ID: 916791874

View in Genome Browser
Species Human (GRCh38)
Location 1:168132303-168132325
Sequence GAGAGCCACAGCGCCCGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9025
Summary {0: 1, 1: 2, 2: 165, 3: 2350, 4: 6507}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916791874_916791876 -1 Left 916791874 1:168132303-168132325 CCAAGCCGGGCGCTGTGGCTCTC 0: 1
1: 2
2: 165
3: 2350
4: 6507
Right 916791876 1:168132325-168132347 CGCCTGTAATCCCAGCACTTTGG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
916791874_916791884 13 Left 916791874 1:168132303-168132325 CCAAGCCGGGCGCTGTGGCTCTC 0: 1
1: 2
2: 165
3: 2350
4: 6507
Right 916791884 1:168132339-168132361 GCACTTTGGGAGGTCGAGGCGGG 0: 2245
1: 92633
2: 228018
3: 235037
4: 154513
916791874_916791879 3 Left 916791874 1:168132303-168132325 CCAAGCCGGGCGCTGTGGCTCTC 0: 1
1: 2
2: 165
3: 2350
4: 6507
Right 916791879 1:168132329-168132351 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
916791874_916791885 16 Left 916791874 1:168132303-168132325 CCAAGCCGGGCGCTGTGGCTCTC 0: 1
1: 2
2: 165
3: 2350
4: 6507
Right 916791885 1:168132342-168132364 CTTTGGGAGGTCGAGGCGGGCGG 0: 820
1: 43248
2: 127664
3: 195278
4: 145058
916791874_916791887 30 Left 916791874 1:168132303-168132325 CCAAGCCGGGCGCTGTGGCTCTC 0: 1
1: 2
2: 165
3: 2350
4: 6507
Right 916791887 1:168132356-168132378 GGCGGGCGGATCACGAGGTCAGG 0: 16279
1: 43514
2: 69209
3: 54541
4: 24107
916791874_916791877 0 Left 916791874 1:168132303-168132325 CCAAGCCGGGCGCTGTGGCTCTC 0: 1
1: 2
2: 165
3: 2350
4: 6507
Right 916791877 1:168132326-168132348 GCCTGTAATCCCAGCACTTTGGG 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
916791874_916791881 9 Left 916791874 1:168132303-168132325 CCAAGCCGGGCGCTGTGGCTCTC 0: 1
1: 2
2: 165
3: 2350
4: 6507
Right 916791881 1:168132335-168132357 CCCAGCACTTTGGGAGGTCGAGG 0: 3341
1: 124982
2: 268208
3: 211109
4: 126311
916791874_916791886 25 Left 916791874 1:168132303-168132325 CCAAGCCGGGCGCTGTGGCTCTC 0: 1
1: 2
2: 165
3: 2350
4: 6507
Right 916791886 1:168132351-168132373 GTCGAGGCGGGCGGATCACGAGG 0: 141
1: 12490
2: 32666
3: 61710
4: 66395
916791874_916791883 12 Left 916791874 1:168132303-168132325 CCAAGCCGGGCGCTGTGGCTCTC 0: 1
1: 2
2: 165
3: 2350
4: 6507
Right 916791883 1:168132338-168132360 AGCACTTTGGGAGGTCGAGGCGG 0: 2438
1: 95371
2: 188205
3: 135654
4: 71168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916791874 Original CRISPR GAGAGCCACAGCGCCCGGCT TGG (reversed) Intronic
Too many off-targets to display for this crispr