ID: 916791469

View in Genome Browser
Species Human (GRCh38)
Location 1:168129113-168129135
Sequence CTGTAAAGAAAGATCAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 368}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916791469 Original CRISPR CTGTAAAGAAAGATCAAACA GGG Intronic
901343550 1:8517892-8517914 CTGTAAATGAATATCAAAAAGGG + Intronic
904671243 1:32167342-32167364 CTGTAAACCATGAGCAAACAGGG - Intronic
906177183 1:43784632-43784654 CTGTATGAAAAGATCAGACATGG - Intronic
906420770 1:45664986-45665008 CTGTTAAAAAAGATGAAAGATGG + Intronic
906436731 1:45803057-45803079 CTGTCCGGAAAGAGCAAACACGG + Intronic
907099482 1:51815734-51815756 ATTTATAGAAAAATCAAACAAGG + Intronic
907833523 1:58087731-58087753 AAGAAAAGAAAGATCAAGCAAGG + Intronic
907951020 1:59184306-59184328 CTGCAAGGAAAGATGAAAAATGG - Intergenic
908072738 1:60481280-60481302 CTGTAACAGAAGATGAAACATGG - Intergenic
908166131 1:61461237-61461259 GTGTGAAGACAGATCAAGCATGG - Intronic
908366368 1:63427635-63427657 CAGTAAATAAAGGGCAAACATGG + Intronic
908366496 1:63429088-63429110 CTGGAAAGAAATGTAAAACATGG - Exonic
908556723 1:65263957-65263979 CTGTGAAGAAAAATGAAACATGG - Intronic
909086367 1:71173783-71173805 CTGTGAAGAAAAATAAAGCAGGG - Intergenic
910669064 1:89755030-89755052 TTGTAAAGGCAGATCAAAGATGG - Intronic
911590243 1:99739038-99739060 ATGTAAAGACAGATCATACTAGG + Intronic
911843095 1:102710015-102710037 CTGTGAAGAAAAATCAAACCAGG + Intergenic
916791469 1:168129113-168129135 CTGTAAAGAAAGATCAAACAGGG + Intronic
917103979 1:171473756-171473778 ATGTAAATACAGATCACACATGG + Intergenic
918025449 1:180740421-180740443 GTGTAAAGAAAAAAAAAACATGG - Intronic
918768077 1:188514826-188514848 CTTTAAAAAAAGATGAAAAATGG + Intergenic
919009931 1:191946952-191946974 CATTAAATAATGATCAAACATGG + Intergenic
919099642 1:193078923-193078945 CTTTAAAAAAAGAACAAACCTGG + Intronic
919688046 1:200502765-200502787 CTGTAGAGAAAAATAAAGCAGGG - Intergenic
921167512 1:212517493-212517515 CTGGGAAGAAAAATTAAACAGGG - Intergenic
921607521 1:217173156-217173178 CTAAAAAGAAAAATAAAACAGGG + Intergenic
922005882 1:221530260-221530282 CTGTAAAGGAAGAAGAGACAGGG - Intergenic
923452034 1:234126996-234127018 CTGAAATGAAACATCAAAGAAGG - Intronic
1063006252 10:1973361-1973383 CTATGAAGAAAAATCTAACAGGG + Intergenic
1064321955 10:14313651-14313673 GTGTAAAGAGAGATGCAACAGGG + Intronic
1064361125 10:14665763-14665785 CTGGGAAGCAGGATCAAACAAGG - Intronic
1064795727 10:19009083-19009105 CTGTAAAGGAAAAGCAGACAGGG - Intergenic
1064875695 10:19991882-19991904 CTGTAAACAAGGACCAATCATGG - Intronic
1065169433 10:23011668-23011690 CTGTAAAAAAAAAGCAAGCAAGG - Intronic
1065472212 10:26094116-26094138 CTTTCAAGAAAGACCAAACAGGG + Intronic
1066694455 10:38065537-38065559 CAGGAAAGAAAGCTTAAACATGG + Intergenic
1067737039 10:48864469-48864491 CTGTAAAGCAATGGCAAACAAGG - Intronic
1068795725 10:61077657-61077679 GTGTAAAGAAAGAACCAACAAGG - Intergenic
1069057637 10:63861387-63861409 CTATGAAGAATGATCAAACTTGG + Intergenic
1069308576 10:67004287-67004309 CTTTAAAGAAAGTCAAAACATGG + Intronic
1070012238 10:72487435-72487457 CTGTAACCACAGATGAAACATGG + Intronic
1070974290 10:80593138-80593160 CTGAAAAAGAAGAACAAACATGG - Intronic
1071222366 10:83483871-83483893 TTGTAAAAAAAGATCAAATTTGG - Intergenic
1071481159 10:86066078-86066100 CTGAAAAGACAGATTAAAGAGGG + Intronic
1072509036 10:96100006-96100028 CTGTGAAGACAAATAAAACAGGG + Intergenic
1073148385 10:101295180-101295202 CTCTAATCAGAGATCAAACAGGG - Intergenic
1074271737 10:111960519-111960541 CTGTAAAGAAATAACACATATGG + Intergenic
1074656564 10:115595569-115595591 GTGTAATAAAAGAGCAAACAAGG - Intronic
1075339422 10:121633457-121633479 CTGTAGATAGAGATCACACAGGG - Intergenic
1075716503 10:124558730-124558752 CTGTAAAGAAAAACAAAACATGG - Intronic
1077005582 11:354195-354217 CTTTTAAGAAAGATCAAAGACGG + Intergenic
1077729213 11:4710556-4710578 CAGTACTGAATGATCAAACATGG - Intronic
1078203161 11:9202905-9202927 TTATAAAGAAAAATAAAACAGGG - Intronic
1079274907 11:19026298-19026320 CTGGAAAGACAGAGTAAACATGG - Intergenic
1079519586 11:21310425-21310447 ATGTAAAGCAAAAACAAACATGG + Intronic
1079658458 11:23011510-23011532 GTGTAAATAAAGAACAAATAAGG + Intergenic
1080201895 11:29681392-29681414 CTGTAAGCAAAGATAACACAGGG - Intergenic
1080914261 11:36639386-36639408 CTGAAAATGAAAATCAAACAAGG - Intronic
1080981122 11:37407508-37407530 CTGTAATAGAAGATGAAACATGG + Intergenic
1081148015 11:39587450-39587472 CTATAAAGAAAGAGCACACTGGG + Intergenic
1081394510 11:42569723-42569745 CTGTAAACAAAGCTCCAGCATGG + Intergenic
1081424416 11:42909701-42909723 ATGAAAGGAAAGATCAAACAAGG + Intergenic
1081816251 11:45944764-45944786 CTCTAAAAAGAGATCAAAAATGG - Intronic
1082204957 11:49421966-49421988 ATTTAAAAAAAGAACAAACAAGG + Intergenic
1082745840 11:56961905-56961927 ATGTAAAGCAAAATAAAACAAGG + Intergenic
1082766421 11:57171736-57171758 CTGTACAGGTAGATCAAACCTGG + Intergenic
1082948371 11:58785271-58785293 CTGTAATAGAAGATGAAACATGG - Intergenic
1083143790 11:60742638-60742660 CTAAGAACAAAGATCAAACAAGG - Intronic
1083798890 11:65035033-65035055 CAGGACAGAAAGATCAGACATGG - Intronic
1085176706 11:74494058-74494080 ATGAAAAGAAAAATAAAACAGGG + Intronic
1086596555 11:88578977-88578999 TTTTACAGAAAGATGAAACAGGG + Intronic
1087261506 11:96017578-96017600 CTATAAAGAAAAAGAAAACAGGG + Intronic
1087489411 11:98804390-98804412 CTGTAACAAGAGATAAAACATGG - Intergenic
1087490881 11:98825491-98825513 CTGGAAAGAAACATTAAATAAGG - Intergenic
1087715816 11:101607628-101607650 CTGTAAATAATTATAAAACAAGG - Intronic
1088035633 11:105310621-105310643 CTGAATAGAAAGATGGAACAGGG - Intergenic
1089587293 11:119518453-119518475 CTGAAAATCAAGGTCAAACATGG - Intergenic
1089889878 11:121870268-121870290 CTGTGAAGACAGTTCAAAAAGGG + Intergenic
1090634335 11:128680940-128680962 ATGGAAAGAATGATCAGACAGGG - Intergenic
1091272166 11:134324033-134324055 TGGCAAAGAAAGAACAAACATGG - Intergenic
1092657175 12:10698435-10698457 CTGTTAAGAAACATAAAACATGG - Intergenic
1093418982 12:18952760-18952782 CTGTAAAGAAATAAGAAAAAGGG - Intergenic
1093630451 12:21402319-21402341 TTGAAAAGAAAAAGCAAACATGG + Intronic
1095311245 12:40699691-40699713 CTGTTACGAAGGATCAAATAAGG - Intronic
1095535730 12:43244731-43244753 CTATAATGAAAGATCAACAAGGG + Intergenic
1095719414 12:45384888-45384910 CTGTAAAGCACGATAAATCAAGG + Intronic
1097578567 12:61425666-61425688 CTATAATGAAAAATCAAGCAAGG - Intergenic
1098305819 12:69101633-69101655 CTGTAACGTGAGATGAAACATGG + Intergenic
1098566693 12:71945261-71945283 CTGTAAAGAAATATGATACTTGG + Intronic
1098873576 12:75843678-75843700 GAGAAAAGAAAGAACAAACATGG + Intergenic
1099706027 12:86153845-86153867 CTGTAAAGAAATATCCAAACTGG - Intronic
1099718904 12:86335898-86335920 CTCTAAAGAAAAATCCACCATGG + Intronic
1099757826 12:86877395-86877417 ATGCAAAGAAAGATAACACATGG - Intergenic
1100032702 12:90212501-90212523 CTGGAAAGAAAGATGAAACTTGG - Intergenic
1100318656 12:93468707-93468729 TAATAAAGAAATATCAAACAAGG - Intronic
1100653988 12:96620702-96620724 CTGTAGAGAAGGGTCAAAAAAGG - Intronic
1100906785 12:99310219-99310241 CAGTAATGAAAGATGATACAGGG - Intronic
1100943271 12:99748701-99748723 CTCTGAAGAAAGATAAAACAGGG + Intronic
1101389164 12:104284624-104284646 CTGTAAAGACAAAATAAACAAGG + Intronic
1101649014 12:106657820-106657842 CTATAAAGAAAAATAAAGCATGG - Intronic
1102155750 12:110726373-110726395 CTCTAAAGAAATATGCAACAGGG - Intronic
1105895427 13:24713232-24713254 CTGTCAAGAAAGATTAAGTAAGG - Intergenic
1106177174 13:27341457-27341479 CGGTAAAGAAAGATGGACCATGG - Intergenic
1106630395 13:31466162-31466184 TTGTAAAGATAGCTCAGACATGG - Intergenic
1107432209 13:40350303-40350325 CTGGTAAGAAAGATGAGACAGGG + Intergenic
1107913892 13:45129808-45129830 CTCTGAAGAAAAATAAAACAAGG + Intronic
1108215802 13:48183177-48183199 CTGTAACAAGAGATGAAACATGG + Intergenic
1108337465 13:49460193-49460215 CTGAAACAAAAGATCAAAGATGG + Exonic
1109002039 13:56817487-56817509 AAGTAAAGAAAGAACAAATATGG + Intergenic
1110100447 13:71594973-71594995 CTGTGGAGAAAAATAAAACAGGG + Intronic
1110299465 13:73908778-73908800 CTGTAAAGAAAAATGAAAACCGG - Intronic
1110907084 13:80904586-80904608 CTGTAAACAAAGATGAGAAAAGG + Intergenic
1111284097 13:86065541-86065563 CTGTAAAGATATATTCAACACGG + Intergenic
1111749409 13:92308912-92308934 CTTTAAAGATGGATCACACATGG - Intronic
1113044208 13:106137134-106137156 CTGTAACAGAAGATGAAACATGG - Intergenic
1114334986 14:21679692-21679714 CTGTAAAGACAGAACAGACAAGG - Intergenic
1115541104 14:34422200-34422222 CTGTAAAGAAAGATGACACCTGG + Intronic
1116426894 14:44801455-44801477 CTGTAATGGTAGATGAAACATGG + Intergenic
1117228376 14:53687609-53687631 CTGAAATGGAAGATGAAACAAGG - Intergenic
1118534534 14:66745836-66745858 CTATTAAGAAAGATCACAAAGGG - Intronic
1119830553 14:77698207-77698229 TTGTGAAGAAAGAGCCAACAGGG + Intronic
1120818346 14:88887103-88887125 CTGGAAAGAAAGATACAAAATGG + Intergenic
1202844396 14_GL000009v2_random:154549-154571 CTCTAAAGATGGATTAAACAAGG - Intergenic
1202847796 14_GL000009v2_random:197156-197178 CTGAAAATAAAGATTAACCAGGG + Intergenic
1202913791 14_GL000194v1_random:144788-144810 CTCTAAAGATGGATTAAACAAGG - Intergenic
1202917270 14_GL000194v1_random:187696-187718 CTGAAAATAAAGATTAACCAGGG + Intergenic
1124135469 15:27031890-27031912 ATGCAAAGAAAAACCAAACAAGG - Intronic
1124194386 15:27608348-27608370 TTGTAAAGAAAGACAAAACCCGG - Intergenic
1124417874 15:29489127-29489149 CAGTAAAGAAAAATAAAACATGG + Intronic
1125135183 15:36333047-36333069 CTGTAAATATAGATGAAACTTGG - Intergenic
1126855713 15:52837566-52837588 CTCTAGAGAAAGAACAAACAGGG - Intergenic
1127063550 15:55213562-55213584 CTGTAAATACAGATGAAACTTGG - Intronic
1127202719 15:56673859-56673881 GTATAAAGAATGTTCAAACATGG - Intronic
1127469529 15:59277954-59277976 CTGTACAGAAAGGTCTAAAATGG - Intronic
1128515621 15:68340037-68340059 CTGCAAAGAAATATTAAAGAAGG - Intronic
1133169818 16:3975351-3975373 CTGCAAATTAAGATCAAAAAGGG - Intronic
1133361781 16:5179792-5179814 CTGTAAAGTAAGGGCAATCATGG - Intergenic
1134334475 16:13284981-13285003 GTGAAAAAAAAGATCAAACATGG - Intergenic
1134835682 16:17358653-17358675 ATGTAAAGAAAAAAGAAACAAGG + Intronic
1138845928 16:60566031-60566053 CTTAAAAGAAATATCCAACATGG - Intergenic
1139106415 16:63831905-63831927 CTGTAAAGAAATATCTGATATGG - Intergenic
1140289293 16:73636043-73636065 GGGTGAAGAAAGATCAAACAGGG - Intergenic
1141316456 16:82967152-82967174 CTGGAAAGAAAGTACAAGCAAGG + Intronic
1142653558 17:1373820-1373842 CTGTGAAGCACAATCAAACAGGG + Intronic
1143035416 17:3992975-3992997 CTGTGAAGAAAGATAATAAAGGG + Intergenic
1143357886 17:6344072-6344094 GTTTGAAGAAAAATCAAACAGGG - Intergenic
1143365131 17:6402876-6402898 CTGTAAGTAAATCTCAAACAGGG - Intronic
1145056272 17:19706006-19706028 CTGGAAAGACAGACCACACAGGG - Intronic
1145360318 17:22206734-22206756 CTGAAAAAAAAAATTAAACAGGG - Intergenic
1147031182 17:37638032-37638054 CTGTAACAGAAGATGAAACATGG + Intronic
1148078415 17:44953472-44953494 CTTTAAAGAATGAGCAAGCATGG + Intergenic
1149307272 17:55360248-55360270 CTGTAAAAGGAGATAAAACATGG - Intergenic
1149975342 17:61260132-61260154 CTGTAAATAAAGTGGAAACAGGG - Intronic
1150346590 17:64409438-64409460 CTCTAAAGAAACAGGAAACATGG - Intronic
1150899056 17:69249985-69250007 CTGGAAAAAAAGATAAAATATGG + Intronic
1152058092 17:78048033-78048055 CTCTAAAGAAATAGAAAACAAGG + Intronic
1154194466 18:12255191-12255213 CTGTAAAGTAAGGTCTAAGAGGG + Intronic
1157254440 18:46125721-46125743 CTTTAAAAAAAAATAAAACAAGG - Intronic
1158251745 18:55496964-55496986 ATTTAAAGAAAGACCAAAAATGG + Intronic
1158379592 18:56914301-56914323 CTGTGAAGAAAAATAAAGCAGGG - Intronic
1159564526 18:70033317-70033339 CTGTAAAGAAATACCTGACACGG - Intronic
1160083137 18:75749728-75749750 GTTTAAAGTAAAATCAAACAAGG - Intergenic
1160821299 19:1059562-1059584 CTCTAAAAAAAGATAAAATAGGG - Intronic
1162713521 19:12613702-12613724 CTGCAAAGAAAGATCATTGAAGG + Intronic
1167531972 19:50023521-50023543 CTGTGAAGAAAAATAAAGCAAGG - Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
926237800 2:11060200-11060222 CTGTAAAGAAGCATCATGCAAGG + Intergenic
926680537 2:15660506-15660528 CTGTAATCAAAATTCAAACAGGG + Intergenic
927380934 2:22478140-22478162 CTTTAATGAAAGTGCAAACAAGG + Intergenic
927617258 2:24611675-24611697 CAGTAAAAAAAGAACAAAGAAGG - Intronic
928129109 2:28636663-28636685 CTTTAAACAAAAATCAAGCAGGG + Intronic
928202843 2:29261803-29261825 AGGTAAAGTAAGATTAAACACGG - Intronic
929389350 2:41451311-41451333 TTGTAAAAGAAGATGAAACATGG + Intergenic
929852466 2:45604786-45604808 CTATAAAGAAAAATAAAACAGGG - Intronic
930658150 2:54027385-54027407 CAGGGAAGAAATATCAAACAGGG + Intronic
931458207 2:62428554-62428576 CTGAAATGAAAGATAAAAAAGGG + Intergenic
931774569 2:65529600-65529622 CTGTACAGAAAGATAAAGGAGGG - Intergenic
931842096 2:66163526-66163548 ATGTAAAGGAGGATAAAACATGG + Intergenic
933116714 2:78482566-78482588 CTATAAAGAAAAATTAAACTAGG + Intergenic
933557971 2:83854814-83854836 TTGTAAAGAAAGAACAAAGTAGG + Intergenic
933818689 2:86090091-86090113 CTGTTGAAAAAAATCAAACAAGG + Intronic
934118090 2:88814501-88814523 CTGTAAAGAATGAGCAAATGAGG + Intergenic
934873440 2:97889924-97889946 GTATAAAGAAAAATCAAACACGG + Intronic
936992733 2:118383366-118383388 CTCTAAGGAAAAATAAAACAGGG + Intergenic
937392468 2:121502347-121502369 ATGCAAAGAAAACTCAAACAGGG + Intronic
938574584 2:132592213-132592235 CTAAAGAGAAAGATCAAACATGG + Intronic
938780072 2:134576729-134576751 CTGAAAAGAAAGGACAAACTTGG + Intronic
938973949 2:136457919-136457941 CTATAAAGAAATATCAAGCCAGG + Intergenic
939603569 2:144224518-144224540 CTATAAAGAAAAATAACACATGG + Intronic
939691243 2:145264223-145264245 CTGTATATAAATATCAAACCTGG + Intergenic
941374005 2:164705280-164705302 ATGTAAAGAAAAATAAAATACGG + Intronic
941920950 2:170850271-170850293 TAGTAAAGAAAAATAAAACAGGG + Intronic
942040949 2:172062286-172062308 CTGTAAACAAAGTTCATAAAAGG - Intronic
943016759 2:182521215-182521237 CTTTAAAAAAATATCAAACAGGG + Intronic
943318822 2:186421292-186421314 ATGAAAATAAAGAGCAAACAAGG + Intergenic
943962763 2:194288288-194288310 CTGTAAAGTAAGAACCAATAAGG - Intergenic
944286377 2:197954764-197954786 ATGTAGAGAAAGAACAAAGATGG - Intronic
944366437 2:198925813-198925835 CTTTAAAAAAAGAATAAACAAGG + Intergenic
945026029 2:205620787-205620809 CTGGAAAGAAAGATCTAGCTAGG + Intergenic
945342161 2:208669136-208669158 CTCTAAATAAAGAACAACCATGG - Intronic
945500344 2:210565117-210565139 TTATAAAGTAAGATTAAACATGG + Intronic
946498853 2:220224427-220224449 CTGAAAAGAAAGATTTAAAAAGG + Intergenic
946568301 2:220992695-220992717 CTGTAAAGAAAATACAAAGAAGG + Intergenic
946669272 2:222085071-222085093 CTATGAAGAAAAATAAAACAAGG - Intergenic
946807413 2:223485113-223485135 CTATAGAGAAAGAGAAAACAAGG - Intergenic
947654082 2:231811280-231811302 CTGAACAGAAAGAGCAAAAAGGG - Intergenic
948684490 2:239661674-239661696 CTGATTAGAAAGAACAAACAAGG - Intergenic
1169358188 20:4925364-4925386 CTGTGAAGAAAAATAAATCAGGG - Intronic
1169934459 20:10867951-10867973 CAGTAAAGAAAGATTAATCAGGG + Intergenic
1170745858 20:19098371-19098393 CTGCAAAGAAAGCTGGAACATGG + Intergenic
1170816523 20:19719276-19719298 CTGTAAAGAAAGGAGAAAAACGG + Intronic
1171471608 20:25376607-25376629 CTATAAAGAAAAATAAAGCAAGG - Intronic
1172503545 20:35444269-35444291 CTGTGAAGAAAAATTAAGCAGGG + Intronic
1173056259 20:39616228-39616250 CTGGAAATAAACAGCAAACAGGG - Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1176633147 21:9159463-9159485 CTCTAAAGATGGATTAAACAAGG - Intergenic
1177421030 21:20857144-20857166 CTGCAAAGACAGAGCAATCAGGG - Intergenic
1177481129 21:21690205-21690227 CAGGAAAGAAAGATCAACTATGG - Intergenic
1178164336 21:29955259-29955281 CTGTCAAGCAAAATCAAACTGGG - Intergenic
1178543824 21:33477419-33477441 ATGTAAAGAGTGAACAAACAAGG + Intronic
1178579911 21:33829601-33829623 CTGAAAAACAAGATCAAACACGG - Intronic
1178789438 21:35686273-35686295 CTGTAACAGAAGATGAAACATGG + Intronic
1182156378 22:28076913-28076935 CTGTATAGAAAGGACAACCAGGG - Intronic
1183496605 22:38148823-38148845 TTGTAAGGAAACATCAAACTAGG + Intronic
1183598018 22:38823745-38823767 CTGTAAAGTGAGGTCAGACAAGG + Intronic
949298633 3:2557287-2557309 ATGTAAAGAAAGATAAAAGTGGG - Intronic
950313085 3:11975910-11975932 CTGAAAGGAAGGATCAAAAAAGG + Intergenic
951366520 3:21789709-21789731 ATGTAAAAAAAGATAAATCAAGG + Intronic
953187872 3:40655160-40655182 CTGAAAAGAAACGTCAGACATGG + Intergenic
953266653 3:41396174-41396196 GGGTAAATAAAGACCAAACATGG - Intronic
953821035 3:46207607-46207629 ATGTAAAGGAAAACCAAACATGG - Intronic
954593052 3:51800721-51800743 TTATAGAGAAAAATCAAACAGGG + Intergenic
955040059 3:55307619-55307641 CTGTAAAGAAAAATAAATTAAGG + Intergenic
955469615 3:59273107-59273129 CTATAAAGAAAAATAAACCAGGG + Intergenic
956002134 3:64740875-64740897 CTTTAAAAAAAAATGAAACAAGG + Intergenic
956762447 3:72455914-72455936 GTGTAAAGAAAGATAAAGCAGGG - Intergenic
957543141 3:81602303-81602325 CTTTAAAGATAGATTCAACATGG + Intronic
957618878 3:82569353-82569375 CTGTAAATAGAAATCAAACTGGG - Intergenic
958292974 3:91860691-91860713 ATGAAAAGAAAGGTTAAACACGG - Intergenic
958327592 3:92427668-92427690 ATGAAAAGAAAGGTTAAACACGG - Intergenic
958356553 3:92902820-92902842 ATGAAAAGAAAGGTTAAACACGG - Intergenic
959566199 3:107835115-107835137 CTCTAAAGAAACATCAAGCAGGG - Intergenic
960128489 3:114026892-114026914 CTGAAGAGAAAGATAAAATATGG - Intronic
960334525 3:116400333-116400355 GAGGAAAGAAAGATCAAACTTGG - Intronic
960374862 3:116887710-116887732 CTCTAAAGAAAGATCAAGAAGGG - Intronic
960399573 3:117179951-117179973 CTTTCAAGATAGATCAAACAGGG - Intergenic
961069747 3:123911573-123911595 CTGTGAAGAAAAATAAAGCAGGG - Intronic
962036163 3:131653929-131653951 CCTTAAAGAAAAATCTAACAAGG + Intronic
962413579 3:135162403-135162425 CTGAAATGCAAGATCACACATGG - Intronic
963119674 3:141765406-141765428 CTGTGAAGAAAAATCAAGCAGGG - Intergenic
963169274 3:142234603-142234625 AGGTAAAGAAAGATTATACAAGG + Intergenic
963483712 3:145908744-145908766 CTAAAAAGAAAGATCTAATAAGG + Intergenic
963501591 3:146133717-146133739 CAGCAAAGAATGATCACACAGGG + Intronic
963670944 3:148251571-148251593 CTATAAAGAAAAATAAATCAGGG + Intergenic
964188476 3:153975557-153975579 TTGGAAAGAAAGAACAAACCTGG - Intergenic
964245092 3:154642426-154642448 CTGTAAAGAGAGATAAGGCAAGG - Intergenic
966099721 3:176252580-176252602 ATGTAAAGAAATTTCAAAAATGG - Intergenic
966399469 3:179534113-179534135 CTGGAAAGAAAATTAAAACAAGG + Intergenic
967635976 3:191803735-191803757 CTGTAAAAGAAGATTAAACTGGG + Intergenic
968029233 3:195468833-195468855 CTACAAAGAAAAATAAAACAGGG + Intergenic
969906403 4:10400684-10400706 GTGTAAAGACAGATCAAAACAGG - Intergenic
970041392 4:11801069-11801091 CTCTAAAGAATGATAGAACATGG - Intergenic
970438254 4:16056552-16056574 CTATAAAGAAAAATGAAGCAAGG + Intronic
971073827 4:23125599-23125621 CTGCCAAGATAGATGAAACAAGG + Intergenic
971098986 4:23441326-23441348 AAGTAAAGAAAGATGAAACCTGG - Intergenic
972411490 4:38799993-38800015 CTGTAGAGAAAAATAAAGCAGGG + Intronic
972612084 4:40665237-40665259 CTATAAAGAGAAATCAAACTTGG + Intergenic
975858276 4:78648352-78648374 CAGAAAAGAAAGATGAAAGAAGG - Intergenic
975969486 4:80016334-80016356 TTATAGAGAAAGAGCAAACAGGG - Intronic
975987225 4:80212269-80212291 CTGTAGAGTTAGATCACACAGGG + Intergenic
976038450 4:80853392-80853414 CTGTGAACAAAAATAAAACAAGG + Intronic
977103260 4:92845932-92845954 GTGGAAAAATAGATCAAACAGGG - Intronic
978041723 4:104072661-104072683 GGGCAAAGAAAGATAAAACATGG - Intergenic
978396746 4:108288885-108288907 CTGCAAGGTAAGTTCAAACATGG + Intergenic
978488792 4:109287866-109287888 AGGTAAAGCAAGATCAAACAAGG + Intronic
980199295 4:129634298-129634320 CAGTGAAGAAAGATTTAACAGGG - Intergenic
980210685 4:129783797-129783819 CTGAGATGAAAAATCAAACAGGG + Intergenic
980441238 4:132847937-132847959 CTGCAAAGAAAGATAAGACAAGG + Intergenic
981227082 4:142309826-142309848 CTGGAGAGTAATATCAAACAGGG + Intronic
982755345 4:159211627-159211649 CTGTAGAGAAAGATCAGCCTGGG + Intronic
983001164 4:162416437-162416459 ATGTAATGAAAGAACAAAAAAGG - Intergenic
983019256 4:162654883-162654905 CTGTGAAGAAAAATAAACCAGGG + Intergenic
983371119 4:166859719-166859741 TTGTAAAGAAAGATCAGAAGGGG + Intronic
983445469 4:167845072-167845094 CTTTCAAATAAGATCAAACAGGG + Intergenic
983758573 4:171375161-171375183 CTGTATAGAAGGAACAAAAAAGG + Intergenic
984139626 4:175987143-175987165 TTCTAAAGAAAGATAAAATATGG - Intronic
984595366 4:181661210-181661232 GTGTAAAGTAAGATCAAGGAAGG - Intergenic
984906782 4:184635404-184635426 CTAAACAGAAAGATCATACATGG - Exonic
1202755066 4_GL000008v2_random:53757-53779 CTCTAAAGATGGATTAAACAAGG + Intergenic
985818472 5:2144237-2144259 CTATAAACAAACAGCAAACAGGG - Intergenic
988330343 5:29829940-29829962 CTGTACAGAAAAATTAAACCAGG - Intergenic
988346016 5:30038858-30038880 TTGTAACAAGAGATCAAACATGG - Intergenic
988424904 5:31052645-31052667 CTGTAAATAAAGTTAAATCAGGG + Intergenic
988454900 5:31378897-31378919 CTGTAAAGCAAGCTCACACCCGG + Intergenic
988691815 5:33580198-33580220 CTATAAAGAAATACCAGACAGGG + Intronic
988942735 5:36162466-36162488 CTGTGCAGAAAAATTAAACAGGG - Intronic
989245152 5:39245941-39245963 CTTTAAAGAAAGATCTATAATGG - Intronic
991334423 5:65530989-65531011 ATGAAAAGAAAGATAAATCAAGG + Intronic
991430908 5:66544146-66544168 TTGTAAAGAAAGATCAAAGTTGG - Intergenic
992413476 5:76530889-76530911 TTGTAAAGAAAGCTGAAAAATGG + Intronic
992878384 5:81080573-81080595 CTGCAAAGAAACAGTAAACACGG - Intronic
993009258 5:82460903-82460925 CAGTAAAAAAAGGACAAACAAGG + Intergenic
994055095 5:95405988-95406010 CTCTAAAGAAAGATTAGGCAGGG - Intronic
994321988 5:98404839-98404861 ATGTAATGAAATTTCAAACAAGG + Intergenic
995337369 5:111015245-111015267 CTGTACAGAAAGATCTTGCAAGG - Intergenic
997222665 5:132181992-132182014 CTCTAAAGAAAAATAAAACAGGG + Intergenic
999220776 5:149975309-149975331 CTGTAAGAAAAAATCAAATAAGG - Intronic
999370768 5:151053890-151053912 CTGTGATGAAAGATCAGAGAAGG + Intronic
999970326 5:156854032-156854054 CTGTAAAGAGAGACCACAGAAGG + Intergenic
1000311339 5:160047879-160047901 CTATAATGAAAAATAAAACAAGG - Intronic
1000826468 5:166051280-166051302 ATGTGAAGAAAAATCAAATAAGG + Intergenic
1000826618 5:166053178-166053200 ATGTGAAGAAAAATCAAATAAGG + Intergenic
1001039298 5:168321317-168321339 CTTTAAAGAAGGATCAGAGATGG - Intronic
1001158537 5:169294088-169294110 CTGAAAAGAAAGGAAAAACAAGG - Intronic
1001395598 5:171418020-171418042 CTATAAAGCAAGATCAAAGACGG + Intergenic
1002420713 5:179147448-179147470 CTTTAAACACAGATCCAACATGG - Intronic
1003735373 6:8872290-8872312 CTGGAAACAAAGATAAAACATGG - Intergenic
1004132871 6:12937603-12937625 TTATGAAGAAAGATAAAACAGGG + Intronic
1004212356 6:13662273-13662295 CTCAAAAGAAAGCACAAACAGGG + Intronic
1004637631 6:17484104-17484126 CTGCAAAGAAAAAACAAAAAAGG - Intronic
1005199899 6:23332944-23332966 TTGTAGGGAAAGATCAAAAAAGG - Intergenic
1005370366 6:25125813-25125835 CTGTAACAGAAGATTAAACATGG + Intergenic
1007066233 6:38992734-38992756 CTCTCAAGAAAGATGAAACAGGG + Intronic
1008077600 6:47161689-47161711 GGGTAAAGAAAGAGCACACAGGG - Intergenic
1008721301 6:54356966-54356988 CTGTAAAGAATGAACATAAATGG - Intronic
1009985346 6:70775584-70775606 CTGTAGAGAGAGAACAAATATGG + Intronic
1010101453 6:72112759-72112781 CTGTGGAGAAAAATCAAACATGG - Intronic
1011809310 6:91112103-91112125 CTTTAAAGAAAAATAAATCAGGG - Intergenic
1011867714 6:91851310-91851332 CTGTAAAAAAAGATTAAAAGTGG - Intergenic
1012646955 6:101696960-101696982 CTGTAAGGAAAGAAATAACAGGG - Intronic
1013364273 6:109424065-109424087 CTAGGAAGAAAGATAAAACAAGG + Intronic
1013606551 6:111754513-111754535 TTTTAAAGAAAGATCCAACTTGG - Intronic
1014006598 6:116426551-116426573 CTGTAAAGGAAAATAAATCATGG - Intronic
1014107667 6:117585041-117585063 CTATAAAGAAATATCAAATGGGG - Intronic
1015118268 6:129673006-129673028 CTGCAGAGAAAGCTGAAACATGG + Intronic
1017710746 6:157165478-157165500 CTGTACAAAAAGTTCAAACGTGG - Intronic
1018850334 6:167584008-167584030 CTGTAAAAAAAGGACAAAGAGGG + Intergenic
1019801266 7:3090002-3090024 CTGGGAAGAAAAATCAGACATGG + Intergenic
1020055382 7:5114324-5114346 CTGTTAGGAAAGAGAAAACAGGG + Intergenic
1020663874 7:11014884-11014906 CTGTAAAAAAAAAAAAAACATGG - Intronic
1020967631 7:14891827-14891849 GTGAAAAGAAAAATAAAACATGG + Intronic
1021295291 7:18897907-18897929 GTGTCTAGAAAGATCACACATGG - Intronic
1021547275 7:21828542-21828564 CTGAAAATAAATACCAAACAGGG + Intronic
1021627271 7:22605999-22606021 TTGTAAAACAAGATTAAACAAGG + Intronic
1021631847 7:22655348-22655370 TTCTAAAGAATGAACAAACATGG + Intergenic
1022031398 7:26494365-26494387 ATGTAGAGAAAGAAAAAACAGGG - Intergenic
1022205581 7:28160318-28160340 CTGGAAAGAAAGGTAGAACAGGG - Intronic
1023384059 7:39637322-39637344 CTGATAATAAAGATCAAACAAGG - Intronic
1023741712 7:43287165-43287187 CTGTAAAGAGAAATAATACAGGG + Intronic
1023935139 7:44734314-44734336 CTGTAAAAACAAAACAAACAAGG - Intergenic
1026819091 7:73534756-73534778 TTGTAAGAAAAGATAAAACAGGG + Intergenic
1028026900 7:85854336-85854358 CTGTGAAGGAAGATAAAACAGGG - Intergenic
1028288519 7:89035200-89035222 CTGAAAAGAAAGAACAAACATGG + Intronic
1030641359 7:112010218-112010240 CTGTAGGGAAAGATAAAATATGG + Intronic
1032866096 7:135925727-135925749 CTGTAAAGAAAGTTTAAATCTGG - Intergenic
1034016297 7:147590574-147590596 CTGTAAAGAAATAACAGACTGGG - Intronic
1034306034 7:150046380-150046402 CACTAAAGAAATATGAAACAGGG + Intergenic
1034366746 7:150556579-150556601 TGGTAGAGAAAGATCAAAAAAGG + Intergenic
1037527715 8:19742991-19743013 AGGGAAATAAAGATCAAACAAGG - Intronic
1039191962 8:34985996-34986018 TTGCAAAGAAATGTCAAACAAGG + Intergenic
1039402806 8:37285606-37285628 CTGTAACAGAAGATGAAACATGG + Intergenic
1039629514 8:39094070-39094092 TTGTATAGAAAGAACAAACTGGG - Intronic
1039946994 8:42138778-42138800 CTGTGTAGAAAGATCATCCATGG + Intergenic
1040422990 8:47258371-47258393 ATTTAAAGAAAGATCTAATATGG - Intergenic
1040625674 8:49146990-49147012 CTCTAAAGAAAAATAAAACATGG - Intergenic
1040718733 8:50291298-50291320 CTGTGAAGAAAAACAAAACAGGG + Intronic
1041510105 8:58646852-58646874 CTGTAAAGGAGGATTAAACTAGG - Intronic
1041596809 8:59664709-59664731 CTGTGAAGAAAGAAAAAAAATGG + Intergenic
1041926338 8:63241412-63241434 CTGTATAGAAAAATCAATGAAGG + Intergenic
1043349833 8:79346652-79346674 TTGTAAAGAAAAATAAAACATGG - Intergenic
1043405751 8:79931125-79931147 CTTTAAAGTAAGACAAAACAGGG + Intronic
1043735190 8:83731827-83731849 CTGTAATGAAGGAAGAAACATGG - Intergenic
1044688352 8:94850820-94850842 ATGGAAAAAAAAATCAAACAAGG - Intronic
1046339960 8:112841038-112841060 TTTTAAAGAAAGATAAATCAAGG + Intronic
1046725684 8:117671222-117671244 CTCTAGAGAAAGATCAGAAAGGG + Intergenic
1047106722 8:121739594-121739616 CTTTAAGGAAAGCTCAACCAGGG - Intergenic
1047192926 8:122694798-122694820 CAGTAAAAAAAAATTAAACATGG + Intergenic
1048180366 8:132188998-132189020 TTGTTAAGAAAAATCAAACCTGG - Intronic
1048271756 8:133034290-133034312 CTGTACAAAAAGACCTAACAAGG - Intronic
1048829333 8:138460719-138460741 CTATAAAAAAAGAACAGACAAGG + Intronic
1048927877 8:139286900-139286922 CTGTAAAGGAAAGACAAACAGGG - Intergenic
1049269847 8:141689016-141689038 CACTAAAAAATGATCAAACATGG - Intergenic
1050466399 9:5928772-5928794 CTGTGAAGAAAAATAAAGCAAGG - Intronic
1051470625 9:17436686-17436708 CTGTAAATAAATATAAACCAAGG - Intronic
1051691097 9:19713072-19713094 CTGGGAAGAAAAATAAAACAGGG - Intronic
1052151658 9:25124617-25124639 ATATAAAGAAAGATTAAAAATGG + Intergenic
1052391069 9:27879142-27879164 CAACAAAGAAAGATCTAACAAGG + Intergenic
1052664992 9:31484355-31484377 CTATAAAGAAAAATAAATCAAGG + Intergenic
1053183980 9:35999106-35999128 TTTTAAAAAAAGAGCAAACATGG - Intergenic
1056155023 9:83825535-83825557 CTATAAAGAAAAAGCAAACAGGG - Intronic
1056355836 9:85800523-85800545 CTATAAAGAAAAAGCAAACAGGG - Intergenic
1056695140 9:88842320-88842342 CTGTAAAGTCAGATGAAAGATGG - Intergenic
1058165981 9:101619784-101619806 CTGACAATAAAGCTCAAACAAGG - Intronic
1058527647 9:105875935-105875957 CTGTCATGAAAGATAAAGCAAGG + Intergenic
1058965764 9:110036981-110037003 TTATAAAGAAAAATAAAACAGGG - Intronic
1059037893 9:110778460-110778482 ATGTATAGAAAGAGCAAAGATGG - Intronic
1059877563 9:118652432-118652454 CAGGAAAGAAAGAACACACAAGG + Intergenic
1203686674 Un_GL000214v1:714-736 CTCTAAAGATGGATTAAACAAGG + Intergenic
1203755984 Un_GL000218v1:127090-127112 CTCTAAAGATGGATTAAACAAGG - Intergenic
1203535862 Un_KI270743v1:38467-38489 CTCTAAAGATGGATTAAACAAGG + Intergenic
1203649601 Un_KI270751v1:103339-103361 CTCTAAAGATGGATTAAACAAGG - Intergenic
1188435188 X:30150780-30150802 ATGTAAACAATGATCAAATAGGG - Intergenic
1188555135 X:31402712-31402734 CAGCAAATAAAGATCAAACAGGG + Intronic
1189047951 X:37613163-37613185 CCATAAAGAAAAATCAAGCAGGG - Intronic
1189961815 X:46331620-46331642 CTATAAAGAAGAATCAAATAGGG + Intergenic
1192792924 X:74400792-74400814 CAGCAAAGAAATATTAAACAAGG - Intergenic
1193038059 X:76974812-76974834 CTGTAAAGAAAAAATAAACATGG - Intergenic
1194560082 X:95409640-95409662 ATGTAAAGAGAGATGAAGCATGG - Intergenic
1196130452 X:112149830-112149852 CTAAAAAGAAAAATGAAACAAGG + Intergenic
1197599558 X:128511901-128511923 ATGTACAGAAAGAACAAACCTGG + Intergenic
1197630223 X:128849758-128849780 CGGTACAGTAACATCAAACAAGG - Intergenic
1202176352 Y:22102370-22102392 CTGGAAAGAAAGAAAAATCAAGG + Intergenic
1202215009 Y:22484014-22484036 CTGGAAAGAAAGAAAAATCAAGG - Intergenic