenic
962440185 3:135406299-135406321 GCTAGATTTCAGAAAATGTATGG - Intergenic
962589331 3:136872899-136872921 CCTGCATTTCAGAAGATGTATGG + Intronic
962651068 3:137492039-137492061 CTTACTTTAAAGAAAACGTATGG + Intergenic
962659382 3:137585813-137585835 CCTAGATTTCAGAAGATGTATGG - Intergenic
962718230 3:138147040-138147062 CCTACTTTGCATATAGTGTAAGG - Intergenic
962727030 3:138239758-138239780 CCTAATTACCATAAAATGAAAGG - Intronic
962769963 3:138602918-138602940 CCTAGATTTCAGAAGATGTATGG + Intergenic
963131413 3:141861747-141861769 CCTAGATACCTGAAAATGTAAGG + Intergenic
963379289 3:144507464-144507486 CCTAGATTTCAGAAGATGTATGG - Intergenic
963394562 3:144715369-144715391 CCTAGATTTCAGAAGATGTATGG - Intergenic
964076684 3:152700763-152700785 CCTATATTTCAGAAGATGTATGG - Intergenic
964098597 3:152962663-152962685 CCTAGATTTCAGAAGATGTATGG - Intergenic
964190230 3:153992650-153992672 CCTAGATTTCAGAAAAAGTACGG + Intergenic
964588194 3:158330484-158330506 CCTACCATCCAGAAAATGGTAGG - Intronic
964654559 3:159052131-159052153 CCTAGCTTTCAGAAGATGTATGG + Intronic
965045502 3:163572426-163572448 CCTAGATTTCAGAAGATGTATGG + Intergenic
965086905 3:164111832-164111854 CCTAGATTTCAGAACATGTATGG - Intergenic
965386897 3:168056296-168056318 CCTAGATTTCAGAAGATGTATGG + Intronic
965865427 3:173199459-173199481 CCTAGATTTCAGAAGATGTATGG - Intergenic
965897431 3:173594754-173594776 CCTAGATTTCAGAAGATGTATGG - Intronic
965915677 3:173842998-173843020 CCTAGATTTCAGAAGATGTATGG - Intronic
965989580 3:174800464-174800486 CCTAGATTTCAGAACATGTATGG + Intronic
966074405 3:175919379-175919401 CCTAGATTTCAGAAAATGCATGG - Intergenic
966115693 3:176458324-176458346 CCTAGATTTCAGAATATGTATGG + Intergenic
966299432 3:178462012-178462034 CCTAGATTTCAGAAGATGTATGG + Intronic
966325250 3:178746184-178746206 CCTAGATTTCAGAAGATGTATGG - Intronic
966675884 3:182589392-182589414 CAGACTATCAAGAAAATGTAAGG + Intergenic
966835384 3:184045677-184045699 CTAACTTTCCAGAAAATGCCAGG - Intergenic
967154986 3:186683917-186683939 CCTAGATTTCAGACAATGTAAGG - Intergenic
967462295 3:189760833-189760855 CCTAGATTTCAGAACATGTATGG - Intronic
967777016 3:193395308-193395330 CCTACATTTCAGAGGATGTATGG - Intergenic
968175925 3:196549471-196549493 CCTAGATTTCAGAAGATGTATGG + Intergenic
969072600 4:4551507-4551529 CCTAGATTTCAGAAGATGTATGG + Intergenic
969103625 4:4788742-4788764 CCTAGATTTCAGAAGATGTATGG + Intergenic
969177037 4:5406544-5406566 CCTAGATTTCAGAGAATGTATGG - Intronic
969194631 4:5550990-5551012 CCTAGATTTCAGAAATTGTATGG + Intronic
969996421 4:11317383-11317405 CCTAGATTTCAGAGAATGTATGG - Intergenic
970097413 4:12479490-12479512 CCTAGATTTCAGAACATGTATGG - Intergenic
970218052 4:13779723-13779745 CCTAGATTTCAGAAGATGTATGG - Intergenic
970344029 4:15135941-15135963 CCTAGATTTCAGAATATGTATGG - Intergenic
970554215 4:17215149-17215171 CCTAGATTTCAGAAGATGTATGG - Intergenic
970635523 4:18005594-18005616 CCTAGATTTCAGAAGATGTATGG - Intronic
970801329 4:19976472-19976494 GCTAGATTTCAGAAAATGTATGG - Intergenic
970987634 4:22176737-22176759 CCTAGATTTCAGAAGATGTATGG - Intergenic
971570455 4:28204867-28204889 CCTAGATTTCAGAAGATGTATGG - Intergenic
971753318 4:30678388-30678410 GCTAGATTTCAGAAAATGTATGG + Intergenic
971896676 4:32605530-32605552 CCTAGATTTCAGAGAATGTATGG - Intergenic
971969601 4:33604613-33604635 CCTAGATTTCAGAAGATGTATGG - Intergenic
972014500 4:34226506-34226528 CCTAGATTTCAGAATATGTATGG + Intergenic
972229232 4:37051534-37051556 CTTACTTTTCTGAAAATGTGGGG + Intergenic
972582436 4:40406752-40406774 CCTAAATTTCAGAGAATGTATGG + Intergenic
972749370 4:41973260-41973282 CCTAGATTTCAGAAGATGTATGG + Intergenic
972857116 4:43120442-43120464 CCTAGATTTCAGAAGATGTATGG - Intergenic
973035204 4:45397234-45397256 CCTAGATTTCAGAAAATGTATGG - Intergenic
973063869 4:45763494-45763516 CCTAGATTTCAGAAGATGTATGG - Intergenic
973182952 4:47291310-47291332 CCTAGATTTCAGAAGATGTATGG + Intronic
973552362 4:52048475-52048497 CCTAGATTTCAGAAGATGTATGG - Intergenic
974269607 4:59633425-59633447 CCTAAATTTCAGAAGATGTATGG - Intergenic
974555831 4:63446162-63446184 CCTAGATTTCAGAAGATGTATGG - Intergenic
974969600 4:68807640-68807662 CCTAGATTTCAGAAGATGTAAGG + Intergenic
974972269 4:68844999-68845021 CCTAGATTTCAGAGAATGTATGG + Intergenic
974981886 4:68967156-68967178 CCTACTTTTCAGAGGATGTACGG - Intergenic
975186521 4:71410035-71410057 CCTAGATTTCAGAAGATGTATGG + Intronic
975214552 4:71738401-71738423 CCTAGATTTCAGAAGATGTATGG + Intergenic
975253976 4:72213028-72213050 CCTAGATTTCAGAAGATGTATGG - Intergenic
975350398 4:73339470-73339492 CCTAGATTTCAGAAGATGTATGG - Intergenic
975942145 4:79660524-79660546 CCTAGATTTCAGAAGATGTATGG + Intergenic
976051560 4:81016569-81016591 CCTAGATTTCAGAAGATGTATGG - Intergenic
976259883 4:83135512-83135534 CCTAGATTTCAGAAGATGTATGG - Intronic
976497496 4:85747119-85747141 CCTACTTTTCAGGAAATGCCTGG + Intronic
976503130 4:85814919-85814941 CCTAGATTTCAGAAGATGTATGG - Intronic
976635671 4:87284558-87284580 CCTAGATTTCAGAAGATGTATGG + Intergenic
976949783 4:90814024-90814046 CCTAGATTTCAGAGAATGTATGG - Intronic
977026078 4:91820960-91820982 CCTAGATTTCAGAAGATGTATGG - Intergenic
977149107 4:93486957-93486979 CCTACGCACCACAAAATGTAAGG - Intronic
977189138 4:93977896-93977918 CCTAAATTTCAGAAGATGTACGG + Intergenic
977197502 4:94081350-94081372 CCTACATTTCAGATAATGTATGG - Intergenic
977395754 4:96468756-96468778 CCTAGATTTCAGAAGATGTATGG - Intergenic
977545054 4:98367312-98367334 CCTACATTGCAGGAAATGTATGG + Intronic
977707362 4:100086646-100086668 CCTAGATTTCAGAAGATGTATGG - Intergenic
977953518 4:103001008-103001030 CCTAGATTTCAGAAGATGTATGG - Intronic
977973066 4:103233173-103233195 CCTAGATTTCAGAAGATGTATGG + Intergenic
978226240 4:106338565-106338587 CCTAGATTTCAGAAGATGTATGG + Intronic
978322687 4:107515674-107515696 CCTAGATTTCAGAAGATGTACGG + Intergenic
978330928 4:107611918-107611940 CCTAGATTTCAGAAGATGTATGG + Intronic
978344868 4:107756534-107756556 CCTAGATTTCAGAAGATGTATGG + Intergenic
978579535 4:110218271-110218293 CCTAGATTTCAGAAGATGTATGG - Intergenic
978654775 4:111052206-111052228 CCTAGATTTCAGAAGATGTATGG + Intergenic
978776069 4:112508155-112508177 CTTACTTTCCAGATAATCTTGGG - Intergenic
978856560 4:113400887-113400909 CCTAGATTTCAGAAGATGTATGG + Intergenic
979097561 4:116570402-116570424 ACTACTGTCCAAAAAATGTTGGG - Intergenic
979116082 4:116826435-116826457 CCTAGATTTCAGAAGATGTATGG - Intergenic
979368010 4:119848295-119848317 CCTAGATTTCAGAAGATGTATGG - Intergenic
979700012 4:123656702-123656724 CCTAGATTCCAGAAGATGTATGG - Intergenic
979703050 4:123689342-123689364 CCTAGATTTCAGAAGATGTATGG - Intergenic
979759937 4:124390035-124390057 CCCATCTTCCAAAAAATGTAGGG - Intergenic
979775219 4:124581762-124581784 CCTAGATTCCAGAGGATGTATGG - Intergenic
979923002 4:126524719-126524741 CCTAGATTTCAGAAGATGTATGG - Intergenic
980006859 4:127552441-127552463 CCTAGATTTCAGAGAATGTATGG + Intergenic
980202779 4:129677325-129677347 CCTAGATTTCAGAAGATGTATGG + Intergenic
980324478 4:131324096-131324118 CCTAGATTTCAGAAGATGTATGG + Intergenic
980368607 4:131838777-131838799 CCTAGATTTCAGAAGATGTATGG + Intergenic
980654594 4:135765921-135765943 CCTAGATTTCAGAGAATGTATGG + Intergenic
981503098 4:145473439-145473461 CCTAGATTTCAGATAATGTACGG - Intergenic
981611450 4:146597659-146597681 CCTAGATTTCAGAAGATGTATGG - Intergenic
981643040 4:146967294-146967316 CCTAGATTTCAGAAGATGTATGG + Intergenic
981861496 4:149361677-149361699 CCTAGATTTCAGAAGATGTATGG + Intergenic
982279144 4:153666102-153666124 CCTACATTTCAGAAGATGTATGG + Intergenic
982299887 4:153867788-153867810 CCTAGTTTTCAGAGGATGTATGG + Intergenic
982301213 4:153881117-153881139 CCTAGGTTTCAGAAGATGTATGG + Intergenic
982392894 4:154884913-154884935 CCTAGATTTTAGAAAATGTATGG - Intergenic
982412152 4:155090606-155090628 TCTACTATCCAGAAAATAAATGG - Intergenic
982482986 4:155934290-155934312 CCTAGATTTCAGAAGATGTATGG + Intronic
982560882 4:156926983-156927005 CCTAGATTTCAGAAGATGTATGG - Intronic
982669981 4:158308775-158308797 CCTAATATCCAGAAACTATAGGG - Intergenic
982829555 4:160043215-160043237 CCTAGATTTCAGAAGATGTATGG - Intergenic
982923413 4:161304807-161304829 CCTAGATTTCAGAGAATGTATGG + Intergenic
982966371 4:161913530-161913552 CCTAGATTTCAGAAGATGTATGG + Intronic
983006398 4:162490456-162490478 CCTAGATTTCAGAAGATGTATGG + Intergenic
983083387 4:163414733-163414755 CCTAGATTTCAGAAGATGTATGG + Intergenic
983320637 4:166191866-166191888 CCTACATTTCAGAAGATGTTTGG + Intergenic
983322409 4:166211669-166211691 CCTAGATTTCAGAAAATGTATGG - Intergenic
983489188 4:168368412-168368434 CCTAGATTTCAGAAGATGTATGG + Intronic
984017325 4:174441737-174441759 CCTAGATTTCAGAAGATGTATGG - Intergenic
984065591 4:175043909-175043931 CCTAGATTTCAGAAGATGTACGG + Intergenic
984355534 4:178653552-178653574 CCTAGATTTCAGAAGATGTATGG + Intergenic
984374428 4:178909442-178909464 CCTACATTCCAGTAAATGTCAGG + Intergenic
984415998 4:179459167-179459189 CCTAGGTTTCAGAAAATGTATGG + Intergenic
985156039 4:186988021-186988043 TCTAGATTTCAGAAAATGTATGG - Intergenic
985184003 4:187296426-187296448 CCTAGATTTCAGAAGATGTATGG - Intergenic
985337705 4:188914052-188914074 CCTAGATTTCAGAAAATGTATGG - Intergenic
985884596 5:2667627-2667649 CCTACTTTCCTGTAAGTTTATGG - Intergenic
986081116 5:4395076-4395098 CCTAGATTTCAGAAGATGTATGG - Intergenic
986129077 5:4910404-4910426 CCTAGATTTCAGAGAATGTATGG - Intergenic
986137834 5:4999273-4999295 CCTACATTTCAGAGGATGTATGG - Intergenic
986152795 5:5142673-5142695 GCTACTTTAAACAAAATGTATGG - Intronic
986162502 5:5242428-5242450 CCTACTTTCCATCTAATTTAAGG + Intronic
986246541 5:6012190-6012212 CCTAGATTTCAGAAGATGTATGG - Intergenic
986281904 5:6330351-6330373 CCTAGATTCCAGAGGATGTATGG + Intergenic
986358295 5:6950240-6950262 CCTTCTTTCCTCAAGATGTACGG - Intergenic
986680095 5:10224580-10224602 CCTAGATTTCAGAAGATGTATGG - Intergenic
986700059 5:10397963-10397985 TCTCCTTTCCAGAAGAGGTAAGG + Intronic
986756751 5:10843935-10843957 CCTAAATTTCAGAAGATGTATGG - Intergenic
986907978 5:12518938-12518960 CCTAGATTTCAGAAAATATATGG - Intergenic
986911610 5:12564892-12564914 CCTAGATTTCAGAAGATGTATGG - Intergenic
986957989 5:13178966-13178988 CTTATTTTCCAGAAAGTTTATGG + Intergenic
986987358 5:13514671-13514693 CCTAGATTTCAGAAGATGTATGG + Intergenic
987260391 5:16196453-16196475 CCTAGATTTCAGAAGATGTATGG - Intergenic
987262053 5:16213941-16213963 CCTAGATTTCAGAAGATGTATGG - Intergenic
987390306 5:17369045-17369067 CCTCCTTTTCAGAAAATGACAGG - Intergenic
987433560 5:17865429-17865451 CCTAGATTTCAGAGAATGTATGG + Intergenic
987435255 5:17885760-17885782 CCTAGATTTCAGAAGATGTATGG + Intergenic
987458318 5:18175018-18175040 CCTACTTTATAGAGAAAGTAGGG - Intergenic
987492095 5:18594222-18594244 CCTAGATTTCAGAAGATGTATGG - Intergenic
987562380 5:19540569-19540591 CCTAGATTTCAGAGAATGTATGG - Intronic
987642364 5:20628838-20628860 CCTAGATTTCAGAAGATGTATGG - Intergenic
987737695 5:21867399-21867421 CCTAGATTTCAGAAAATGTATGG + Intronic
987773590 5:22336685-22336707 CCTAGATTTCAGAAATTGTATGG + Intronic
987841198 5:23224709-23224731 CCTACATTACACAAAATGCAGGG + Intergenic
987908132 5:24105547-24105569 CCTAGATTTCAGAGAATGTATGG - Intronic
988074779 5:26338676-26338698 CCTACATTTCAGAGGATGTATGG - Intergenic
988159654 5:27503003-27503025 CCTAGATTTCAGAGAATGTATGG - Intergenic
988162869 5:27543992-27544014 CCTATGTTTCAGAGAATGTATGG + Intergenic
988172955 5:27682901-27682923 CCTAGATTTCAGAAGATGTATGG - Intergenic
988396007 5:30698665-30698687 CCTAGATTTCAGAAAATGTATGG + Intergenic
989132784 5:38124270-38124292 CCTAGATTTCAGAGAATGTATGG - Intergenic
989174669 5:38511863-38511885 TCTAATTTCCACAAAATGAATGG + Exonic
989501645 5:42175703-42175725 CTTACTTTCAAGAAAATATTCGG + Intergenic
989662632 5:43815892-43815914 CCTAGATTTCAGAGAATGTATGG + Intergenic
989731642 5:44656403-44656425 CCTAGATTTCAGAGAATGTATGG + Intergenic
989767453 5:45103965-45103987 CCTAGATTTCAGAAGATGTATGG + Intergenic
989966875 5:50475256-50475278 CCTAGATTCCAGAGGATGTATGG + Intergenic
990193299 5:53286312-53286334 CCTAGATTTCAGAAGATGTATGG - Intergenic
990526079 5:56629049-56629071 CCTAGATTTCAGAAGATGTATGG + Intergenic
990595562 5:57309433-57309455 CCTAGATTTCAGAAGATGTATGG + Intergenic
990844572 5:60122403-60122425 CCTATATTTCAGAAGATGTATGG - Intronic
990923044 5:60989039-60989061 TCTACTATCCAGAATCTGTAAGG + Intronic
991678492 5:69113439-69113461 CCTACATTTCTGAAAATTTAGGG - Intronic
992310951 5:75498650-75498672 CCTACATTTCAGAGGATGTATGG + Intronic
992666278 5:79012629-79012651 CCTAAATTTCAGAAGATGTATGG - Intronic
993117521 5:83735505-83735527 CCTAGATTTCAGAGAATGTATGG + Intergenic
993146125 5:84096040-84096062 CCTAGATTTCAGAAGATGTATGG + Intronic
993215875 5:85021869-85021891 CCTAGATTTCAGAAGATGTATGG - Intergenic
993575155 5:89591205-89591227 CCTAGATTTCAGAAGATGTATGG + Intergenic
994019290 5:95004737-95004759 CCTAGATTTCAGAGAATGTATGG + Intronic
994023744 5:95058533-95058555 CCTACTTTCCAGAACTGTTACGG + Intronic
994285164 5:97955913-97955935 CCTAGATTTCAGAGAATGTATGG + Intergenic
994392371 5:99203056-99203078 CGTAATTTCCAGAAAAGGTGAGG - Intergenic
994443094 5:99835846-99835868 CCTAGATTTCAGAGAATGTATGG + Intergenic
994507964 5:100665550-100665572 CCTAGATTTCAGAGAATGTATGG - Intergenic
994552790 5:101258763-101258785 CCTACATTTCAGAAGATGTATGG + Intergenic
994553170 5:101262302-101262324 CCTAGATTTCAGAGAATGTATGG + Intergenic
994608207 5:101998296-101998318 AATGCTTTCCAGAGAATGTAAGG + Intergenic
994614920 5:102092374-102092396 CCTAGATTTCAGAAGATGTATGG - Intergenic
994637684 5:102363379-102363401 CCTAGATTTCAGAAGATGTATGG - Intergenic
994655954 5:102593363-102593385 CCTAGATTTCAGAACATGTACGG - Intergenic
994755625 5:103790431-103790453 CCTAGATTTCAGAAGATGTATGG - Intergenic
994823326 5:104680760-104680782 CCTAGATTTCAGAAGATGTATGG + Intergenic
994828535 5:104747144-104747166 CCTAGATTTCAGAAAATGTGAGG + Intergenic
994895597 5:105698095-105698117 CCTAGATTTCAGAAGATGTATGG - Intergenic
994944095 5:106362655-106362677 CCTAATATCCAGAATCTGTAAGG - Intergenic
995333832 5:110976270-110976292 CCTAGATTTCAGAAGATGTATGG - Intergenic
995384608 5:111574977-111574999 CCTACTGTCAAGAACATGAAGGG + Intergenic
995392411 5:111653432-111653454 CCTACATTTCAGAAGTTGTATGG - Intergenic
995414190 5:111890579-111890601 CCTAGATTTTAGAAAATGTATGG - Intronic
996033605 5:118733814-118733836 CCTAGATTTCAGAAGATGTATGG + Intergenic
996098121 5:119420617-119420639 CCTAGATTTCAGAAGATGTATGG + Intergenic
996196343 5:120611662-120611684 CCTAGATTTCAGAAGATGTACGG + Intronic
996222402 5:120949900-120949922 CCTAGATTTCAGAAGATGTATGG + Intergenic
996222826 5:120953861-120953883 CCTAGATTTCAGAAGATGTATGG + Intergenic
996239019 5:121171398-121171420 CCTAGATTTCAGAAGATGTATGG - Intergenic
996247545 5:121282990-121283012 CCTAGATTTCAGAAGATGTATGG + Intergenic
996255881 5:121402717-121402739 CCTATATTCCAGAGGATGTATGG + Intergenic
996468009 5:123825797-123825819 CCTAGATTTCAGAAGATGTATGG + Intergenic
996641634 5:125761796-125761818 CCTAGATTCCAGAGGATGTATGG + Intergenic
996679753 5:126219149-126219171 TCTAATATCCAGAAACTGTAAGG + Intergenic
996967294 5:129321183-129321205 CCTAGATTTCAGAGAATGTATGG - Intergenic
997056661 5:130452107-130452129 CCTAGATTTCAGAAGATGTATGG - Intergenic
997108238 5:131045895-131045917 CCTAGATTTCAGAAGATGTATGG - Intergenic
997266758 5:132499318-132499340 CCTACTTTCCAGGAGAGGAATGG - Intergenic
998144667 5:139720369-139720391 CCTAGATTTCAGAAGATGTATGG + Intergenic
998697096 5:144652771-144652793 CTTAGATTTCAGAAAATGTATGG - Intergenic
998722991 5:144975551-144975573 CCTAGATTTCAGAAGATGTATGG + Intergenic
998813934 5:145993501-145993523 CCTAGATTTCAGAAGATGTATGG - Intronic
998871501 5:146557197-146557219 CCTAGATTTCAGAAGATGTATGG - Intergenic
998889354 5:146729787-146729809 CCTAGATTTCAGAAGATGTATGG + Intronic
999490258 5:152043279-152043301 CCTCCTTTCCAGAAAAATTCAGG - Intergenic
999668128 5:153934515-153934537 CCTAGATTTCAGAAGATGTATGG - Intergenic
999669371 5:153945161-153945183 CCTAGATTTCAGAAGATGTATGG - Intergenic
1000564894 5:162834932-162834954 CCTAGATTTCAGAAGATGTATGG - Intergenic
1000607880 5:163343821-163343843 CCCACTTTCTATAAAATGAATGG + Intergenic
1000660495 5:163932940-163932962 CCCCCTTTCCAGAGAGTGTAAGG - Intergenic
1000947199 5:167436888-167436910 CCTACATTTCAGAAGATGTATGG + Intronic
1001049468 5:168402803-168402825 CCTCATTCCCAGAAAATGTAAGG + Intronic
1001055210 5:168443732-168443754 CCTTCTTACAAGAAAATGTCAGG + Intronic
1001181661 5:169526191-169526213 CCTAGTTTTCAGAAGATGTATGG - Intergenic
1001248562 5:170125364-170125386 CATACTTTGCAGGAAATGGAGGG - Intergenic
1001879545 5:175231488-175231510 CCTACTATCCAGAAGAGATAGGG - Intergenic
1002732822 5:181354420-181354442 CCTAGATTTCAGAGAATGTATGG + Intergenic
1002751716 6:119686-119708 CCTAGATTTCAGAGAATGTATGG - Intergenic
1003659308 6:8045308-8045330 CCTAGATTTCAGAAGATGTAAGG + Intronic
1003753195 6:9085389-9085411 CCTACTTTCCAGAGAATCAAGGG - Intergenic
1003791505 6:9552111-9552133 CCTAGATTTCAGAAGATGTATGG - Intergenic
1003979545 6:11377079-11377101 CCTAGATTCCAGAGGATGTATGG + Intronic
1004561452 6:16755813-16755835 ATTACTTTCCAGAAAATTCATGG - Intronic
1004592808 6:17070014-17070036 CATAGATTTCAGAAAATGTATGG + Intergenic
1004830843 6:19475301-19475323 CCTAGATTTCAGAAGATGTATGG - Intergenic
1005228514 6:23671657-23671679 CCTAGTTTTCAGAGGATGTATGG - Intergenic
1005400945 6:25433911-25433933 GCTAATTTCAGGAAAATGTAAGG + Intronic
1005904987 6:30254798-30254820 CCTAGATTTCAGAAGATGTATGG - Intergenic
1005920769 6:30398605-30398627 ACTAATATCCAGAATATGTAAGG - Intergenic
1005921723 6:30407635-30407657 CCTAGATTTCAGAAGATGTATGG + Intergenic
1007815169 6:44517515-44517537 ACTAATATCCAGAATATGTAAGG - Intergenic
1008452164 6:51665570-51665592 CCTACTTTTCAGCTCATGTAGGG - Intronic
1008930169 6:56931322-56931344 CCTAGATTTCAGAAGATGTATGG + Intronic
1008998763 6:57688954-57688976 CCTAGATTTCAGAAGATGTATGG - Intergenic
1009187247 6:60588333-60588355 CCTAGATTTCAGAAGATGTATGG - Intergenic
1009284964 6:61804610-61804632 CCTACATTTCAGAGGATGTATGG - Intronic
1009396628 6:63206945-63206967 CCTAGATTTCAGAAGATGTAGGG + Intergenic
1009490509 6:64284684-64284706 CCTAGATTTCAGAAGATGTATGG - Intronic
1009538667 6:64924130-64924152 CCTAGATTTCAGAAGATGTATGG - Intronic
1009604097 6:65844781-65844803 GCTAATTTCCAGGAAATGCAGGG - Intergenic
1009726559 6:67543025-67543047 CCTAGATTCCAGAGGATGTAGGG + Intergenic
1009780300 6:68260481-68260503 CCTAGATTTCAGAAGATGTATGG - Intergenic
1009781587 6:68278551-68278573 CCTAATATCCAGAAACTATAAGG - Intergenic
1010263758 6:73845090-73845112 CCTAGATTTCAGAAGATGTATGG + Intergenic
1010282603 6:74038523-74038545 CCTAGATTTCAGAAGATGTATGG + Intergenic
1010605955 6:77889966-77889988 CCTACATTTCAGAGCATGTATGG + Intronic
1010636046 6:78260402-78260424 CCTAGGTTTCAGAAGATGTATGG - Intergenic
1010767893 6:79797073-79797095 CCTATTTCCCTGAATATGTATGG - Intergenic
1011152522 6:84290043-84290065 CCTAGATTTCAGAAGATGTAGGG - Intergenic
1011821211 6:91255831-91255853 CCTAGATTTCAGAAGATGTATGG + Intergenic
1012001188 6:93657286-93657308 TCTAATATCCAGAAAATATAAGG - Intergenic
1012064880 6:94537531-94537553 CCTAGATTTCAGATAATGTATGG - Intergenic
1012141500 6:95631678-95631700 CCTAGATTTCAGAAGATGTATGG + Intergenic
1012213758 6:96556924-96556946 CCTATATTTCAGAAGATGTATGG - Intergenic
1012649603 6:101736429-101736451 CCTAGATTTCAGAAGATGTATGG - Intronic
1012826361 6:104151610-104151632 CCTAGATTTCAGAAGATGTATGG - Intergenic
1012830810 6:104201616-104201638 CCTAGATTTCAGAATATGTATGG + Intergenic
1012883300 6:104816534-104816556 CCTAGATTTCAGAGAATGTATGG + Intronic
1013077019 6:106780771-106780793 CCTAGATTTCAGGAAATGTATGG + Intergenic
1013086653 6:106863257-106863279 CCTAGATTTCAGAAGATGTATGG + Intergenic
1013214563 6:108015604-108015626 CCTAGATTTCAGAAGATGTATGG - Intergenic
1013568455 6:111394490-111394512 ACTAATCTCCAGAATATGTAAGG - Intronic
1013626069 6:111938139-111938161 CGTAATTTCCAAAAACTGTAGGG + Intergenic
1013717196 6:112976139-112976161 CCTAGATTTCAGAAAATGAATGG + Intergenic
1013865461 6:114690964-114690986 CCTAGATTTCAGAAGATGTATGG - Intergenic
1013884484 6:114945725-114945747 CCTAGATTTCAGAAGATGTATGG - Intergenic
1013918164 6:115366817-115366839 CCTAGATTTCAGAAGATGTATGG + Intergenic
1014407001 6:121064734-121064756 CCTAGATTTCAGAAGATGTATGG + Intergenic
1014482444 6:121954821-121954843 CCTAGATTTCAGAAGATGTATGG - Intergenic
1014613112 6:123568524-123568546 CCTAGATTTCAGAGAATGTATGG - Intronic
1014730960 6:125030965-125030987 CCTACATTTCAGAAGATGTAGGG - Intronic
1014771796 6:125465711-125465733 CCTAGATTTCAGAAGATGTATGG + Intergenic
1015193485 6:130498567-130498589 CCCTCTTTCCAGAGAATATATGG - Intergenic
1015260376 6:131230470-131230492 TCTAATTTCCAGAAATTGTAAGG - Intronic
1015456815 6:133435687-133435709 CCCACTTTCTGGAAAAAGTACGG - Intronic
1015523188 6:134151686-134151708 CCTAGGTTTCAGAACATGTATGG + Intergenic
1015677094 6:135762343-135762365 CCTAGATTTCAGAAGATGTATGG - Intergenic
1016094634 6:140020450-140020472 CCTAGATTTCAGAAGATGTATGG - Intergenic
1016122754 6:140364198-140364220 CCTAGATTTCAGAAGATGTATGG + Intergenic
1016139772 6:140594397-140594419 CCTAGATTTCAGAAGATGTATGG + Intergenic
1016202566 6:141430272-141430294 CCTAGATTTCAGAAGATGTATGG - Intergenic
1016230631 6:141800244-141800266 CCTATATTTCAGAAGATGTATGG + Intergenic
1016420009 6:143873574-143873596 CCTAGATTTCAGAAGATGTATGG - Intronic
1016537631 6:145126395-145126417 CCTAGATTTCAGAAGATGTATGG + Intergenic
1016693460 6:146965528-146965550 CCTAGATTTCAGAAGATGTATGG + Intergenic
1017525385 6:155237593-155237615 CCTAGATTTCAGAGAATGTATGG - Intronic
1017654428 6:156613967-156613989 CCTAGATTTCAGAAGATGTATGG - Intergenic
1018032060 6:159849253-159849275 CCTAGATTTCAGAAGATGTATGG + Intergenic
1018215009 6:161518284-161518306 CCTGCTTTCCAGAAGATGAGAGG + Intronic
1018516111 6:164581565-164581587 ACTACATTTCAGAAGATGTATGG - Intergenic
1018585188 6:165349916-165349938 CCTAGATTTCAGAGAATGTATGG + Intronic
1018636894 6:165870211-165870233 ACTAATATCCAGAATATGTAAGG + Intronic
1018721578 6:166577125-166577147 CCTAGATTGCAGAAGATGTATGG + Intronic
1019237077 6:170626738-170626760 CCTAGATTTCAGAGAATGTATGG + Intergenic
1020782699 7:12536220-12536242 ACTAGATTTCAGAAAATGTAGGG - Intergenic
1020837203 7:13168400-13168422 CCTACATTTCAGAGGATGTATGG - Intergenic
1020979790 7:15053227-15053249 CCTAGATTTCAGAGAATGTATGG - Intergenic
1021036839 7:15809931-15809953 CCTAGATTTCAGAAGATGTATGG - Intergenic
1021192990 7:17643786-17643808 CCTAGATTTCAGAAGATGTATGG + Intergenic
1021525202 7:21578714-21578736 CCTAGATTTCAGAGAATGTATGG - Intronic
1021550045 7:21861373-21861395 CCTACTCCCCCAAAAATGTATGG + Intronic
1022234592 7:28448655-28448677 CTTGCCTTCCAGAACATGTAAGG + Intronic
1022549714 7:31227394-31227416 CCTAGATTTCAGAAGATGTATGG + Intergenic
1022798331 7:33750852-33750874 ACTACTATCCAGAATGTGTAAGG - Intergenic
1023137012 7:37062888-37062910 GCTACTTTCCAGGAAAAGAAAGG + Intronic
1023291660 7:38674463-38674485 CTTTCTTTCTAGCAAATGTAAGG + Intergenic
1023353689 7:39345920-39345942 ACTACCTTCCAGAAAATTGAGGG + Intronic
1023543180 7:41288545-41288567 CCTAGATTTCAGAGAATGTATGG + Intergenic
1023573826 7:41603271-41603293 CCTTCTCTCCAGAAATTGCATGG + Intergenic
1023585653 7:41727050-41727072 CATACTTTTTAGAACATGTAAGG - Intergenic
1023650518 7:42364371-42364393 CCTTCATTTCAGAAGATGTAGGG - Intergenic
1023786891 7:43717002-43717024 CCTAGATTTCAGAAGATGTATGG + Intronic
1024021429 7:45374165-45374187 CCTAGATTTCAGAAGATGTATGG - Intergenic
1024289802 7:47794504-47794526 CCTAGATTTCAGAAGATGTATGG + Intronic
1024438563 7:49388210-49388232 CCTAGATTTCAGAAGATGTATGG - Intergenic
1024729258 7:52236109-52236131 CCTACATTTCAGAGGATGTATGG + Intergenic
1026110790 7:67457509-67457531 CCTACTGTCCTGACATTGTAGGG - Intergenic
1026842166 7:73675781-73675803 CCTATTTTTCTGAAAATGCATGG + Intergenic
1027549554 7:79574002-79574024 CCTAGATTTCAGAATATGTATGG + Intergenic
1027556487 7:79670393-79670415 CCTAGATTTCAGAACATGTATGG + Intergenic
1027613822 7:80395915-80395937 CATAATTTCAAGAGAATGTAAGG + Intronic
1027798336 7:82720648-82720670 CCTAGATTTCAGAACATGTATGG - Intergenic
1027834152 7:83219300-83219322 CCTAGATTTCAGAAGATGTATGG + Intergenic
1027937840 7:84632333-84632355 CCTAGATTTCAGAAGATGTATGG + Intergenic
1027993551 7:85395252-85395274 CCTAGATTTCAGAGAATGTATGG - Intergenic
1028011384 7:85648757-85648779 CCTAGATTTCAGAAGATGTATGG - Intergenic
1028189167 7:87825418-87825440 CCTAGATTTCAGAAGATGTAGGG + Intronic
1028360016 7:89956013-89956035 CCTAGATTTCAGAAGATGTATGG - Intergenic
1028745300 7:94320456-94320478 CCTAGATTTCAGAAGATGTATGG - Intergenic
1030072769 7:105711950-105711972 CCTAGATTTCAGAAGATGTATGG - Intronic
1030809902 7:113959294-113959316 CCTAGATTCCAGAGAGTGTATGG - Intronic
1030970051 7:116045555-116045577 CCTAGATTTCAGAAGATGTATGG + Intronic
1031145734 7:117995148-117995170 CCTAGGTTTCAGAAGATGTATGG + Intergenic
1031175049 7:118339181-118339203 CCTAGATTTCAGAAGATGTATGG + Intergenic
1031194200 7:118591321-118591343 CCTACATTTCAGAGGATGTATGG + Intergenic
1031275223 7:119712698-119712720 CCTACATTTCAGAGGATGTATGG - Intergenic
1031298836 7:120039179-120039201 CCTATATTTCAGAAGATGTATGG - Intergenic
1031365482 7:120895656-120895678 CCTAGATTTCAGAAGATGTATGG + Intergenic
1031637563 7:124120039-124120061 CCTAGATTTCAGAAGATGTATGG + Intergenic
1031652067 7:124303495-124303517 CCTAGATTTCAGAAGATGTATGG + Intergenic
1031715936 7:125108924-125108946 CCTAGATTTCAGAGAATGTATGG - Intergenic
1031872528 7:127102681-127102703 CCTACATTTCAGAGGATGTATGG + Intronic
1032053168 7:128662496-128662518 CCTAGATTTCAGAAGATGTATGG + Intergenic
1032454048 7:132058437-132058459 CCTAGATTTCAGAAGATGTATGG + Intergenic
1033072846 7:138220695-138220717 CCTAGATTTCAGAAGATGTACGG + Intergenic
1033456369 7:141507341-141507363 CCTAGATTTCAGAAGATGTATGG - Intergenic
1033759984 7:144427513-144427535 CCTAGATTTCAGAAGATGTATGG - Intergenic
1034037299 7:147838003-147838025 CCTAGATTTCAGAAGATGTATGG - Intronic
1034040740 7:147874335-147874357 CCTAGATTTCAGAGAATGTATGG - Intronic
1034320229 7:150173246-150173268 CCTAGATTTCAGAACATGTATGG - Intergenic
1034740097 7:153465841-153465863 CCTAGATTTCAGAAGATGTATGG + Intergenic
1034772520 7:153793975-153793997 CCTAGATTTCAGAACATGTATGG + Intergenic
1034851912 7:154501639-154501661 CCTAGATTTCAGAAGATGTATGG + Intronic
1034874515 7:154713483-154713505 CCTAGATTTCAGAAGATGTATGG - Intronic
1035088329 7:156280730-156280752 CTTACTTAGAAGAAAATGTATGG - Intergenic
1035135426 7:156698489-156698511 CCTAGATTTCAGAAGATGTATGG - Intronic
1035510693 8:179872-179894 CCTAGATTTCAGAGAATGTATGG - Intergenic
1036091078 8:5666032-5666054 TCTACTTCCCAGAAACAGTAAGG - Intergenic
1036193703 8:6695236-6695258 AGTACTTGCAAGAAAATGTATGG + Intergenic
1036519881 8:9481541-9481563 CCTACATTCCAATGAATGTAGGG - Intergenic
1037048831 8:14343130-14343152 CCTAAATTTCAGAAGATGTATGG + Intronic
1038258714 8:25974018-25974040 GCTCATTTCCAGAAAATGTGAGG + Intronic
1040078063 8:43260201-43260223 CCTAGATTCCAGAGGATGTATGG - Intergenic
1040094902 8:43433819-43433841 CCTAGATTTCAGAAGATGTATGG + Intergenic
1040397190 8:47011209-47011231 CCTAGATTTCAGAAGATGTATGG - Intergenic
1040741346 8:50579786-50579808 CCTAGATTTCAGAAGATGTATGG + Intronic
1040863470 8:52024244-52024266 CCTAGATTTCAGAGAATGTATGG + Intergenic
1040925840 8:52681825-52681847 CCTAGATTTCAGAAGATGTACGG + Intronic
1040945902 8:52883734-52883756 CCTAGATTTCAGAGAATGTATGG - Intergenic
1041251430 8:55938521-55938543 CCTTCTTGCCAGAAAACCTAGGG + Intronic
1041339087 8:56822925-56822947 CCTAGATTTCAGAAGATGTATGG + Intergenic
1041475929 8:58266020-58266042 CCTTCTTATCAGAAACTGTAAGG + Intergenic
1041682229 8:60605266-60605288 CCTAGATTTCAGAGAATGTATGG + Intronic
1041793096 8:61717180-61717202 CCTAGATTTCAGAAGATGTATGG - Intergenic
1041852080 8:62403654-62403676 CCTAGATTTCAGAGAATGTATGG + Intronic
1042073925 8:64967616-64967638 CCTAGATTTCAGAAGATGTATGG - Intergenic
1042169772 8:65980201-65980223 CCTAGATTTCAGAAGATGTATGG + Intergenic
1042423505 8:68619857-68619879 CCTACTGGCCAGAAATTATAAGG - Intronic
1042466340 8:69133413-69133435 CCTAGATTTCAGAAGATGTATGG - Intergenic
1042602537 8:70512639-70512661 CCTAGATTTCAGAAGATGTACGG + Intergenic
1042635418 8:70868374-70868396 CCTAGATTTCAGAAGATGTATGG - Intergenic
1042646077 8:70987853-70987875 CCTAGATTTCAGAAGATGTATGG - Intergenic
1042992365 8:74655603-74655625 CCTAGATTTCAGAAGATGTATGG + Intronic
1043510516 8:80946110-80946132 CCTAGATTTCAGAAGATGTATGG + Intergenic
1043623775 8:82229806-82229828 CCTAGATTTCAGAAGATGTATGG + Intergenic
1044443071 8:92243419-92243441 CCTAGATTTCAGAAGATGTATGG - Intergenic
1044537664 8:93375778-93375800 CCTACTCTCCAGAATATGCCTGG + Intergenic
1044851441 8:96432675-96432697 CCTAGATTTCAGAGAATGTATGG + Intergenic
1045075795 8:98566434-98566456 CATAATTTTCAGAAAATGTATGG - Intronic
1045214167 8:100130179-100130201 CCTAGATTTCAGAAGATGTATGG - Intronic
1045588171 8:103562812-103562834 CCTAGATTTCAGAAGATGTATGG - Intronic
1045736021 8:105296973-105296995 CCTAGATTTCAGAAGATGTATGG - Intronic
1046034234 8:108821782-108821804 CCTAGATTTCAGAAGATGTATGG + Intergenic
1046129275 8:109946753-109946775 CCTAGATTTCAGAAGATGTATGG + Intergenic
1046231515 8:111364501-111364523 CCTAGATTTCAGAAGATGTATGG - Intergenic
1046235893 8:111423867-111423889 CCTAGATTTCAGAAGATGTATGG + Intergenic
1046309453 8:112415404-112415426 CCTAGATTTCAGAAGATGTATGG + Intronic
1046596531 8:116267766-116267788 CCTAATATCCAGAATCTGTAAGG - Intergenic
1046656341 8:116899271-116899293 CCTAGATTTCAGAAGATGTATGG + Intergenic
1046725265 8:117667057-117667079 TCTAATTTACAGAAAATGTCAGG - Intergenic
1046814773 8:118571747-118571769 CCTAGATTCCAGAAGATGTATGG + Intronic
1046865309 8:119142727-119142749 CCTAATATCCAGAATCTGTAAGG + Intergenic
1046929051 8:119824835-119824857 CCTAGATTTCAGAAGATGTATGG + Intronic
1047140399 8:122132480-122132502 CCTACCTGCCAGACAATGTTAGG + Intergenic
1047428728 8:124771824-124771846 ACTACTTCCCAGAAAATGCAAGG + Intergenic
1047535080 8:125712305-125712327 CCTAGATTTCAGAAGATGTATGG + Intergenic
1047545652 8:125813845-125813867 CCTAGATTTCAGAAGATGTATGG + Intergenic
1047772526 8:128041835-128041857 CCAAACTTCCAGAAAAAGTAAGG - Intergenic
1047918047 8:129603849-129603871 CCTAGATTTCAGAAGATGTATGG - Intergenic
1047954633 8:129964572-129964594 CCCATTTTCAAGAAAATGGATGG - Intronic
1048478917 8:134769788-134769810 CCTAGATTTCAGAATATGTATGG - Intergenic
1048768269 8:137867781-137867803 CCTAGATTTCAGAAGATGTATGG + Intergenic
1048769724 8:137882720-137882742 CCTAGATTTCAGAAGATGTATGG + Intergenic
1048772773 8:137912951-137912973 CCTAGATTTCAGAGAATGTATGG - Intergenic
1049085758 8:140477420-140477442 CCTAGATTTCAGAAGATGTATGG - Intergenic
1049825592 8:144665730-144665752 CCTAGATTTCAGAAGATGTATGG + Intergenic
1050185478 9:2968365-2968387 CCGACTTTCAAGAAAAAGAAAGG - Intergenic
1050384816 9:5077567-5077589 ACTACTTACTAGAAAATGCATGG - Exonic
1050905099 9:10993888-10993910 CCTAGATTTCAGAAGATGTATGG + Intergenic
1050935746 9:11392812-11392834 CCTAGATTCCAGACGATGTATGG + Intergenic
1051013541 9:12448038-12448060 CTTAGATTTCAGAAAATGTATGG + Intergenic
1051075525 9:13229874-13229896 ACCACTTTCCAAAAAATGCAAGG - Intronic
1051309800 9:15757920-15757942 CCTAGATTTCAGAAGATGTATGG + Intronic
1051382260 9:16470751-16470773 CCTAGATTTCAGAAGATGTATGG + Intronic
1051450674 9:17193875-17193897 CCTAGATTTCAGAAGATGTACGG - Intronic
1051573167 9:18583404-18583426 CCTAGATTTCAGAAGATGTATGG + Intronic
1051771398 9:20583559-20583581 CCTAGATTGCAGAAGATGTATGG - Intronic
1051869049 9:21715358-21715380 CCTAGATTTCAGAAAATGTATGG - Intergenic
1051967378 9:22845201-22845223 CCTAGATTTCAGACAATGTATGG - Intergenic
1052070978 9:24081092-24081114 CCTAAATTTCAGAAGATGTATGG + Intergenic
1052210181 9:25894182-25894204 CCTAGGTTTCAGAAGATGTATGG - Intergenic
1052238223 9:26239067-26239089 CTTACTGTCTATAAAATGTAGGG + Intergenic
1052637258 9:31121471-31121493 CCTAGATTTCAGAAGATGTATGG - Intergenic
1052701333 9:31941457-31941479 CCTACATTTCAGAGGATGTATGG + Intergenic
1052782558 9:32795998-32796020 CCTACATTTCAGGAGATGTATGG - Intergenic
1052969419 9:34367973-34367995 CCTAGATTTCAGAGAATGTATGG - Exonic
1053125870 9:35580475-35580497 CCTAGTTTTCAGAGGATGTATGG + Intergenic
1053246036 9:36535464-36535486 CCTAGATTTCAGAAGATGTATGG + Intergenic
1053384170 9:37673670-37673692 CCTAGATTTCAGAAGATGTATGG - Intronic
1053632973 9:39964501-39964523 CCTAGATTTCAGAAGATGTATGG + Intergenic
1053772780 9:41499032-41499054 CCTAGATTTCAGAAGATGTATGG - Intergenic
1054210915 9:62286196-62286218 CCTAGATTTCAGAAGATGTATGG - Intergenic
1054314068 9:63562658-63562680 CCTAGATTTCAGAAGATGTATGG + Intergenic
1055362021 9:75501882-75501904 CCTAATATCCAGAATCTGTAAGG - Intergenic
1055384634 9:75747857-75747879 CCTAGATTTCAGAAGATGTATGG + Intergenic
1055406847 9:75983907-75983929 CCCACTTTCCAAAAAATACAGGG + Intronic
1055520004 9:77071166-77071188 CCTACTTTCCAAAAAGTTTCTGG + Intergenic
1055711547 9:79067427-79067449 CCAGCTTTCCAGAATATGTTTGG + Intergenic
1056012465 9:82346420-82346442 CCTAGATTTCAGAAGATGTATGG + Intergenic
1056129213 9:83567094-83567116 CCTAGATTTCAGAAGATGTATGG - Intergenic
1056639395 9:88357712-88357734 CCTAGATTTCAGAAGATGTATGG + Intergenic
1057645097 9:96866450-96866472 CCTAGATTTCAGAAGATGTATGG + Intronic
1057983105 9:99681893-99681915 CCTAGGTTTCAGAAGATGTATGG - Intergenic
1058076533 9:100657267-100657289 CCTAGATTTCAGAAGATGTATGG + Intergenic
1058181727 9:101807807-101807829 CCTAGATTTCAGAAGATGTATGG + Intergenic
1058230345 9:102417295-102417317 CCTAGATTTCAGAAGATGTATGG + Intergenic
1058283717 9:103150407-103150429 CCTAGATTTCAGAAGATGTATGG + Intergenic
1058330749 9:103756978-103757000 CCTAGATTTCAGAAGATGTATGG - Intergenic
1058380449 9:104371832-104371854 CCTAGATTTCAGAAGATGTATGG + Intergenic
1058834450 9:108848716-108848738 CCTAGATTTCAGAAGATGTATGG - Intergenic
1058874710 9:109233838-109233860 CCTACTTTTAAAAAAATGTCTGG + Intronic
1059110741 9:111556520-111556542 CCTAGATTTCAGAGAATGTATGG - Intronic
1059187067 9:112283997-112284019 CCTACATTTCAGAGGATGTATGG + Intronic
1059482302 9:114600863-114600885 CCTAGATTTCAGAAGATGTATGG - Intergenic
1059614777 9:115937633-115937655 CCTAATTTAAAGAAAATGTTTGG + Intergenic
1060100538 9:120836777-120836799 ACTTCTTTTCAGAATATGTAAGG - Intronic
1060290163 9:122294978-122295000 TCTGCTTTCCTGAATATGTAAGG - Intronic
1060622714 9:125082321-125082343 CCTAGATTTCAGAAGATGTATGG + Intronic
1062157887 9:135063851-135063873 CCTAGTTTTCAGAAGATGTATGG - Intergenic
1062616937 9:137401546-137401568 CCTACATTTCAGAAGATGTTTGG - Intronic
1062757229 9:138306744-138306766 CCTAGATTTCAGAGAATGTATGG + Intergenic
1203663109 Un_KI270754v1:1191-1213 CCTGCTTTCCAAAACATGTGTGG + Intergenic
1185893637 X:3840804-3840826 CCTAGATTTCAGAAGATGTATGG + Intronic
1185898752 X:3879228-3879250 CCTAGATTTCAGAAGATGTATGG + Intergenic
1185903869 X:3917657-3917679 CCTAGATTTCAGAAGATGTATGG + Intergenic
1186096059 X:6103342-6103364 CTTTCCTTCCAGAAAATGGAGGG - Intronic
1186700303 X:12083385-12083407 CCTAGATTTCAGAAGATGTATGG + Intergenic
1186992441 X:15084576-15084598 CCTAGATTTCAGAAGATGTATGG + Intergenic
1187555192 X:20344664-20344686 CCTATATTTCAGAAGATGTATGG + Intergenic
1187925467 X:24245730-24245752 CCTACTTCCCAGACAATGCAAGG + Intergenic
1188003816 X:25004380-25004402 CTTACTTTCCTGAAAATATCGGG - Exonic
1188162354 X:26819499-26819521 CCTAGTTTTCAGAGGATGTATGG + Intergenic
1188193560 X:27201263-27201285 ATTATTTTCCATAAAATGTATGG - Intergenic
1188196400 X:27240454-27240476 CCTAGATTTCAGAAGATGTATGG + Intergenic
1188325525 X:28796935-28796957 CCTAGATTTCAGAAAATGTATGG - Intronic
1188449583 X:30295065-30295087 CCTAGATTTCAGAAGATGTATGG + Intergenic
1188510839 X:30934771-30934793 CCTAATCTCCAGAACCTGTAAGG - Intronic
1188749258 X:33885218-33885240 CCTAGATTTCAGAGAATGTATGG + Intergenic
1188764999 X:34080388-34080410 CCTAGATTTCAGAAGATGTATGG - Intergenic
1188794211 X:34442043-34442065 CCTAGATTTCAGAAGATGTATGG - Intergenic
1188889695 X:35595119-35595141 CCTAGATTTCAGAGAATGTATGG + Intergenic
1189140437 X:38599684-38599706 CCTGCTGCCAAGAAAATGTAGGG - Intronic
1189228787 X:39435724-39435746 CCTAGATTTCAGAAGATGTATGG - Intergenic
1189253735 X:39621260-39621282 CCTAGATTTCAGAGAATGTATGG - Intergenic
1189629517 X:42937538-42937560 CCTACATCCCAGAAAATTCAAGG + Intergenic
1189669749 X:43395218-43395240 CCTAGATTTCAGAGAATGTATGG - Intergenic
1189727452 X:43982510-43982532 TCTAATATCCAGAAAATATAAGG + Intergenic
1189788717 X:44583368-44583390 CCTAGATTTCAGAGAATGTATGG + Intergenic
1190002552 X:46703144-46703166 TCTAATTTCCAGAATCTGTAAGG - Intronic
1190078886 X:47339488-47339510 ACCACTTTCCAGAATATTTAAGG - Intergenic
1190499704 X:51062536-51062558 CCTAGATTTCAGAGAATGTATGG + Intergenic
1190513283 X:51195659-51195681 CCTAGATTTCAGAAGATGTATGG - Intergenic
1191116421 X:56857738-56857760 CCTAGATTTCAGAAGATGTATGG - Intergenic
1191188577 X:57640259-57640281 CCTAGATTTCAGAAGATGTATGG + Intergenic
1191802147 X:65093201-65093223 CCTAGATTTCAGAAGATGTATGG + Intergenic
1191856119 X:65628304-65628326 CCTAGATTTCAGAAGATGTATGG - Intronic
1192162469 X:68798794-68798816 CCTAGATTTCAGAAGATGTATGG + Intergenic
1192270541 X:69575302-69575324 CCTAGATTTCAGAAGATGTATGG - Intergenic
1192309432 X:69997906-69997928 CCTAGATTTCAGAAGATGTATGG + Intronic
1192501136 X:71653326-71653348 CCTAGATTTCAGAAGATGTATGG - Intergenic
1192527740 X:71862101-71862123 CCTAGATTTCAGAAGATGTATGG - Intergenic
1192932824 X:75825875-75825897 CCTAGGTTTCAGAGAATGTATGG - Intergenic
1193221228 X:78929053-78929075 CCTAGATTTCAGAAGATGTATGG - Intergenic
1193332948 X:80256114-80256136 CCTAGATTCCAGAGGATGTATGG + Intergenic
1193459723 X:81775867-81775889 CCTGGATTCCAGAAGATGTATGG - Intergenic
1193527569 X:82612250-82612272 CCTAGATTTCAGAAGATGTAAGG + Intergenic
1193529848 X:82643171-82643193 CCTAGATTTCAGAAGATGTATGG - Intergenic
1193865059 X:86720866-86720888 CCTACATTTCAGAGGATGTATGG - Intronic
1193938231 X:87649399-87649421 ACTAATTTCCAGAATATGTACGG - Intronic
1193962854 X:87947299-87947321 CCTAGATTTCAGAAAATATATGG + Intergenic
1194035117 X:88861156-88861178 GCTATTTTCCAGAAAATTTGAGG + Intergenic
1194149805 X:90309888-90309910 CCTAGATTTCAGAAGATGTAAGG - Intergenic
1194150814 X:90323445-90323467 CCTAGATTTCAGAGAATGTATGG - Intergenic
1194200650 X:90950204-90950226 CCTAGATTTCAGAAGATGTATGG + Intergenic
1194211554 X:91076217-91076239 ACTGCTTCCCAGACAATGTAAGG - Intergenic
1194216397 X:91134832-91134854 CCTAGATTTCAGAAGATGTATGG + Intergenic
1194256922 X:91646189-91646211 CCTAGATTTCAGAAGATGTATGG + Intergenic
1194349090 X:92803427-92803449 CCTAGATGCTAGAAAATGTAAGG - Intergenic
1194373997 X:93110163-93110185 CCTGGATTTCAGAAAATGTATGG - Intergenic
1194473966 X:94335655-94335677 CCTAGATTTCAGAAGATGTATGG + Intergenic
1194527015 X:94989520-94989542 CCTAGATTTCAGATAATGTATGG - Intergenic
1194843621 X:98776113-98776135 CCTAGTTTTCAGAGGATGTATGG + Intergenic
1194856244 X:98932901-98932923 CCTAGATTTCAGAGAATGTATGG + Intergenic
1194881169 X:99253678-99253700 CCTAGATTTCAGAGAATGTATGG - Intergenic
1194952652 X:100145233-100145255 CCTAGATTTCAGAAGATGTATGG + Intergenic
1195022144 X:100839825-100839847 TCTACTATCCAGAAACAGTAAGG - Intronic
1195206941 X:102610846-102610868 CCTAGATTTCAGAAGATGTATGG + Intergenic
1195514573 X:105758722-105758744 CTTACTTTCCAGTAAAAGTTTGG + Intronic
1195522766 X:105850098-105850120 CCTAGATTTCAGAAGATGTATGG - Intronic
1195525915 X:105889611-105889633 CCTAGATTTCAGAAGATGTATGG - Intronic
1195545240 X:106106212-106106234 CCTAGATTTCAGAAGATGTATGG + Intergenic
1195767545 X:108312445-108312467 CCTATATTCCATAAAATGGAAGG - Intronic
1195816777 X:108896761-108896783 CCTACATTTCAGAGGATGTATGG + Intergenic
1195863720 X:109407834-109407856 CCTAGATTTCAGAAGATGTATGG + Intronic
1196036374 X:111149516-111149538 CCTAGATTTCAGAAGATGTATGG - Intronic
1196366760 X:114932500-114932522 CCTAGATTTCAGAAGATGTATGG - Intergenic
1196566060 X:117206561-117206583 CCTAGATTTCAGAAAATGTGTGG - Intergenic
1196567851 X:117229866-117229888 CCTAGATTTCAGAGAATGTATGG - Intergenic
1196874123 X:120141985-120142007 CCTACTATCCAGAATCTATAAGG - Intergenic
1196973871 X:121137925-121137947 CCTAGATTTCAGAAGATGTATGG - Intergenic
1197074754 X:122341046-122341068 CCTAGATTTCAGAAGATGTAGGG - Intergenic
1197223147 X:123932452-123932474 CCTACATTTCAGAGGATGTATGG + Intergenic
1197301701 X:124789030-124789052 CCTAGATTTCAGAAGATGTATGG - Intronic
1197349785 X:125369874-125369896 CCTAGATTTCAGAGAATGTATGG - Intergenic
1197400091 X:125979417-125979439 CCTAGATTTCAGAAGATGTAGGG - Intergenic
1197499093 X:127222209-127222231 TCTAGATTCCAGAGAATGTACGG + Intergenic
1197511117 X:127370834-127370856 CCTAGATTTCAGAAGATGTATGG - Intergenic
1197547050 X:127838349-127838371 CCTAAATTTCAGAATATGTATGG - Intergenic
1197639749 X:128954664-128954686 CCTAGATTTCAGAAGATGTATGG - Intergenic
1197640273 X:128959660-128959682 CCTAGATTTCAGAAGATGTATGG - Intergenic
1197642885 X:128986160-128986182 CCTAGATTTCAGAAGATGTATGG + Intergenic
1197856582 X:130919577-130919599 CCTAGATTTCAGAAGATGTATGG - Intergenic
1197975674 X:132163461-132163483 CCTAGATTTCAGAAGATGTATGG + Intergenic
1198324733 X:135557902-135557924 CTTAATTTCCAAAAAATATAAGG + Intronic
1198408609 X:136342246-136342268 CTTACTTTCCAGTAGATATAGGG + Intronic
1198734622 X:139772269-139772291 CCTAGATTTCAGAATATGTATGG + Intronic
1198857506 X:141033515-141033537 CCTAGATTTCAGAAGATGTATGG + Intergenic
1198905190 X:141553856-141553878 CCTAGATTTCAGAAGATGTATGG - Intergenic
1198919359 X:141708311-141708333 CCTAGATTTCAGAAGATGTAAGG - Intergenic
1199117390 X:144008644-144008666 CTTACATTTCAGAAGATGTATGG - Intergenic
1199189313 X:144951766-144951788 CCTAGATTTCAGAGAATGTATGG - Intergenic
1199214031 X:145246563-145246585 CCTAGATTTCAGAAGATGTATGG - Intergenic
1199278096 X:145970009-145970031 CCTAGATTTCAGAAGATGTATGG + Intergenic
1199301720 X:146221124-146221146 CCTGGATTCCAGAAGATGTATGG - Intergenic
1199362887 X:146943397-146943419 CCTAGATTTCAGAAGATGTATGG - Intergenic
1199566091 X:149217187-149217209 CCTAGATTTCAGAAGATGTATGG + Intergenic
1199999315 X:153049496-153049518 CCTAGATTTCAGAAGATGTATGG + Intergenic
1200332327 X:155310783-155310805 CCTAGATTTCAGAGAATGTATGG - Intronic
1200381582 X:155842939-155842961 CCTAGATTTCAGAAGATGTATGG + Intergenic
1200496179 Y:3886622-3886644 CCTAGATTTCAGAAGATGTAAGG - Intergenic
1200497182 Y:3900206-3900228 CCTAGATTTCAGAGAATGTATGG - Intergenic
1200546639 Y:4526638-4526660 CCTAGATTTCAGAAGATGTATGG + Intergenic
1200575641 Y:4885456-4885478 CCTAGATTTCAGAAGATGTATGG + Intergenic
1200682026 Y:6224234-6224256 CCTGGATTTCAGAAAATGTATGG - Intergenic
1200751443 Y:6948051-6948073 CCTACTTCCCAGTAATAGTATGG + Intronic
1201469477 Y:14317882-14317904 CCTACATTTCTGAAGATGTATGG + Intergenic
1201592362 Y:15629046-15629068 CCTAGATTTCAGAAGATGTATGG + Intergenic
1201681127 Y:16644579-16644601 CGTACATTCCAGACATTGTATGG - Intergenic