ID: 916792378

View in Genome Browser
Species Human (GRCh38)
Location 1:168136247-168136269
Sequence GGCTGCTCACCTGGTCCTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 222}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916792362_916792378 30 Left 916792362 1:168136194-168136216 CCGCCGCCCGCCCAGGCTCGGGG 0: 1
1: 0
2: 2
3: 40
4: 389
Right 916792378 1:168136247-168136269 GGCTGCTCACCTGGTCCTCACGG 0: 1
1: 0
2: 2
3: 21
4: 222
916792366_916792378 23 Left 916792366 1:168136201-168136223 CCGCCCAGGCTCGGGGAGACAGC 0: 1
1: 0
2: 3
3: 23
4: 213
Right 916792378 1:168136247-168136269 GGCTGCTCACCTGGTCCTCACGG 0: 1
1: 0
2: 2
3: 21
4: 222
916792376_916792378 -10 Left 916792376 1:168136234-168136256 CCGGCTGGGAGAAGGCTGCTCAC 0: 1
1: 0
2: 1
3: 15
4: 189
Right 916792378 1:168136247-168136269 GGCTGCTCACCTGGTCCTCACGG 0: 1
1: 0
2: 2
3: 21
4: 222
916792372_916792378 -1 Left 916792372 1:168136225-168136247 CCCTGAGTCCCGGCTGGGAGAAG 0: 1
1: 0
2: 1
3: 10
4: 187
Right 916792378 1:168136247-168136269 GGCTGCTCACCTGGTCCTCACGG 0: 1
1: 0
2: 2
3: 21
4: 222
916792364_916792378 27 Left 916792364 1:168136197-168136219 CCGCCCGCCCAGGCTCGGGGAGA 0: 1
1: 0
2: 2
3: 18
4: 184
Right 916792378 1:168136247-168136269 GGCTGCTCACCTGGTCCTCACGG 0: 1
1: 0
2: 2
3: 21
4: 222
916792368_916792378 19 Left 916792368 1:168136205-168136227 CCAGGCTCGGGGAGACAGCGCCC 0: 1
1: 0
2: 1
3: 9
4: 174
Right 916792378 1:168136247-168136269 GGCTGCTCACCTGGTCCTCACGG 0: 1
1: 0
2: 2
3: 21
4: 222
916792373_916792378 -2 Left 916792373 1:168136226-168136248 CCTGAGTCCCGGCTGGGAGAAGG 0: 1
1: 0
2: 0
3: 15
4: 223
Right 916792378 1:168136247-168136269 GGCTGCTCACCTGGTCCTCACGG 0: 1
1: 0
2: 2
3: 21
4: 222
916792375_916792378 -9 Left 916792375 1:168136233-168136255 CCCGGCTGGGAGAAGGCTGCTCA 0: 1
1: 0
2: 1
3: 27
4: 263
Right 916792378 1:168136247-168136269 GGCTGCTCACCTGGTCCTCACGG 0: 1
1: 0
2: 2
3: 21
4: 222
916792365_916792378 24 Left 916792365 1:168136200-168136222 CCCGCCCAGGCTCGGGGAGACAG 0: 1
1: 0
2: 2
3: 30
4: 272
Right 916792378 1:168136247-168136269 GGCTGCTCACCTGGTCCTCACGG 0: 1
1: 0
2: 2
3: 21
4: 222
916792367_916792378 20 Left 916792367 1:168136204-168136226 CCCAGGCTCGGGGAGACAGCGCC 0: 1
1: 0
2: 0
3: 7
4: 138
Right 916792378 1:168136247-168136269 GGCTGCTCACCTGGTCCTCACGG 0: 1
1: 0
2: 2
3: 21
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916792378 Original CRISPR GGCTGCTCACCTGGTCCTCA CGG Intronic