ID: 916787445

View in Genome Browser
Species Human (GRCh38)
Location 1:168096773-168096795
Sequence GGCACCGAGGACCACCAGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 174}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916787437_916787445 5 Left 916787437 1:168096745-168096767 CCATGTAGGGGCCCCAGGTGACC 0: 1
1: 0
2: 0
3: 13
4: 131
Right 916787445 1:168096773-168096795 GGCACCGAGGACCACCAGGATGG 0: 1
1: 0
2: 4
3: 19
4: 174
916787432_916787445 23 Left 916787432 1:168096727-168096749 CCTCAGAGGCGATGACAACCATG 0: 1
1: 0
2: 0
3: 6
4: 92
Right 916787445 1:168096773-168096795 GGCACCGAGGACCACCAGGATGG 0: 1
1: 0
2: 4
3: 19
4: 174
916787439_916787445 -6 Left 916787439 1:168096756-168096778 CCCCAGGTGACCATGAAGGCACC 0: 1
1: 0
2: 1
3: 18
4: 191
Right 916787445 1:168096773-168096795 GGCACCGAGGACCACCAGGATGG 0: 1
1: 0
2: 4
3: 19
4: 174
916787441_916787445 -8 Left 916787441 1:168096758-168096780 CCAGGTGACCATGAAGGCACCGA 0: 1
1: 0
2: 2
3: 14
4: 166
Right 916787445 1:168096773-168096795 GGCACCGAGGACCACCAGGATGG 0: 1
1: 0
2: 4
3: 19
4: 174
916787440_916787445 -7 Left 916787440 1:168096757-168096779 CCCAGGTGACCATGAAGGCACCG 0: 1
1: 0
2: 0
3: 11
4: 114
Right 916787445 1:168096773-168096795 GGCACCGAGGACCACCAGGATGG 0: 1
1: 0
2: 4
3: 19
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916787445 Original CRISPR GGCACCGAGGACCACCAGGA TGG Exonic
900159889 1:1218558-1218580 GGCACCGTGGAGAACCAGCAGGG - Exonic
900397528 1:2459308-2459330 AGGAAGGAGGACCACCAGGAAGG - Intronic
900397533 1:2459324-2459346 AGGAAGGAGGACCACCAGGAAGG - Intronic
900397542 1:2459356-2459378 GGCAAGGAGGACCACCAGGAAGG - Intronic
900397556 1:2459404-2459426 GGCAAGGAGGACCACCAGGAAGG - Intronic
900397561 1:2459420-2459442 GGCAAGGAGGACCACCGGCAAGG - Intronic
900397575 1:2459468-2459490 AGGAAGGAGGACCACCAGGAAGG - Intronic
900397580 1:2459484-2459506 AGGAAGGAGGACCACCAGGAAGG - Intronic
900397585 1:2459500-2459522 AGGAAGGAGGACCACCAGGAAGG - Intronic
900397590 1:2459516-2459538 AGGAAGGAGGACCACCAGGAAGG - Intronic
900397595 1:2459532-2459554 AGGAAGGAGGACCACCAGGAAGG - Intronic
900397600 1:2459548-2459570 GGCAAGGAGGACCACCAGGAAGG - Intronic
900397605 1:2459564-2459586 GGCAAGGAGGACCACCGGCAAGG - Intronic
900397614 1:2459596-2459618 GGCAAGGAGGACCACCGGAAAGG - Intronic
900397626 1:2459644-2459666 GGCAAGGAGGACCACCGGAAAGG - Intronic
900397642 1:2459708-2459730 GGCAAGGAGGACCACCGGAAAGG - Intronic
900495713 1:2975127-2975149 GGCTCCGAGGAGCAACATGAGGG - Intergenic
900743023 1:4342214-4342236 GGCAGGCAGGACCATCAGGAAGG - Intergenic
902573572 1:17362519-17362541 GGCACTGAGGACCCCCAAAATGG + Intronic
903542257 1:24103153-24103175 GGCACTGAGGACCACATTGAAGG - Intronic
903654831 1:24942846-24942868 GGCTCCGAGGAGCACCAGGCTGG - Intronic
904774273 1:32897072-32897094 GGCGAGGAGGTCCACCAGGATGG - Intronic
905043169 1:34976848-34976870 GGCCGCGAGCACCAGCAGGAAGG + Intergenic
906060477 1:42945073-42945095 GGCACTAAGCATCACCAGGAGGG + Intronic
907053632 1:51345533-51345555 GGCACAGAGCACCAGCAGCAGGG + Intergenic
915359612 1:155278044-155278066 GGCACGGAGGACCTCCGGCAGGG - Intronic
916787445 1:168096773-168096795 GGCACCGAGGACCACCAGGATGG + Exonic
918392543 1:184081752-184081774 GGCACTAAGTACCACCAGGTTGG + Intergenic
920111234 1:203588763-203588785 AGAACCAAGGACCACCAGGAAGG + Intergenic
922208058 1:223466557-223466579 GGCAATGAGGAGCACCAGGCTGG - Intergenic
924056191 1:240126886-240126908 GGAACACAGGACCAACAGGATGG + Intronic
924740679 1:246792821-246792843 GGCTCCGAGCACCCCAAGGACGG - Intergenic
924740689 1:246792851-246792873 GGCTCCGTGCACCCCCAGGACGG - Intergenic
1064141599 10:12795374-12795396 GGCACGGTGGACCCACAGGAAGG - Intronic
1065939980 10:30555731-30555753 GGAGCCGAGGACCAACAGGTTGG - Intergenic
1068793491 10:61052560-61052582 GGGAGGGAGGAACACCAGGAGGG - Intergenic
1068952345 10:62790054-62790076 GGCACCGAGGCAATCCAGGAAGG + Intergenic
1070954196 10:80454057-80454079 GGCACCGGGGACCGCGAGGCCGG - Intergenic
1071309579 10:84329370-84329392 GCCACCAAGGACCACCACAAAGG - Intronic
1074145611 10:110714708-110714730 GGGGCTGAGGACAACCAGGAAGG - Intronic
1076518402 10:131062899-131062921 GGCACGGAGGCCCAGCAGAAGGG + Intergenic
1076590775 10:131580632-131580654 AGCTTCGAGGACCAACAGGATGG + Intergenic
1076841199 10:133046442-133046464 GGGGCCCAGGACCACCAGCATGG - Intergenic
1079127801 11:17731211-17731233 GGCACCCCAGCCCACCAGGAGGG + Intergenic
1083702240 11:64487139-64487161 GGCAGCAAGGACCACCAGGATGG + Intergenic
1084021841 11:66422443-66422465 GGCAACCAGGTCCACCTGGAGGG - Exonic
1088248267 11:107840171-107840193 GACACAGAGGAGCTCCAGGAGGG + Intronic
1098943082 12:76559613-76559635 GGCCCCGAGGTCCACCAGCCCGG + Exonic
1099573587 12:84356155-84356177 AGCACAGAGCACCACCAAGAAGG + Intergenic
1103408891 12:120696487-120696509 GACTCCGAAGGCCACCAGGATGG - Exonic
1103551147 12:121738427-121738449 AGCACCAAAGGCCACCAGGAGGG + Intronic
1104519786 12:129462953-129462975 GGCTCCGAGGACTCCCAGGCTGG - Intronic
1104638453 12:130452174-130452196 GGGACCGAGGACCCCAGGGAGGG - Intronic
1112526572 13:100153678-100153700 GGCAACGATAACCACGAGGAAGG + Intronic
1113009738 13:105750286-105750308 GACACCTGGGACCACCAGAAGGG + Intergenic
1113731594 13:112645432-112645454 GACACCGAGGACGGCGAGGACGG + Intergenic
1115442980 14:33457278-33457300 GGCACAGAAGCCCAACAGGAGGG - Intronic
1119265867 14:73262954-73262976 GGCAACAAGGCCCACCAGGCAGG - Intronic
1121977329 14:98417374-98417396 GGCACCCACGACGCCCAGGAGGG + Intergenic
1123073205 14:105652227-105652249 GGCAGCGTGGGCCCCCAGGAAGG + Intergenic
1123132665 14:106000512-106000534 GGCACTCAGGACCATCAGGGAGG - Intergenic
1123132689 14:106000593-106000615 GGCACTCAGGACCATCAGGGAGG - Intergenic
1123132726 14:106000751-106000773 GGCACTCAGGACCATCAGGGAGG - Intergenic
1123132750 14:106000832-106000854 GGCACTCAGGACCATCAGGGAGG - Intergenic
1123132793 14:106001010-106001032 GGCACTCAGGACCATCAGGGAGG - Intergenic
1123132817 14:106001091-106001113 GGCACTCAGGACCATCAGGGAGG - Intergenic
1123132841 14:106001172-106001194 GGCACTCAGGACCATCAGGGAGG - Intergenic
1123132865 14:106001253-106001275 GGCACTCAGGACCATCAGGGAGG - Intergenic
1123132889 14:106001334-106001356 GGCACTCAGGACCATCAGGGAGG - Intergenic
1123582917 15:21731780-21731802 GGCACTCAGGACCATCAGGTAGG - Intergenic
1123619567 15:22174376-22174398 GGCACTCAGGACCATCAGGTAGG - Intergenic
1128035275 15:64519400-64519422 GTCACTGAGGAACACCAAGAAGG + Intronic
1129738722 15:77979606-77979628 GGCTCCGAGGAGGACCAGGAGGG + Intergenic
1129847236 15:78773574-78773596 GGCTCCGAGGAGGACCAGGAGGG - Intronic
1130254659 15:82320314-82320336 GGCTCCGAGGAGGACCAGGAGGG + Intergenic
1130362880 15:83207427-83207449 GCGACCAAGGACTACCAGGAAGG - Exonic
1130600314 15:85269692-85269714 GGCTCCGAGGAGGACCAGGAGGG - Intergenic
1132573628 16:655048-655070 GCCACCGAGGCCCACCTGGCCGG - Exonic
1133223124 16:4327747-4327769 GGCCGCGGGGACCACCGGGACGG - Intronic
1138294388 16:55873999-55874021 GCCACAGAGGAACACCAGGCTGG - Exonic
1138433948 16:56986631-56986653 GGCACAGAGGGGCCCCAGGATGG - Intergenic
1138511759 16:57512790-57512812 GGCACCGAGGAGGCCGAGGATGG - Exonic
1139558019 16:67724929-67724951 TACACAGAGGAGCACCAGGACGG - Exonic
1141483553 16:84323338-84323360 GGCAGCGCTGATCACCAGGATGG + Intronic
1142291637 16:89195975-89195997 GGCTCCCAGGGCCACCAGGCAGG + Exonic
1142307951 16:89295893-89295915 TGCACAGAGCACCCCCAGGAAGG - Intronic
1142419417 16:89961311-89961333 GTCACTGAGGAGCACCTGGAGGG + Intronic
1143650026 17:8257698-8257720 GCCACCAAGGACCACCTGCATGG - Intronic
1143785727 17:9254186-9254208 GGCACCGGAGACAGCCAGGATGG - Intronic
1146614843 17:34347934-34347956 GGCTCTGAGGAGCACCACGATGG - Intergenic
1147162631 17:38577007-38577029 GGCACAGAGGTCCACCTGGCCGG - Intronic
1148341426 17:46875692-46875714 GGCTTCCAGGACCTCCAGGAAGG - Intronic
1150978584 17:70117284-70117306 GACACCGAGGACTACTAGAAGGG + Intronic
1151569786 17:74920569-74920591 GGCTCCGAAGGACACCAGGAAGG + Exonic
1153762542 18:8346132-8346154 GGCAGGGAGGACCACCAGCCCGG + Intronic
1155002895 18:21704291-21704313 CGCTCCGAGGACCACCCGGCCGG + Intronic
1156330648 18:36118531-36118553 GGCAGGGAGTAGCACCAGGAAGG + Intronic
1157327545 18:46679971-46679993 GGCTCCCAGTTCCACCAGGAGGG + Exonic
1158865257 18:61632361-61632383 GGAGCAGAGGACCACCAGGATGG - Intergenic
1160095391 18:75867211-75867233 GGCTTCTAGTACCACCAGGATGG + Intergenic
1161286682 19:3472072-3472094 GGCACCGAGGACACCGAGGATGG + Intergenic
1161325581 19:3662123-3662145 AGCCCCGGGGACCACCAGGAGGG - Intronic
1161579581 19:5073440-5073462 GGCACCAGAGAGCACCAGGAGGG - Intronic
1161579755 19:5074320-5074342 GGCACCTAGGAACACAAGGGGGG - Intronic
1162951637 19:14074680-14074702 GGGACAGAGGACCAGAAGGAAGG - Intronic
1163404157 19:17112266-17112288 GCCACCGAGGGACACCAGGTGGG + Intronic
1163755927 19:19106139-19106161 GGGACCGAGGAACACGAGGCGGG - Intronic
1165105990 19:33469957-33469979 GGCACCCAGGACCCACAGGTGGG - Intronic
1165382387 19:35490383-35490405 GGCAGAGTGGAGCACCAGGAGGG + Exonic
1166309868 19:41956909-41956931 GGAGCCGATGACCACCAGGGTGG + Exonic
1166756628 19:45196452-45196474 GACACTGAGGACCACCCAGAGGG - Intronic
1168538943 19:57194291-57194313 GGAACTGAGAACCACCACGATGG + Intronic
928605413 2:32941272-32941294 GGCACTGAGGGCCAGCACGAGGG + Intergenic
937037681 2:118795355-118795377 GGTACCTTGGACCACCAAGATGG - Intergenic
937219775 2:120335976-120335998 GGCACAGAGGACCACCTGGCAGG + Intergenic
937359596 2:121219569-121219591 GGCACTGTGTACAACCAGGATGG + Exonic
938092219 2:128441293-128441315 GGCCCCGAGGACCAGCACCAAGG - Intergenic
940901560 2:159130903-159130925 GGAGCCAAGGACCACCAGGCAGG - Intronic
941048742 2:160706658-160706680 GGCACTGAGGACTACTAGAATGG - Intergenic
943470045 2:188283711-188283733 GACACTGAGGACTACTAGGAAGG + Intergenic
947143650 2:227043117-227043139 GGCCCAGAGGATCACCTGGAAGG - Exonic
947330969 2:229029056-229029078 GACACTGGGGACCACCAGGAGGG + Intronic
947745153 2:232503499-232503521 GCCCCCGAGGTCCACCAGGCGGG - Intergenic
948299030 2:236888294-236888316 TGCACCAAGGCCCACCAGGTCGG - Intergenic
948979319 2:241485093-241485115 GACAGGGAGGACCACAAGGAGGG - Intronic
1169194178 20:3674506-3674528 TGCTCTGGGGACCACCAGGAAGG + Exonic
1170629270 20:18054415-18054437 GGCTCCCAGGACCACAAGAAGGG - Intronic
1170688699 20:18592477-18592499 GGACCAGAGGACCATCAGGAGGG + Intronic
1172512706 20:35511725-35511747 GGCACCCAGGAGCCCCAGGTCGG + Exonic
1175855266 20:62117727-62117749 AGCACAGAGGACCACCAGGGAGG + Intergenic
1176083244 20:63284461-63284483 GGCACCGAGTCCCCCCTGGAGGG - Intronic
1176213682 20:63938575-63938597 GTGACCGAGGAACGCCAGGAAGG + Intergenic
1176955356 21:15096602-15096624 AGTACCGAAGACCACCAGGCTGG + Intergenic
1180953829 22:19732543-19732565 GGCAGAGAAGACCCCCAGGAGGG - Intergenic
1180983251 22:19889260-19889282 GGCCCAGAGGACCCCCAGGAAGG + Intronic
1183529927 22:38347808-38347830 AGCACAGAGGACCCCCAGGCAGG + Intronic
1184690637 22:46115786-46115808 GGGACCAAGGACCTTCAGGATGG + Intergenic
1184887480 22:47355263-47355285 GCCACCGAGGTCCCCGAGGAGGG - Intergenic
950541328 3:13615028-13615050 GACACCAAGGACAACGAGGATGG - Intronic
953692251 3:45129590-45129612 GTCACTGAGGATCACAAGGATGG + Intronic
954613449 3:51958016-51958038 GGCAGGCAGGACCACCAGCAGGG - Exonic
955386837 3:58487284-58487306 GGGAACGGGGAACACCAGGAGGG + Intergenic
955607369 3:60720207-60720229 GGCACTGATGACCAGGAGGATGG - Intronic
958719589 3:97827350-97827372 GGCACTTAGAAACACCAGGAAGG + Intronic
960987415 3:123289995-123290017 GACACCGAGGGCCACAGGGAGGG + Intronic
966883663 3:184362946-184362968 GGCACCGAGGACCCCGGGGCCGG - Intronic
969301627 4:6300504-6300526 GGGAGGGAGGACCACTAGGATGG + Intronic
973079589 4:45972916-45972938 GGCACCGAGGACCAGTATCATGG + Intergenic
975985952 4:80202054-80202076 GGCACCAAGGACCACGGGGGCGG + Exonic
982351085 4:154416235-154416257 GGCCCCGAGGACAGCCTGGAAGG + Intronic
982398212 4:154936848-154936870 GGCACTGAGGACCATTGGGATGG + Intergenic
984474050 4:180215179-180215201 GGCCGCTAGGGCCACCAGGAGGG - Intergenic
985512570 5:320949-320971 GGGGCCAAGGACCACCGGGAGGG + Intronic
985622153 5:961359-961381 GGCAGTGTGGACCACCAGGAAGG - Intergenic
985725055 5:1511768-1511790 GGAACCGAGCCCCTCCAGGAGGG + Intronic
985729885 5:1541174-1541196 GGCAGGGAGGACCCTCAGGAAGG - Intergenic
992886540 5:81165697-81165719 GGCACACAGGACCAGCAGGTGGG - Intronic
997411791 5:133696377-133696399 GGCCCCAAGGACCTGCAGGAAGG - Intergenic
999125000 5:149240086-149240108 GGCACTGAGAAGCAGCAGGAAGG + Intronic
1002453564 5:179332821-179332843 GGCACTGAGGAGCACCAAGGAGG + Intronic
1003631942 6:7795262-7795284 GGCAGCCAGAACCACAAGGAAGG + Intronic
1004131978 6:12929143-12929165 GGCACAGAGGAACAAAAGGAGGG + Intronic
1004842061 6:19598712-19598734 GGGAACGAGGACCACCAAGAAGG + Intergenic
1007239343 6:40413880-40413902 GGCACTCAGAACCACCATGAGGG - Intronic
1018623552 6:165755151-165755173 GGCACCTAGCAGCCCCAGGATGG + Intronic
1019032566 6:169025179-169025201 GGCACCGAGAACCGTCAGCACGG - Intergenic
1019479459 7:1259931-1259953 TGCACCCAGGACCACCACGAGGG - Intergenic
1023864629 7:44232921-44232943 GGAAGCGGAGACCACCAGGAGGG + Intronic
1026108243 7:67437818-67437840 AGTGCCGAGGACCACCGGGAGGG - Intergenic
1026944496 7:74307090-74307112 GTCCCCGAGGAGCACCCGGAAGG - Intronic
1028748878 7:94359737-94359759 GACACTGAGGACCACTAGAAGGG + Intergenic
1034080911 7:148277002-148277024 GGGACAGAGCACAACCAGGAAGG - Intronic
1034678573 7:152910717-152910739 GACACCCAGCACCCCCAGGAGGG + Intergenic
1034951311 7:155298422-155298444 GGCACCGTGGGCCGCCAGCAGGG - Exonic
1035267997 7:157702791-157702813 GGCAGCGCGGAGCAGCAGGACGG - Intronic
1035304865 7:157925489-157925511 GGGACCCGGGACCACGAGGAAGG - Intronic
1043464072 8:80487357-80487379 AGCACCGAGGACGAGGAGGAGGG + Exonic
1044552965 8:93532576-93532598 GGCACCCAGGAACAGCAGGAAGG - Intergenic
1048999495 8:139815787-139815809 GGCTCCGGGGATCACCAGCAGGG + Intronic
1049813671 8:144588029-144588051 GACACCGAGGAAAACCAGCAAGG + Intronic
1049939835 9:535011-535033 GGCTGCGAGGCCCAGCAGGAGGG - Intronic
1053020280 9:34689732-34689754 GGAACCGAGGACCAGAAGGAAGG - Exonic
1053439818 9:38107099-38107121 GGGACCGGCCACCACCAGGAGGG + Intergenic
1054769517 9:69070441-69070463 GGCCACCAGGGCCACCAGGAGGG + Intronic
1056897830 9:90567299-90567321 GGCACCAATGACCAGGAGGAGGG - Intergenic
1057250893 9:93500689-93500711 GGCACAGAGCATCAGCAGGAGGG + Intronic
1059352769 9:113677252-113677274 GGCACCCGGGCCCTCCAGGAGGG - Intergenic
1060781455 9:126416283-126416305 GGCACAGAGGGCCACCATGCAGG - Intronic
1061979182 9:134090374-134090396 GGCACCTAGGAAGACAAGGAGGG - Intergenic
1062288117 9:135782467-135782489 GGCACCGTGCAGCCCCAGGATGG - Intronic
1062411862 9:136429835-136429857 GGCACCCAGGGCCAGGAGGAGGG + Intronic
1062494881 9:136827000-136827022 GGCACAGCAGGCCACCAGGAAGG - Intronic
1062541493 9:137043611-137043633 GGCACCGAGGACACCTAAGATGG + Intronic
1062579711 9:137223840-137223862 GGCCCAGGGGAGCACCAGGAAGG - Intergenic
1185457909 X:319739-319761 GGCATCGGGGACCCCCAGGGCGG - Intergenic
1193724368 X:85021582-85021604 GGCACCTGGGACCACTGGGATGG - Intronic
1199650434 X:149943030-149943052 GGCTCAGAAGGCCACCAGGATGG - Intergenic
1199819774 X:151433029-151433051 GGCACCTAAGACCAGCAGGAGGG - Intergenic