ID: 916787040

View in Genome Browser
Species Human (GRCh38)
Location 1:168093885-168093907
Sequence TGCTGCCTCCTCCTGGGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 473
Summary {0: 1, 1: 0, 2: 7, 3: 47, 4: 418}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916787036_916787040 -4 Left 916787036 1:168093866-168093888 CCCAGACTCTTACTGATGCTGCT 0: 1
1: 0
2: 0
3: 17
4: 181
Right 916787040 1:168093885-168093907 TGCTGCCTCCTCCTGGGATCAGG 0: 1
1: 0
2: 7
3: 47
4: 418
916787035_916787040 14 Left 916787035 1:168093848-168093870 CCACATTCTGCTTTGGTTCCCAG 0: 1
1: 0
2: 1
3: 24
4: 300
Right 916787040 1:168093885-168093907 TGCTGCCTCCTCCTGGGATCAGG 0: 1
1: 0
2: 7
3: 47
4: 418
916787037_916787040 -5 Left 916787037 1:168093867-168093889 CCAGACTCTTACTGATGCTGCTG 0: 1
1: 0
2: 1
3: 19
4: 238
Right 916787040 1:168093885-168093907 TGCTGCCTCCTCCTGGGATCAGG 0: 1
1: 0
2: 7
3: 47
4: 418

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916787040 Original CRISPR TGCTGCCTCCTCCTGGGATC AGG Intronic
900154841 1:1199754-1199776 TGCACCCTCCTCATGGGTTCTGG - Intergenic
900346332 1:2212274-2212296 TGTAGCCTCCTCCCAGGATCCGG + Intronic
900358989 1:2278941-2278963 TGCTGCCGCCTCCTGGACCCTGG + Intronic
900569178 1:3349970-3349992 TGCTGTCTCCTCCAGGGCTCAGG - Intronic
901083704 1:6597919-6597941 TGCTGCCTCCGGCTGGTTTCTGG - Intronic
901259309 1:7859915-7859937 AGCCTCCGCCTCCTGGGATCAGG - Intergenic
902367103 1:15983179-15983201 TCCTGGCTCATCCTGGAATCTGG - Intergenic
902690232 1:18106533-18106555 TGCTCCCTCCTCCTGCCCTCTGG - Intergenic
903023981 1:20413876-20413898 AGCTGCCTTCTCCTGGGTTGGGG - Intergenic
903546671 1:24128349-24128371 TGCTCGCTCCTCCTGGATTCTGG + Intronic
904433691 1:30480502-30480524 TGCTTTCTCCTCCTGAGGTCAGG + Intergenic
905023148 1:34831745-34831767 TGCTTCCTCTTTCTGGGAACTGG - Intronic
905044292 1:34984213-34984235 AGCCCCCTCCTCCTGGGATTTGG - Intronic
906150527 1:43584874-43584896 GGCTGCCTCCCCCTGCGATTAGG + Intronic
906193985 1:43918198-43918220 AGCTGCCGCCTCCAGGGCTCCGG + Intronic
906716005 1:47969811-47969833 TGCTGGCTTCACCTGGGACCAGG - Intronic
907177781 1:52541122-52541144 CTCTGCCTCCTCCTGGGTTCAGG - Intronic
907218916 1:52890683-52890705 TGCTGCTTCAACCTGGGCTCAGG + Intronic
907860232 1:58345764-58345786 GGCTGCAACCTCCTGGGATGGGG - Intronic
907913292 1:58846077-58846099 TGCTGCCTCCTTATGCCATCAGG + Intergenic
908123925 1:61011906-61011928 TGGTGCCTACTCCTGGGCGCTGG - Intronic
908231107 1:62105975-62105997 TCCTGCCTCATCCTGGGAGCTGG - Intronic
910273094 1:85418533-85418555 TGATGCCTTCTCCTGGTATTTGG - Intronic
911188783 1:94927498-94927520 GTCTGCCTCCTCCCGGGCTCTGG + Intergenic
912079032 1:105912460-105912482 TGCAGCTTCCTCCTGATATCAGG - Intergenic
912581371 1:110724108-110724130 TGCTCCCACCTCCTGTGATAGGG + Intergenic
912951694 1:114124733-114124755 TCCTGCCTCTTCCTGGGTTGGGG - Intronic
912991276 1:114488966-114488988 AGCTTCCACCTCCTGGGCTCAGG - Intronic
913227067 1:116709722-116709744 TGCTGCCAGCACCTGGGATGAGG + Intergenic
914917616 1:151828083-151828105 TGCTACCTCCTCCTGGGTGGGGG - Intronic
914918677 1:151833314-151833336 TGCTGGCTCCTCCTGTCAGCTGG - Intergenic
915346220 1:155198348-155198370 TGCTGCCTCCACCTGGGCAAAGG + Intronic
916647113 1:166797156-166797178 AGTGGCCTCCTCCTGGGAGCAGG - Intergenic
916739591 1:167636666-167636688 TGCAACCTCCTCCCGGGTTCAGG + Intronic
916787040 1:168093885-168093907 TGCTGCCTCCTCCTGGGATCAGG + Intronic
917008050 1:170437550-170437572 CACTACCTCCTCATGGGATCAGG + Intergenic
917489036 1:175481871-175481893 TGCTGCCTCCTGCTGGAAGTTGG + Intronic
919984004 1:202660097-202660119 AGCTCTCTCCTCCTGGGGTCAGG + Intronic
920108798 1:203572773-203572795 TGCTGCCTCCTCCTGCTCCCAGG - Intergenic
920333307 1:205227909-205227931 GGCTGCCTCCGCCCGGGAGCGGG - Intergenic
920918759 1:210280227-210280249 TTCTGCCTCCACCGTGGATCTGG - Intergenic
921397459 1:214683725-214683747 TGCTGCTCCCTCCTGTGATTTGG - Intergenic
921552984 1:216561618-216561640 TGCTGCCTTACCCTGGGTTCAGG - Intronic
922791549 1:228313933-228313955 TCCTGCGGGCTCCTGGGATCAGG + Intronic
922842155 1:228651204-228651226 TGCTGCCTCCCCCTGGTAGGAGG - Intergenic
924560938 1:245156043-245156065 GGTGGCCTCCTCCTGGGGTCAGG - Intronic
924819948 1:247479594-247479616 TGCTGCATCCACCTGGGAGCAGG - Intergenic
1064301983 10:14130997-14131019 TGCTTTCTCCTCCTGGTGTCAGG - Intronic
1065826299 10:29574801-29574823 TGATGTCTCCTTCTGGGGTCAGG - Intronic
1067270627 10:44788691-44788713 CACTGCCTCTTCCTGGCATCAGG + Intergenic
1067475212 10:46560450-46560472 TGGTTCCTCCTGTTGGGATCTGG - Intergenic
1067750658 10:48969166-48969188 TGCTGCCTCCTCTCTGGAACAGG + Exonic
1067793834 10:49306813-49306835 TGGTGGGTCCCCCTGGGATCTGG - Intronic
1067835130 10:49633624-49633646 GGTTGGCTCCTCCTGGGTTCAGG - Intronic
1071589295 10:86856992-86857014 TGCTCTCTTCTCCTGGGATCAGG + Intronic
1073510783 10:104041171-104041193 TGCTGCCTCCTCCTGAGCAGAGG - Intronic
1074961177 10:118447568-118447590 TGCTTCCTGCTCCTGGCATCTGG - Intergenic
1075076822 10:119357514-119357536 TGCTGCCTGCTCCTGGGGAGTGG + Intronic
1075483894 10:122804871-122804893 TGCTGCCGCCTGCTGAGTTCCGG + Intergenic
1075978795 10:126719638-126719660 TGGTTCCTCCTCTTGGGACCAGG - Intergenic
1076695015 10:132243148-132243170 TCCTGCATCCTCCTGTGAGCTGG - Intronic
1076838763 10:133034265-133034287 TGCTGTTTCCTCCTGCAATCTGG - Intergenic
1077150702 11:1071851-1071873 TGCTGCCTCCTGATGGCCTCCGG - Intergenic
1077716016 11:4581512-4581534 ATCTGCCTCCTCCTGCAATCTGG + Intergenic
1077716765 11:4589096-4589118 ATCTGCCTCCTCCTGCTATCTGG + Intergenic
1078238499 11:9508483-9508505 TGCTGCCTCATGGTGGGATGAGG + Intronic
1078248350 11:9596706-9596728 AACTGCCGCCTCCTGGGCTCAGG - Intergenic
1078281070 11:9901724-9901746 AGCTGCGACCTCCTGGGCTCAGG + Intronic
1078705669 11:13741263-13741285 TGCTGCTTCCTGCTGGACTCGGG + Intergenic
1078759616 11:14241935-14241957 TGCAGCCTCCTCCTAGGCTCAGG - Intronic
1079440092 11:20504813-20504835 AACTGCCACCTCCTGGGTTCAGG + Intronic
1080122929 11:28698106-28698128 TGCTGCCCCCTGCTGGCATCTGG + Intergenic
1080421963 11:32118343-32118365 TCCTGCCTCCTCCTGAGGTCAGG + Intergenic
1080457597 11:32430541-32430563 CCCTGCCTACTCCTGGGCTCAGG - Intronic
1081925866 11:46827541-46827563 TGCAGCCTAGTCCTGGGCTCAGG - Intronic
1082862328 11:57868219-57868241 TAGTGGCTCATCCTGGGATCTGG + Intergenic
1083163846 11:60871660-60871682 CTCAGCCTCCTCCTGGGACCTGG - Intronic
1083932273 11:65852583-65852605 TGCTGCCCTGTCCTGGCATCCGG - Intronic
1084330336 11:68426231-68426253 TCCAGCCTCCTCCAGGGGTCGGG - Intronic
1084360604 11:68666558-68666580 TCCTGCCTCCTCCTGTTAGCTGG - Intergenic
1084746078 11:71170769-71170791 AGCTGCTTCCTCCTGGCACCTGG - Intronic
1084953852 11:72681038-72681060 AGCTTCCTCCTCCTGGGGTGTGG - Intergenic
1085128669 11:74019195-74019217 TCCTGGCTCCTCCTGGACTCTGG + Intronic
1085739093 11:79063871-79063893 AGCTGGCACGTCCTGGGATCAGG + Intronic
1086642410 11:89176033-89176055 TGCTGCCTCTGGCTGGAATCAGG - Intergenic
1087159503 11:94935271-94935293 TGCTGCCCCATCCTGGGCTCTGG + Intergenic
1089823067 11:121246275-121246297 TCCTGCCTGCTCCTTGGAGCGGG - Intergenic
1090525391 11:127528955-127528977 TACTCCCTTCTCTTGGGATCTGG + Intergenic
1091032100 11:132199648-132199670 TGCTTTCTCCTGCTGGGAACTGG + Intronic
1091448630 12:559239-559261 TCCTTCCTCCTCCTGGCCTCTGG + Intronic
1091687153 12:2571371-2571393 TACTTGCTCCTCCTGGGGTCTGG + Intronic
1091983010 12:4881799-4881821 TGCTGCCACATCCAGGAATCAGG + Intergenic
1092162632 12:6324311-6324333 TCCAGCCTCTTCCTGGGGTCGGG + Intronic
1092171542 12:6376455-6376477 CCCTGCCTCTTCCTGGGCTCCGG - Intronic
1093082180 12:14825260-14825282 TGCTGCTGCCTCCTGGCTTCTGG + Intronic
1094118130 12:26938848-26938870 GGCTCCCTGCTCCTGGGAGCCGG + Intronic
1095510813 12:42949805-42949827 TGCTTCCTTCTCCAGGGAGCTGG + Intergenic
1097108668 12:56641281-56641303 TGCAACCTCCTCCTGGGTTCAGG - Intronic
1097130367 12:56806796-56806818 TGCTGCCCCCTCCTGACATCAGG + Intergenic
1097267677 12:57755363-57755385 TGCTGCCACCGCCGGGGCTCCGG - Exonic
1099693811 12:85993631-85993653 TGCAGCCCCCTCCTGACATCAGG - Intronic
1100840463 12:98607570-98607592 TAACGCGTCCTCCTGGGATCTGG - Intergenic
1101020266 12:100546611-100546633 TGCCTCCACCTCCTGGGTTCAGG - Intronic
1101326798 12:103722874-103722896 TGATGTCTCCACCTGGGGTCTGG - Intronic
1101424479 12:104576644-104576666 TGCAGCCTTCTCCTGGGCTTTGG - Intronic
1101447429 12:104747232-104747254 TGGTGCAGCCTCCTGGGGTCTGG - Intronic
1102299466 12:111760468-111760490 TTCTGCCTCCCCTGGGGATCAGG - Intronic
1102348228 12:112173072-112173094 TGCTGCATCCTTCTGGGAGGTGG + Intronic
1102519773 12:113471136-113471158 TTCTTCCTCCGCCTGGGCTCGGG + Intronic
1103854270 12:123954848-123954870 TGCTCCCTCCTCCTGGGGTGGGG - Intronic
1103981697 12:124741054-124741076 TGCTGCCTCCTCCAGGTGTGTGG - Intergenic
1104065542 12:125302281-125302303 AGCCTCCACCTCCTGGGATCAGG - Intronic
1104968491 12:132520606-132520628 TGCTGCTACCTCCTGGGGGCTGG - Intronic
1105242514 13:18620719-18620741 TTCTGTCTCCTCCTGGGGTGAGG - Intergenic
1105253729 13:18725538-18725560 TGCTGCTTCCTCCAGGGACATGG + Intergenic
1105805156 13:23948125-23948147 TGCAGGCTCCCCCTGGGATGTGG + Intergenic
1105955905 13:25282452-25282474 TGCTTCCTCCTCCTTGGGCCAGG - Intronic
1106411514 13:29514449-29514471 TGCTGCCACCTCCGGGGGGCGGG + Exonic
1106411973 13:29516956-29516978 TGCTGCCTCCTTCCAGGGTCTGG + Intronic
1106792108 13:33166381-33166403 TCCTCTCTCCTCCTGGGCTCTGG + Intronic
1108053853 13:46467403-46467425 TGCCTCCCCCTCCTGGGATGGGG - Intergenic
1108688979 13:52846010-52846032 GGCGGCCTCCTCCGGGGAGCCGG + Exonic
1108847766 13:54696954-54696976 TGCAGCTTCCTCCTGACATCAGG + Intergenic
1108934373 13:55867348-55867370 TGCAGCTTCCTCCTGGTATCAGG + Intergenic
1110718143 13:78731161-78731183 TGCCTCCGCCTCCTGGGTTCAGG + Intergenic
1111168171 13:84490733-84490755 TGCAGCATCCTCCTGATATCAGG - Intergenic
1113777162 13:112954367-112954389 TGCTGCCTCCTCGAGGTTTCAGG - Intronic
1113885119 13:113654749-113654771 GGCTGCCGCCTCCTCGGCTCTGG - Intronic
1113925533 13:113939593-113939615 AGCCGCCTCCTCCTGGGCTTTGG + Intergenic
1114646763 14:24260337-24260359 GGCTGGCTTCTCCTGGGGTCAGG + Intronic
1114977734 14:28123096-28123118 TGCTGCCTCCCCCGGAGCTCAGG + Intergenic
1115641426 14:35337856-35337878 TGCTGCTGCCTCCTGAGGTCAGG + Intergenic
1116004126 14:39274505-39274527 TGTAGCCTCCTCCCGGGTTCAGG + Intronic
1118895376 14:69941319-69941341 CGCTGCCTCCTCCTGAGAGGTGG - Intronic
1119165423 14:72488683-72488705 TGCAGGCTCCTCTTGGGACCAGG + Intronic
1119171580 14:72539816-72539838 TGGTGCCGCCTCCTTGGAGCAGG - Intronic
1121433034 14:93900669-93900691 TGCAGCCACAGCCTGGGATCTGG - Intergenic
1122282730 14:100633609-100633631 GGCTGCCTCCTCCTGGGAGCAGG - Intergenic
1122906179 14:104802606-104802628 TGCTGCCTCTTCCTGGAACTTGG + Exonic
1122956321 14:105073197-105073219 TGCTCCCTGCCCGTGGGATCTGG + Intergenic
1122975522 14:105169171-105169193 TGCCGCCTCCTACTCTGATCAGG + Intergenic
1123015692 14:105373704-105373726 AGCTTCCACCTCCTGGGCTCAGG - Intronic
1123096147 14:105767967-105767989 TGCTGTGTCCTGCTGGGCTCGGG + Intergenic
1202839059 14_GL000009v2_random:103486-103508 TGTTGCCTCCTCCTGAGTTTGGG - Intergenic
1202908426 14_GL000194v1_random:93577-93599 TGTTGCCTCCTCCTGAGTTTGGG - Intergenic
1123488785 15:20763874-20763896 TTCTGTCTCCTCCTGGGGTGAGG + Intergenic
1123545284 15:21332961-21332983 TTCTGTCTCCTCCTGGGGTGAGG + Intergenic
1123631312 15:22261827-22261849 AGCTTCTACCTCCTGGGATCAGG - Intergenic
1123903961 15:24903950-24903972 AACTGCCACCTCCTGGGCTCAGG - Intronic
1124240093 15:28021368-28021390 TGCAGCCTTATTCTGGGATCAGG - Intronic
1125292881 15:38168993-38169015 TGCTTGCTCCTCCTTTGATCTGG - Intergenic
1125781803 15:42275290-42275312 AACTGCCGCCTCCTGGGCTCAGG - Intronic
1128110382 15:65072270-65072292 GGCTGCCTCCTCCAGGCCTCTGG + Intronic
1128189096 15:65673387-65673409 AGCTTCCTCCTCCTGGGTTCAGG - Intronic
1128868860 15:71136980-71137002 TGCTGCCTCCTCCTGGTGTGTGG + Intronic
1129038517 15:72665314-72665336 TGCCTGCTCCTCCTGGGAACTGG - Intronic
1129211372 15:74071916-74071938 TGCCTGCTCCTCCTGGGAACTGG + Intronic
1129399029 15:75269168-75269190 TGCCTGCTCCTCCTGGGAACTGG - Intronic
1129402637 15:75293444-75293466 TGCCTGCTCCTCCTGGGAACTGG - Intronic
1129476169 15:75785869-75785891 TGCCTGCTCCTCCTGGGAACTGG - Intergenic
1130415322 15:83688888-83688910 AGCTTCCACCTCCTGGGCTCAGG + Intronic
1130511141 15:84590228-84590250 TGCTGAGTCCTCCAGGGATGAGG - Intergenic
1130739978 15:86588753-86588775 TGCTGCCTCCTCATAGGGTCAGG - Intronic
1130819882 15:87483691-87483713 TGTTACCTCCTCCTGCGAGCAGG - Intergenic
1130994035 15:88894434-88894456 TGCTGCCTCCTGCTGGTACCTGG - Intronic
1131110176 15:89760095-89760117 GGCTGCATCCTCCAGGGATCTGG - Intergenic
1131511239 15:93050703-93050725 TGCTTCCACCCCCTGGGGTCTGG + Intronic
1132075405 15:98815877-98815899 TGCTGCCTCCACCCTGGATGAGG + Intronic
1132414365 15:101610104-101610126 TGATGCCACCTCCCAGGATCTGG + Intergenic
1202953630 15_KI270727v1_random:60232-60254 TTCTGTCTCCTCCTGGGGTGAGG + Intergenic
1132601745 16:775896-775918 GACAGCCTCCTCCTGGCATCGGG + Intronic
1132617315 16:848046-848068 TGCTGCCTCCTGCTGGTGTGTGG + Intergenic
1132939820 16:2501113-2501135 TGCTGCCTCTACCTGGGGTTTGG + Exonic
1134108708 16:11501437-11501459 AGCCGCCACCTCCTGGGCTCAGG + Intronic
1134133845 16:11667427-11667449 TGGGACCTCCTCCTGGGAACGGG - Intergenic
1134454329 16:14383195-14383217 TGCAGCCTCTACCTGGGCTCAGG - Intergenic
1135491638 16:22914653-22914675 AGCTTCCAACTCCTGGGATCAGG - Intronic
1135602691 16:23796670-23796692 AGCCTCCTCCTCCTGGGCTCAGG + Intergenic
1136109963 16:28058544-28058566 AGCTTCCACCTCCTGGGCTCAGG - Intronic
1136631249 16:31490396-31490418 CGCTGCCTCCTCCTGGGTAAGGG - Exonic
1136736435 16:32471740-32471762 ATCAGCCACCTCCTGGGATCAGG + Intergenic
1137412938 16:48244657-48244679 CGCGGCCTCCTCCGGGGACCTGG + Intronic
1138587471 16:57979951-57979973 TCCTGCCTCAGCCTGGGAGCTGG - Intronic
1139615138 16:68084398-68084420 AGACGCCTCCTCCTGGGGTCTGG - Intergenic
1139946808 16:70647391-70647413 GGCTGCCTTCTCCAGGCATCTGG - Intronic
1140469670 16:75207015-75207037 TGCTGCCTCTTGCTGGCCTCGGG + Intronic
1140475934 16:75239260-75239282 TGTTCTCTCCTCCTGGGCTCTGG - Intronic
1141086127 16:81096566-81096588 TGCTGCCTCTTCCGGGCCTCAGG - Intergenic
1141846750 16:86614953-86614975 GGCTTCCTCCTCCTGGGTTCTGG - Intergenic
1141869937 16:86778480-86778502 TGCTGCTGCCTCCTGGGAGGCGG - Intergenic
1141897441 16:86967580-86967602 TGCTGCTTCAGCCTGGGGTCAGG - Intergenic
1142176412 16:88647455-88647477 GGCAGCCTCCACCTGGGCTCAGG - Intronic
1142377289 16:89712457-89712479 TGCTGTCTCCTCCCGGGCTTTGG + Exonic
1203016635 16_KI270728v1_random:357838-357860 ATCAGCCACCTCCTGGGATCAGG - Intergenic
1203034970 16_KI270728v1_random:630996-631018 ATCAGCCACCTCCTGGGATCAGG - Intergenic
1142900495 17:3008473-3008495 ACCTGCCTCCTCCTGGGTTGGGG + Intronic
1142990130 17:3724588-3724610 TGTCGCTTCCTCCTGGGAGCAGG - Exonic
1143491218 17:7286290-7286312 AGCTGCCTCCTCCAGGGACAAGG - Intronic
1143576147 17:7794433-7794455 TGCCGCAGCCCCCTGGGATCTGG - Intronic
1145751947 17:27361518-27361540 TGCTGCCTCTCCTTGGGTTCTGG + Intergenic
1147160624 17:38567655-38567677 TCTTGCCTCCTCCTGAGCTCTGG - Intronic
1147316808 17:39624983-39625005 AGCTGCCCCAGCCTGGGATCCGG + Intergenic
1147986240 17:44309083-44309105 TGCAGCCTCCCTCTGGGTTCTGG - Intronic
1149996626 17:61409290-61409312 TGGTGGCTCCTCCAGGGCTCTGG - Exonic
1151604776 17:75129509-75129531 TGGTGCCCCCTCCAGGGCTCTGG + Exonic
1151861244 17:76763942-76763964 AGCCTCCTCCTCCTGGGTTCAGG + Intronic
1152337441 17:79706710-79706732 TGAAGCCTCCTCCTGGCAGCTGG - Intergenic
1152574092 17:81132614-81132636 TGCTGTCTCTCCCTGGGGTCGGG + Intronic
1152669828 17:81596482-81596504 AGCTTCCTCCTCCTGGGTTCAGG - Intronic
1153428258 18:4989248-4989270 TGCAGCTTCCTCCTGATATCAGG + Intergenic
1153988434 18:10373912-10373934 TGCTGCCTCCTCCAGGGACCTGG + Intergenic
1157340120 18:46770939-46770961 TGCTTCCTCCTCCTGCTGTCTGG - Intergenic
1160538246 18:79606807-79606829 GGCTCCCTCCGCCTGGGATCTGG - Intergenic
1160898630 19:1415515-1415537 TGCTGGCTCCTGCTGGGTGCCGG + Intronic
1160987039 19:1843835-1843857 TGCTGCCTCCTCCTGGTGGATGG - Intronic
1161583164 19:5091701-5091723 GGCTCCCTCCCCCTGGGCTCCGG - Intronic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1162099562 19:8331663-8331685 CTCTGACTCCTCCTGGGATGGGG - Intronic
1162452361 19:10762846-10762868 TCCTGCCTCCTCCAGGGCACTGG - Intronic
1163148532 19:15398300-15398322 TGCATCTTCCTTCTGGGATCTGG + Intronic
1163695026 19:18759768-18759790 TGATGCCCTCTCCTGGGTTCAGG + Intronic
1163948329 19:20561352-20561374 TGGTGCCTACTCCTGGGAGGAGG + Intronic
1164143555 19:22495255-22495277 TGCAGCTTCCTCCTGATATCAGG - Intronic
1164586762 19:29480608-29480630 TCCTGCCTCTTCCTGGATTCCGG - Intergenic
1165054265 19:33164049-33164071 AGCTTCCACCTCCTGGGCTCAGG + Intronic
1165077736 19:33290148-33290170 TGGTGACTCGTCCTGGAATCAGG + Intergenic
1166210367 19:41302903-41302925 CGCTGCCTCCCCCTCGGTTCTGG - Exonic
1167223314 19:48218434-48218456 TGCAACCCCCTCCTGGGTTCAGG + Intronic
1167685450 19:50953025-50953047 CACTGCCTCCTCCTGGGCTCTGG + Exonic
1168498713 19:56875618-56875640 TGCAGCTTCCTGCTGGGGTCTGG - Intergenic
1202633977 1_KI270706v1_random:27070-27092 TGTTGCCTCCTCCTGAGTTTGGG + Intergenic
1202651903 1_KI270707v1_random:12943-12965 TGTTGCCTCCTCCTGAGTTTGGG - Intergenic
925428362 2:3769966-3769988 TGTTCCCTCCTCCTGGCCTCAGG + Intronic
929595059 2:43170570-43170592 TGCTGCCACCTCCTGGCACGGGG - Intergenic
930422997 2:51177163-51177185 TGCTGCCTCCTCCTAGCAAGAGG + Intergenic
931321448 2:61177630-61177652 GGCGGCCTCCTTCCGGGATCTGG + Exonic
932479007 2:72027593-72027615 CACGGCCTCCTCCTGGGAACGGG - Intergenic
933587069 2:84190863-84190885 TGCTACTTCCTCTTGGGACCTGG - Intergenic
933767462 2:85719815-85719837 GGCTGCCTGCTCCTTGGCTCTGG + Intergenic
934309033 2:91847085-91847107 ATCGGCCACCTCCTGGGATCAGG - Intergenic
934553916 2:95277612-95277634 TGCCTGCTGCTCCTGGGATCTGG + Intronic
935137893 2:100322840-100322862 TCCCTCCTCCTCCTGGTATCTGG - Intergenic
935573502 2:104686978-104687000 TGCGGGCTCCTCCTGGGCCCAGG - Intergenic
935830508 2:106996864-106996886 CACTGCCTTCTCCTTGGATCAGG + Intergenic
936477603 2:112853108-112853130 TGCTGCCCCCTTCTGGGTTGGGG + Intergenic
937167382 2:119833782-119833804 TTCTGCCTCCAAATGGGATCTGG - Intronic
938307310 2:130264781-130264803 TCCTGCCTCCTCCTGGCTTCTGG - Intergenic
938384177 2:130852849-130852871 TTCTGTCTGCTCCTGGGCTCTGG - Intronic
938448019 2:131392063-131392085 TCCTGCCTCCTCCTGGCTTCTGG + Intergenic
938841453 2:135168819-135168841 TGCTGCCTCCTCCTGAGGGAGGG + Exonic
940718670 2:157257940-157257962 TGCTGCTTCCTGCTGTGTTCAGG + Exonic
941648570 2:168068203-168068225 TCCTGCCTCCTCCTCTGATATGG - Intronic
945198660 2:207260446-207260468 CACTGCCACCTCATGGGATCTGG - Intergenic
945232506 2:207607305-207607327 TGCAGCCTCTGCCTGGGTTCAGG - Intronic
945451740 2:210002495-210002517 TCCCGCCTCCTCCTGGGGTGGGG - Intergenic
946225439 2:218261822-218261844 TGCTGCCACATCCTGGGGACAGG - Intronic
946282150 2:218673418-218673440 TGCTGTTTCCTCCTGGGATGAGG + Intronic
946980467 2:225208454-225208476 GGCTTCCTCATCCTGGGCTCCGG - Intergenic
948113931 2:235479735-235479757 TGGTGCCGCCCCCTGGGATGAGG - Intergenic
948191902 2:236065728-236065750 AGCTGCCTCCTGCTGGGTTGTGG + Intronic
948279358 2:236734659-236734681 TCCTGCCTCTTCCTGGTGTCTGG - Intergenic
948701385 2:239762676-239762698 TGCAGCATCCTCCTGGGAGAGGG + Intergenic
948714653 2:239853243-239853265 TGCAGCCTCCTCCCCTGATCAGG + Intergenic
948735781 2:240004059-240004081 TTCTGCCTGCTGCTGGGCTCTGG - Intronic
948786920 2:240357466-240357488 TGCTGCCTCTGCGTGGCATCTGG + Intergenic
948897879 2:240935609-240935631 TGCTGCCGCCGTCTGGGATGCGG + Intronic
949067143 2:241999002-241999024 TGCTGCCTCCTCCTGAGTGACGG + Intergenic
1170272637 20:14545295-14545317 TGTTGGCTGCTCCTTGGATCTGG + Intronic
1170525107 20:17228585-17228607 TCCTCTCTCTTCCTGGGATCAGG - Intronic
1170555832 20:17513965-17513987 TGCTCCCTGCTCCTGGGGACAGG + Intronic
1171078049 20:22149188-22149210 TGCAGCCTCCTTCTGGGTGCTGG + Intergenic
1172101284 20:32484797-32484819 TCCTGCCTCCTCCTGCGCCCCGG - Intronic
1172187839 20:33042341-33042363 TGTTGGCACCTCCTGGGGTCAGG - Intronic
1172681260 20:36717354-36717376 TGCTGCATCCTCCAGGCTTCAGG - Intronic
1173178218 20:40781447-40781469 GGCTGCCTTCTCCTGGGAAAGGG + Intergenic
1173856504 20:46253595-46253617 TGCTGCCACCTCCAGGGATCCGG + Intronic
1174046761 20:47739309-47739331 CACTGCAGCCTCCTGGGATCTGG + Intronic
1174198096 20:48787258-48787280 TGCCGTGTCGTCCTGGGATCGGG - Intronic
1174436258 20:50509489-50509511 AGCTTCCACCTCCTGGGCTCAGG + Intergenic
1175119376 20:56706569-56706591 TGCTTCCTTCTTCTGGAATCAGG - Intergenic
1175828448 20:61949741-61949763 TGCTGCGTCCTCCAGGGACGCGG - Intergenic
1175902030 20:62363733-62363755 TGCCTCCTCCTCCTAGGATGAGG - Intronic
1176022945 20:62971329-62971351 TGCTGCCTCCTCCTGGCTTTCGG - Intergenic
1176044253 20:63084182-63084204 TGCAGCCTTCACCTGGGATTGGG - Intergenic
1176231576 20:64035832-64035854 TGCTGCCTCTCCCAGGGATCTGG - Intronic
1176449551 21:6850687-6850709 TTCTATCTCCTCCTGGGATGAGG - Intergenic
1176627785 21:9108240-9108262 TGTTGCCTCCTCCTGAGTTTGGG - Intergenic
1176646190 21:9352851-9352873 TGTTGCCTCCTCCTGAGTTTGGG + Intergenic
1176827721 21:13715711-13715733 TTCTATCTCCTCCTGGGATGAGG - Intergenic
1176839238 21:13825534-13825556 TGCTGCTTCCTCCAGGGACATGG + Intergenic
1177053791 21:16273730-16273752 AACTTCCTCCTCCTGGGTTCAGG - Intergenic
1177124674 21:17181598-17181620 TGCAGCTTCCTCCTGATATCAGG - Intergenic
1178689152 21:34736770-34736792 TCCTCCCTCCTCCTGGACTCTGG + Intergenic
1178881752 21:36455529-36455551 TGCTCCCTCCTCCTTGAAACGGG + Intergenic
1179398928 21:41066317-41066339 GGCTGCCTTCTTATGGGATCTGG - Intergenic
1179519693 21:41934009-41934031 TGCTGCCGCCTGCTGGGATGAGG - Intronic
1179642035 21:42754087-42754109 AGCTGCCTCCCCCTGGGACGTGG - Intronic
1179805656 21:43835465-43835487 GGCTGCCCCCTCCTGTGTTCAGG - Intergenic
1179883851 21:44305121-44305143 TGCTGCCACCTGCTGGGCTCTGG + Intronic
1179923676 21:44521184-44521206 AGCTGCCTCCTCCGGGGAACTGG + Intronic
1180061041 21:45385228-45385250 TGCGGCCGCCTCCTTGGCTCTGG - Intergenic
1180366725 22:11946146-11946168 TGTTGCCTCCTCCTGAGTTTGGG - Intergenic
1180379357 22:12125060-12125082 TGTTGCCTCCTCCTGAGTTTGGG + Intergenic
1180418126 22:12787827-12787849 TGTTGCCTCCTCCTGAGTTTGGG - Intergenic
1180536111 22:16394180-16394202 ATCGGCCACCTCCTGGGATCAGG - Intergenic
1181533837 22:23531684-23531706 CTCTGCCTCCTCCTGGGGCCAGG + Intergenic
1181981299 22:26768797-26768819 GGCTGCCTCCTTCTGGGATAAGG + Intergenic
1182693467 22:32179566-32179588 AGCTGCCTCCTCCCAGGAACTGG + Intergenic
1183491849 22:38120985-38121007 TCCTGCCACCTCCTGCGTTCAGG - Intronic
1183521346 22:38297790-38297812 TGCTGCCATCTCTTGGGAACAGG + Intronic
1184087251 22:42272251-42272273 ACCTGGCTTCTCCTGGGATCAGG + Intronic
1184554918 22:45227923-45227945 AGCTCCCTCCTCCCTGGATCAGG + Intronic
1184558474 22:45247047-45247069 GGCTGCCTCTTCCGGGGCTCAGG - Intergenic
1184771086 22:46596963-46596985 TGCTGCCTCCAGGTGGGATCGGG + Intronic
1185126307 22:49012597-49012619 TGCTGCCCCCTCCCAGGCTCTGG - Intergenic
1185319684 22:50194800-50194822 GGCTGGCTGCTCCTGGGATGGGG + Intronic
950054748 3:10015611-10015633 GCTTCCCTCCTCCTGGGATCCGG - Intergenic
950410107 3:12830611-12830633 TGCTGCCACCCCCTGGGGTGAGG + Intronic
950911052 3:16592336-16592358 TCCTGCCTCCTCCTGAGGTCAGG + Intronic
951136340 3:19107812-19107834 TTCTGCCTGCTCCTTGGAGCAGG + Intergenic
951852746 3:27160822-27160844 AGCCTCCTCCTCCTGGGTTCAGG - Intronic
952684326 3:36131668-36131690 TGCAGCTTCCTCCTGATATCAGG - Intergenic
952976057 3:38697559-38697581 TGCAGCCTCCTCCTCAGCTCTGG + Exonic
954286881 3:49625527-49625549 TGCTGCCACATCCTGGAACCAGG - Intronic
954864601 3:53718185-53718207 TTCACCCTCCTCCTGGGTTCCGG + Intronic
955220531 3:57019506-57019528 TGTTTACACCTCCTGGGATCAGG - Intronic
955817408 3:62860211-62860233 TGCAGCCTCCTCCAGGAAGCAGG + Intronic
956696345 3:71922280-71922302 TCCTTCCTCCACCTGGGCTCGGG - Intergenic
957093996 3:75760515-75760537 TGTTGCCTCCTCCTGAGTTTGGG - Intronic
959583246 3:108003136-108003158 TGCTTCCTGCTACTGGGAGCTGG - Intergenic
960519160 3:118635585-118635607 TGCTTCCTGCTCCTGGGGACTGG + Intergenic
960670334 3:120149341-120149363 TGCCTCCACCTCCTGGGCTCAGG + Intergenic
960941532 3:122938080-122938102 TGCAGCATATTCCTGGGATCTGG - Intronic
961038961 3:123663645-123663667 TGCTCCCTTCTCCTGTGCTCTGG - Intronic
961512766 3:127413182-127413204 TGCTGGGGCCTCCTGGGCTCTGG + Intergenic
961535620 3:127568826-127568848 GGCTCACTCCTCCTGGGCTCGGG + Intergenic
961762723 3:129183608-129183630 TGCTGCCGCCGCCTCGGACCCGG - Intronic
961845995 3:129763462-129763484 TGCAACCACCTCCTGGGTTCAGG - Intronic
962105354 3:132383423-132383445 TTCTGCCTGCTCCAGGGAGCAGG + Intergenic
963120740 3:141774872-141774894 AGCTTCCGCCTCCTGGGTTCAGG + Intergenic
964331645 3:155609323-155609345 TCCTGCTTCCTCCAGGGATGGGG - Intronic
965918433 3:173881178-173881200 AACTGCCGCCTCCTGGGTTCAGG + Intronic
1202740694 3_GL000221v1_random:52205-52227 TGTTGCCTCCTCCTGAGTTTGGG - Intergenic
968951891 4:3699741-3699763 TGCTGCCTTCTCCTGGCACCCGG - Intergenic
971111070 4:23586662-23586684 TGCTGCTGCCTTCTGGGTTCAGG - Intergenic
971230854 4:24799540-24799562 TCCTGCCTGCTCCTGGCAGCCGG + Exonic
973363663 4:49189462-49189484 TGTTGCCTCCTCCTGAGTTTGGG + Intergenic
973397417 4:49607279-49607301 TGTTGCCTCCTCCTGAGTTTGGG - Intergenic
974697646 4:65396812-65396834 TGCAGCTTCCTCCTGATATCAGG - Intronic
976370580 4:84284075-84284097 TGCTGCCTCTCTCTGGGGTCAGG - Intergenic
976780259 4:88750605-88750627 TGCTTTCTCCTCCTGGCAGCGGG - Exonic
977040699 4:92013635-92013657 TACTGCCTCCTACTGGGAGCGGG - Intergenic
978257082 4:106705185-106705207 AACTGGCTCCTCCTGGCATCTGG - Intergenic
979324927 4:119368096-119368118 CTCTGCCTCCTCCTGGGTTCAGG + Intergenic
979919799 4:126481519-126481541 TGCAGCTTCCTCCTGATATCAGG - Intergenic
982189581 4:152840798-152840820 AGCTTCCACCTCCTGGGTTCAGG + Intronic
983242833 4:165253114-165253136 CTCTGCCTCCTCCTGGGTTCAGG + Intronic
983875076 4:172866059-172866081 TACTGCCTTCACCTTGGATCAGG + Intronic
983914830 4:173281187-173281209 TGCTGCCTCCTCCTGGTTCTGGG + Intronic
984255763 4:177388288-177388310 TGCAACCTCCTCCTGGGATCAGG + Intergenic
1202760977 4_GL000008v2_random:110543-110565 TGTTGCCTCCTCCTGAGTTTGGG + Intergenic
985662213 5:1162888-1162910 TGCAGCCTCCACCTGGCAGCAGG + Intergenic
985671511 5:1209201-1209223 TGGTGCCCCCTCCTGGGCCCTGG - Intronic
985798850 5:1987801-1987823 TGCTGCTTCTTCCTGTCATCCGG + Intergenic
986007091 5:3677359-3677381 TGGAGCCTCCTCCTGGGCTGAGG + Intergenic
986385126 5:7225904-7225926 TTCTGCCTCCTCCTAGGACAGGG - Intergenic
986413108 5:7501832-7501854 TGCTTCCTCCTCCTGCCCTCAGG + Intronic
986418157 5:7549282-7549304 TGCTGCCTTCGCCAGGGATCTGG - Intronic
986709927 5:10481283-10481305 TGGCCCCTCCTCCTGGGAACTGG - Intergenic
987088236 5:14488376-14488398 TGCGGCCTCTACCTGGGACCAGG + Intronic
988019852 5:25608518-25608540 TGCAGCTTCCTCCTGATATCAGG + Intergenic
988467041 5:31501050-31501072 GGATCCTTCCTCCTGGGATCTGG - Intronic
990477260 5:56173624-56173646 TTCCGCCTCCTCCTGGGTTCAGG + Intronic
990577614 5:57138277-57138299 GGCTGCCCTCTTCTGGGATCAGG + Intergenic
990864665 5:60367638-60367660 TTCTCCCTCCTGCTGGGACCTGG + Intronic
992969988 5:82046454-82046476 TGTTGCCTCCTCCTAGATTCTGG - Intronic
993116244 5:83722573-83722595 GACTGCCTCCTCCTGGACTCTGG + Intergenic
995870424 5:116738417-116738439 TGCTGGCTCTTACTGGAATCAGG + Intergenic
996661963 5:126014833-126014855 GGCTGCAGCCTCCAGGGATCAGG - Intergenic
997443131 5:133922771-133922793 TGCTGCCTATTCCTGAGTTCAGG + Intergenic
997565550 5:134883347-134883369 TGCTACCTCCTCCTGGGTTCCGG - Intronic
998584277 5:143409993-143410015 AGCTGCCTCATCCTTGAATCAGG - Intronic
1000037270 5:157459000-157459022 AGCTGCCTCCTCCAGGAAGCCGG + Intronic
1001629725 5:173165751-173165773 TGCTGCCACCCCCTGGGCCCTGG + Intergenic
1001783240 5:174388666-174388688 TGCTGCTTCCTTCTGGCCTCTGG - Intergenic
1002060151 5:176621064-176621086 TGCTCCCACCTCCTGGGGCCTGG + Intronic
1002082905 5:176748138-176748160 TGATGCCTGCTCCTGGGACGCGG + Intergenic
1002521416 5:179794950-179794972 AGCTGCAACCTCCTGGGAGCAGG + Intronic
1002688938 5:181037200-181037222 TCCTGCCTCCTCCGTGGAGCAGG - Intergenic
1002689876 5:181043425-181043447 GGCTGCCACCTCCTGGGGACAGG - Intronic
1003064763 6:2894584-2894606 GGCTGCCTCTTCCTAGGTTCTGG - Intronic
1003579378 6:7325937-7325959 TGCAGCCTCCTCCTGGGCTCAGG + Intronic
1007165540 6:39826206-39826228 TGCGGCCTGCTCCTGGTCTCTGG + Intronic
1007397187 6:41584711-41584733 TGGTGCCTCCTCCTGGGTTGGGG + Intronic
1007773002 6:44206311-44206333 AACTGCCGCCTCCTGGGTTCAGG + Intergenic
1009021479 6:57951676-57951698 TGCTGCCACCCCCTGAGGTCTGG - Intergenic
1009611738 6:65952416-65952438 TGCTGCCTCCTCATCCAATCAGG + Intergenic
1009849839 6:69181144-69181166 TGCATCCTCCTCCTGAGATGTGG + Intronic
1009919677 6:70041984-70042006 TGCAACCTCCTCCTGGGTTTAGG - Intronic
1016417508 6:143848553-143848575 TTGTGCCTCCTCCTGGGCTGAGG + Intronic
1017000619 6:149995064-149995086 TGCTGCCTCCTTCAGGCCTCTGG + Intergenic
1017630565 6:156392664-156392686 TGCTGTCTCCTCTGGGGACCTGG - Intergenic
1017797871 6:157864171-157864193 TGCTCCCTCCTCCAGGGGTAAGG + Intronic
1018882057 6:167893821-167893843 TGCTGCCTTCACCTGGGTCCTGG + Intronic
1019669754 7:2271007-2271029 TGCTTCCTCCTCCAGGAAACAGG + Intronic
1019811693 7:3169627-3169649 AGCTTCCACCTCCTGGGCTCAGG - Intronic
1021715212 7:23455477-23455499 TGCTCCCTCCTCCTATGTTCTGG + Intronic
1022507468 7:30915853-30915875 TGCTGCCTCCTCCAGAGCTCAGG + Intronic
1023558753 7:41450502-41450524 CGCTGACTCCTCCTGAAATCTGG - Intergenic
1023715304 7:43037793-43037815 TGCTGCCTCGACCTTGGAGCTGG + Intergenic
1023865473 7:44236227-44236249 TGCTGCCTCCTCCATGGCTCTGG + Intronic
1026608865 7:71839448-71839470 AACTGCCACCTCCTGGGTTCAGG - Intronic
1026668478 7:72365221-72365243 TGCTGAACCCTCCTGGGTTCAGG - Intronic
1027000664 7:74651563-74651585 CTCTGCCTCCTCCAGGGATTTGG - Intergenic
1027001793 7:74658689-74658711 TGCGGACTCCACCTGGGAGCGGG - Intronic
1027538146 7:79432950-79432972 TTCTGTCTCCTCTTGAGATCAGG - Intronic
1028410735 7:90527922-90527944 TGCAGCCTACTCCTGGCCTCAGG - Intronic
1029272581 7:99385809-99385831 TGCTTCCACCTCCTGGGATGGGG + Intronic
1030689981 7:112522395-112522417 ACCTGCCTCCTTCTGGAATCAGG - Intergenic
1032471770 7:132184201-132184223 CGCTGCCCCCTGCTGGGACCAGG - Intronic
1034303210 7:150033761-150033783 TGCTTCCACCTCCTGCGATGGGG + Intergenic
1034304602 7:150038965-150038987 TGCCTCCCCCTCCTGCGATCGGG + Intergenic
1035680312 8:1483014-1483036 CACTGCCTCCTCCTTGGAGCTGG + Intergenic
1036222751 8:6934393-6934415 TGCTTCCTTCTCCTGGGCTCTGG + Intergenic
1036224849 8:6949183-6949205 TGCTCCCTTCTCCTGGGCTCTGG + Intergenic
1036226934 8:6967173-6967195 TACTCCTTCCTCCTGGGGTCTGG + Intergenic
1036234468 8:7026332-7026354 TGCTTCCTTCTCCTGGGTGCTGG + Intergenic
1036514378 8:9430157-9430179 TTCTGCCTCCTCTTGGGATGTGG + Intergenic
1039266297 8:35827639-35827661 TGCTGCCCCTTCCTGGCCTCTGG + Intergenic
1039453390 8:37693398-37693420 TGCTCCCACCTCCTGGGAAGTGG - Intergenic
1039659966 8:39450605-39450627 TGCAGCTTCCTCCTGATATCAGG - Intergenic
1040384118 8:46901853-46901875 TGCTGCCTCCACCTGGAAAAGGG + Intergenic
1048309253 8:133305725-133305747 TGCCGCCATCACCTGGGATCTGG + Intergenic
1049066601 8:140321270-140321292 TCCTGGCTCCTCCTGGCACCTGG - Intronic
1049089115 8:140500778-140500800 TGCTGCCTATTTCTGGGATGGGG - Intergenic
1049199374 8:141332472-141332494 TGCTGCCCCCACCTGGGTTAGGG - Intergenic
1049475089 8:142793628-142793650 TCTTTGCTCCTCCTGGGATCAGG + Intergenic
1049591368 8:143464452-143464474 GGCTGACTCCTCCTGGGAAGTGG + Intronic
1049741049 8:144241083-144241105 TTCTGCCTCCTCCTGGTATCTGG - Exonic
1052941129 9:34132860-34132882 GGCTGCCTGCCCCTGGGATGGGG + Intergenic
1053737222 9:41108951-41108973 TGCCTCCTCCTCCTGCGATGGGG - Intergenic
1054691127 9:68322368-68322390 TGCCTCCTCCTCCTGCGATGGGG + Intergenic
1055523846 9:77110192-77110214 TGCTGTCTCCACATGGAATCAGG + Intergenic
1056145641 9:83726148-83726170 TGCAACCGCCTCCTGGGTTCAGG - Intergenic
1056655414 9:88504768-88504790 TCCTGTGTCATCCTGGGATCGGG + Intergenic
1056742268 9:89267744-89267766 TGCAGCTTCCACCTGGGTTCAGG + Intergenic
1057555668 9:96085699-96085721 AGCTGCGTCCACCTGGGGTCAGG + Intergenic
1058303903 9:103412218-103412240 TTCTGCCTCTTCCTGATATCTGG - Intergenic
1059862666 9:118482438-118482460 TGCTGCCTTATCCTGGGGCCAGG + Intergenic
1060301872 9:122378694-122378716 TCTTGCCTCCTCCTGGGTTGGGG - Intronic
1060519839 9:124288031-124288053 TGCTGCATCCTCCCAGGAGCTGG - Intronic
1061001702 9:127906325-127906347 AGCTGCCAGCTCCAGGGATCAGG - Intergenic
1061016354 9:127983030-127983052 TGAAGTCTCCTCCTGGGGTCAGG - Intergenic
1062343748 9:136105301-136105323 TGGTGCTTCCTCCTGGGGACAGG - Intergenic
1062590663 9:137273070-137273092 TGCTTCCTGCTCCTTGGAGCTGG + Exonic
1062679659 9:137771921-137771943 TCCTTCCTCTTCCTTGGATCTGG - Intronic
1203519636 Un_GL000213v1:33830-33852 TTCTATCTCCTCCTGGGATGAGG + Intergenic
1203750631 Un_GL000218v1:75919-75941 TGTTGCCTCCTCCTGAGTTTGGG - Intergenic
1203483361 Un_GL000224v1:28429-28451 TGTTGCCTCCTCCTGAGTTTGGG + Intergenic
1203709336 Un_KI270742v1:82142-82164 TGTTGCCTCCTCCTGAGTTTGGG - Intergenic
1203541747 Un_KI270743v1:95427-95449 TGTTGCCTCCTCCTGAGTTTGGG + Intergenic
1187114807 X:16338309-16338331 TGCTGCCTCCTTCATGGAACTGG + Intergenic
1189331098 X:40145584-40145606 TGCTGCCTCCTCCCAGGTTTCGG + Intronic
1190056843 X:47186125-47186147 TACTTCCTCCTCTTGGGCTCTGG - Exonic
1190062831 X:47222023-47222045 TTCTGCTTCCTCTTGGGCTCTGG - Intronic
1194379673 X:93177318-93177340 TGCAGCTTCCTCCTGATATCAGG - Intergenic
1195853620 X:109308305-109308327 TGCAGCTTCCTCCTTGTATCAGG + Intergenic
1196501652 X:116390222-116390244 TGGTCTCTCCTCCTTGGATCTGG + Intergenic
1198981336 X:142399789-142399811 AGCTTCCACCTCCTGGGCTCTGG - Intergenic
1199545268 X:149002180-149002202 TGCTGACTCCTCCTGTGCCCTGG - Intergenic
1200090294 X:153632848-153632870 TGCTCCCTTCTCCTGGCACCTGG - Intergenic
1200112277 X:153747040-153747062 ATCGGCCACCTCCTGGGATCAGG - Intergenic
1201164288 Y:11193596-11193618 TGTTGCCTCCTCCTGAGTTTGGG - Intergenic