ID: 916792378

View in Genome Browser
Species Human (GRCh38)
Location 1:168136247-168136269
Sequence GGCTGCTCACCTGGTCCTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 222}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916792373_916792378 -2 Left 916792373 1:168136226-168136248 CCTGAGTCCCGGCTGGGAGAAGG 0: 1
1: 0
2: 0
3: 15
4: 223
Right 916792378 1:168136247-168136269 GGCTGCTCACCTGGTCCTCACGG 0: 1
1: 0
2: 2
3: 21
4: 222
916792375_916792378 -9 Left 916792375 1:168136233-168136255 CCCGGCTGGGAGAAGGCTGCTCA 0: 1
1: 0
2: 1
3: 27
4: 263
Right 916792378 1:168136247-168136269 GGCTGCTCACCTGGTCCTCACGG 0: 1
1: 0
2: 2
3: 21
4: 222
916792362_916792378 30 Left 916792362 1:168136194-168136216 CCGCCGCCCGCCCAGGCTCGGGG 0: 1
1: 0
2: 2
3: 40
4: 389
Right 916792378 1:168136247-168136269 GGCTGCTCACCTGGTCCTCACGG 0: 1
1: 0
2: 2
3: 21
4: 222
916792365_916792378 24 Left 916792365 1:168136200-168136222 CCCGCCCAGGCTCGGGGAGACAG 0: 1
1: 0
2: 2
3: 30
4: 272
Right 916792378 1:168136247-168136269 GGCTGCTCACCTGGTCCTCACGG 0: 1
1: 0
2: 2
3: 21
4: 222
916792372_916792378 -1 Left 916792372 1:168136225-168136247 CCCTGAGTCCCGGCTGGGAGAAG 0: 1
1: 0
2: 1
3: 10
4: 187
Right 916792378 1:168136247-168136269 GGCTGCTCACCTGGTCCTCACGG 0: 1
1: 0
2: 2
3: 21
4: 222
916792376_916792378 -10 Left 916792376 1:168136234-168136256 CCGGCTGGGAGAAGGCTGCTCAC 0: 1
1: 0
2: 1
3: 15
4: 189
Right 916792378 1:168136247-168136269 GGCTGCTCACCTGGTCCTCACGG 0: 1
1: 0
2: 2
3: 21
4: 222
916792364_916792378 27 Left 916792364 1:168136197-168136219 CCGCCCGCCCAGGCTCGGGGAGA 0: 1
1: 0
2: 2
3: 18
4: 184
Right 916792378 1:168136247-168136269 GGCTGCTCACCTGGTCCTCACGG 0: 1
1: 0
2: 2
3: 21
4: 222
916792367_916792378 20 Left 916792367 1:168136204-168136226 CCCAGGCTCGGGGAGACAGCGCC 0: 1
1: 0
2: 0
3: 7
4: 138
Right 916792378 1:168136247-168136269 GGCTGCTCACCTGGTCCTCACGG 0: 1
1: 0
2: 2
3: 21
4: 222
916792368_916792378 19 Left 916792368 1:168136205-168136227 CCAGGCTCGGGGAGACAGCGCCC 0: 1
1: 0
2: 1
3: 9
4: 174
Right 916792378 1:168136247-168136269 GGCTGCTCACCTGGTCCTCACGG 0: 1
1: 0
2: 2
3: 21
4: 222
916792366_916792378 23 Left 916792366 1:168136201-168136223 CCGCCCAGGCTCGGGGAGACAGC 0: 1
1: 0
2: 3
3: 23
4: 213
Right 916792378 1:168136247-168136269 GGCTGCTCACCTGGTCCTCACGG 0: 1
1: 0
2: 2
3: 21
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916792378 Original CRISPR GGCTGCTCACCTGGTCCTCA CGG Intronic
900091048 1:920881-920903 CGCTGCTCACCTGCACCTCCTGG + Intergenic
900342431 1:2195255-2195277 GGTGGCTCACTTGGGCCTCAGGG + Intronic
900367423 1:2316889-2316911 GGCTGGGCACCTGGCCCTCCAGG + Intergenic
900448813 1:2695309-2695331 GGATGCTCACCTGGGCGTCTGGG - Intronic
900452282 1:2756260-2756282 GGATGCTCACCTGGGCGTCTGGG - Intronic
900717361 1:4153480-4153502 AGCTGCTCATGGGGTCCTCAAGG + Intergenic
901266493 1:7914349-7914371 AGCTGCCCTCCTGGTGCTCACGG - Intergenic
901301771 1:8204760-8204782 AGCTTCTCACGTGGTTCTCATGG + Intergenic
901640774 1:10692061-10692083 GGCTTCTCTCCTGGGCCTTAGGG - Intronic
901978245 1:13012358-13012380 GGCTTCCCACCTGGCCTTCAGGG + Intronic
902003840 1:13216580-13216602 GGCTTCCCACCTGGCCTTCAGGG - Intergenic
902023065 1:13362324-13362346 GGCTTCCCACCTGGCCTTCAGGG - Intergenic
904090536 1:27941891-27941913 AGCTGCCCACCTGGACCCCAAGG + Intronic
904391602 1:30189647-30189669 AGATGCAGACCTGGTCCTCAGGG - Intergenic
905125894 1:35716072-35716094 GGCTGCGCACCCCTTCCTCAGGG + Exonic
907390993 1:54158198-54158220 GACTTCTCTCCTGGTCCCCAGGG + Intronic
911541918 1:99166530-99166552 TGCTGCTCTCCTGGATCTCAAGG - Intergenic
912511389 1:110192470-110192492 GCCTTCTTACCTGGTCCTCTCGG + Intronic
912639608 1:111332683-111332705 GGCTGCTCAGCTGGTCTGGAAGG + Intergenic
914196837 1:145452076-145452098 GCCTCCTCTCCTGGCCCTCAAGG + Intergenic
914489521 1:148142585-148142607 GGCTGCCCACCAGGTCCTGGGGG - Intronic
915674094 1:157514946-157514968 GTCTGCACCCCTGGTCCTCCTGG + Exonic
916792378 1:168136247-168136269 GGCTGCTCACCTGGTCCTCACGG + Intronic
920308290 1:205032789-205032811 CCCTGCTCACCTGGTCCCCTGGG + Intergenic
920382915 1:205546102-205546124 GCATGCTCACTAGGTCCTCATGG - Intergenic
920949156 1:210556468-210556490 TGCTGCTCACCTGAACCCCAGGG + Intronic
1067719169 10:48713947-48713969 AACTGCTCACCTGGGCATCAGGG - Intronic
1068765621 10:60759717-60759739 GGCTACTCTCCCTGTCCTCACGG + Intergenic
1068773118 10:60844145-60844167 GGGTGCTTATCTGGGCCTCAGGG + Intergenic
1069787231 10:70996688-70996710 GGCTGGTCCCCAGGTCCCCAAGG - Intergenic
1069880240 10:71588095-71588117 GGCTGCTCACCCTCTCCGCAGGG - Intronic
1070704548 10:78628368-78628390 GGAGGCTGACCTGGCCCTCATGG + Intergenic
1071498067 10:86182225-86182247 GGCTGCTCACCAGGGCCACTGGG - Intronic
1072807820 10:98435742-98435764 GGGTGCTGAGCTGGTCCTCCAGG + Exonic
1072901441 10:99410998-99411020 GGTTGCTCTCCTATTCCTCATGG - Intronic
1073519774 10:104117172-104117194 GCCTCTCCACCTGGTCCTCACGG + Intergenic
1073894939 10:108144392-108144414 GGCTAATCACTTGGTCCTCGTGG - Intergenic
1075634210 10:124019305-124019327 GGCAGCCCACCCGGTCCTCAAGG - Intronic
1076028538 10:127138334-127138356 GTCTGTTCACATGGGCCTCATGG + Intronic
1076133340 10:128028636-128028658 GGCTGCTCAGCTGTGCCTGAGGG - Intronic
1076259360 10:129053580-129053602 AGCTGCTAACCTGGTCACCAAGG - Intergenic
1076864581 10:133160557-133160579 GGGGGCTCACCTCGTCCTCGGGG - Exonic
1077197392 11:1288272-1288294 GGCTGCTCAGCTGGACCCTAAGG + Intronic
1077983193 11:7322310-7322332 GGCTGCTTAACTGATCCTAAGGG + Intronic
1080147110 11:28999650-28999672 GGTTCCTCATCTGGTCTTCATGG + Intergenic
1080853393 11:36090889-36090911 GTCTGCTCAACAGGTCCTCTGGG - Intronic
1083713512 11:64562833-64562855 GGCCGCTCTCCCGGTCCCCAAGG + Intronic
1084188718 11:67489201-67489223 GGCTGGTCACCGGGTCCACAAGG - Intronic
1084400529 11:68940377-68940399 GCCGGCTCACCTGGTCCCCACGG - Exonic
1085181345 11:74539501-74539523 TGCTGGTGACCTGTTCCTCATGG + Intronic
1085430740 11:76445499-76445521 GGCTCCTCACCCGGACCTCTCGG - Intronic
1085719853 11:78903258-78903280 GGCCGCGCACCTGGTCTCCAGGG + Exonic
1085758149 11:79218565-79218587 GGCTTCTCACCTGTGCCTTATGG + Intronic
1088470317 11:110182752-110182774 GCCTGCTCACCTGGCCTTGAGGG - Intronic
1089490983 11:118883980-118884002 GTCTACTCACCAGGTCCTCCAGG - Exonic
1090304214 11:125676510-125676532 GGCTACACATCTGGTCCACAAGG - Intronic
1091355919 11:134937638-134937660 AGAGGCTGACCTGGTCCTCATGG - Intergenic
1091773264 12:3167763-3167785 GGCTGCTGACCTGGTGTGCAGGG + Intronic
1092137790 12:6161672-6161694 GGCTGCTCAGCAGCTCCACAGGG + Intergenic
1095446429 12:42287375-42287397 GGCAGCTCACCTCGTCATCCGGG - Intronic
1095965649 12:47865221-47865243 GGCTCCTCACCCTGTCATCACGG + Intronic
1096028260 12:48387126-48387148 GGAGGCTCAGCTGTTCCTCATGG - Intergenic
1096239609 12:49952726-49952748 GGGTTCTCCCCAGGTCCTCAAGG - Intronic
1096532025 12:52248412-52248434 GGCTGCTCCCCAGGTGCTCCTGG - Intronic
1097015909 12:55987095-55987117 TGGTGCTCTCCTGGTACTCATGG - Exonic
1102466644 12:113134410-113134432 TCCTGCTCACCTGGGCCACAGGG + Intronic
1102508163 12:113397155-113397177 AGCTGCTCACCTGGTGATCTTGG + Exonic
1103342876 12:120230401-120230423 GGCTGCCCAGGTGGTCATCAGGG - Intronic
1103728211 12:123009479-123009501 TGCTGCTCATCTGGGCCTCTGGG - Intronic
1107372532 13:39768282-39768304 AGCTGCCCAGCTGGTCCCCAGGG - Intronic
1111701144 13:91691369-91691391 GCCTGATCACCTGGGCTTCATGG - Intronic
1114646792 14:24260440-24260462 AGCTGCTCACCTGGGCACCAGGG + Exonic
1118763595 14:68895446-68895468 GGCTGCTGGCCTGGTTCCCATGG - Intronic
1121183240 14:91945376-91945398 GGCTCCCCAACTGGTTCTCAAGG - Intronic
1121456749 14:94043315-94043337 GGCCGCTCACCTGGTCCTTGTGG + Intronic
1121728058 14:96167281-96167303 GCCTGCTCACAGGGTGCTCAAGG + Intergenic
1122555116 14:102574730-102574752 GGTTGCTCACCTTGTCCTAGAGG + Intergenic
1122603115 14:102930880-102930902 GGCTGGGCTCCTAGTCCTCATGG - Exonic
1122855999 14:104560559-104560581 GGCTCCTCAGCTGGTCCCCAAGG - Intronic
1123149980 14:106171210-106171232 GGCTCCTCACCAGGGCCTGAAGG + Intergenic
1123196273 14:106619373-106619395 GGCTCCTCACCAGGGCCTGAAGG + Intergenic
1123204172 14:106695556-106695578 GGCTCCTCACCAGGGCCTGAAGG + Intergenic
1123209180 14:106742024-106742046 GGCTCCTCACCAGGGCCTGAAGG + Intergenic
1124193611 15:27601117-27601139 GGCTGCTCTGCTGGCCATCACGG - Intergenic
1124407616 15:29405674-29405696 GGCTGCTCAGCAGGTCCTGGGGG + Intronic
1128764606 15:70243522-70243544 AGCTGCTCTCCTGGACCTCACGG + Intergenic
1129741903 15:77993395-77993417 GGCTTTTCACCTGCTCCTCTGGG + Intronic
1129843806 15:78759079-78759101 GGCTTTTCACCTGCTCCTCTGGG - Intergenic
1130171156 15:81516084-81516106 GGCTGCTCATCAGGACCTTATGG - Intergenic
1130258002 15:82334721-82334743 GGCTTTTCACCTGCTCCTCTGGG + Intergenic
1130596933 15:85255242-85255264 GGCTTTTCACCTGCTCCTCTGGG - Intergenic
1132027649 15:98416856-98416878 GGCTGCTCTCTGGGTCCCCAAGG - Intergenic
1132292775 15:100714838-100714860 GGCTGCTCCCGTGGTTCCCAGGG - Intergenic
1132606459 16:795640-795662 GCCTGGTCACCTGGGCCTCCCGG - Intronic
1136536893 16:30904732-30904754 GGCTGCTGAGCTGGAGCTCAGGG + Intergenic
1136677585 16:31926024-31926046 TGCTCCTCAGCTGGTCCCCATGG + Intergenic
1136694208 16:32062326-32062348 GGCTCCTCACCAGGGCCTGAAGG - Intergenic
1136794705 16:33005590-33005612 GGCTCCTCACCAGGGCCTGAAGG - Intergenic
1136875202 16:33848802-33848824 GGCTCCTCACCGGGGCCTGAAGG + Intergenic
1138497027 16:57415211-57415233 GGCTCCACCCCTGCTCCTCAGGG + Intronic
1138590166 16:57995432-57995454 GGCTGCTGGCCTGGACCCCAGGG - Exonic
1139280111 16:65763498-65763520 GGCTCCTCACCAGCTCCTCTGGG - Intergenic
1139334378 16:66220922-66220944 GCTTGCTCAGCTGGTGCTCAGGG - Intergenic
1139950177 16:70664679-70664701 GGCTGCTCTTCTGGTGCTCCAGG + Exonic
1203096968 16_KI270728v1_random:1267240-1267262 GGCTCCTCACCAGGGCCTGAAGG - Intergenic
1142906170 17:3043788-3043810 ATCAGCTCAGCTGGTCCTCAAGG - Intergenic
1143072439 17:4307900-4307922 CGCTGCTCACCTGCTCCTTAAGG - Intronic
1143258472 17:5581770-5581792 GCCTGCCAACCTGGTCCCCAGGG + Intronic
1144092657 17:11871901-11871923 GGTTTCACACCTGGTGCTCAGGG - Intronic
1144714382 17:17424085-17424107 GGCTGCAGACCTGGGCCTCCCGG + Intergenic
1149578078 17:57727999-57728021 GGCGGCTCTGCTGGACCTCAGGG - Intergenic
1150359538 17:64519246-64519268 AGCAGCTCTCCAGGTCCTCAGGG + Intronic
1154954670 18:21242381-21242403 GGCCGCTCACCTGGCCCTAGCGG - Intronic
1156505356 18:37587226-37587248 GGCTGCACACTAGGCCCTCAGGG - Intergenic
1158404282 18:57147290-57147312 GGCTGCGCACCGGGCCCACAAGG - Exonic
1160781699 19:880324-880346 TCCTGCTCCCCTGGTGCTCAGGG - Intronic
1162459443 19:10805811-10805833 GGCTGCTCACTTGGTCCCCAGGG + Intronic
1163754521 19:19098691-19098713 GGCGGATCACCTGAGCCTCAGGG + Intronic
1165230553 19:34383867-34383889 GGCTGCTGACCTCGGCCTGAGGG - Intronic
1165830009 19:38725759-38725781 GGTGGCTCAGCTGGTCCTCCAGG - Exonic
1166015231 19:39974480-39974502 GGCTCCTGGCCAGGTCCTCAAGG - Intronic
1166471580 19:43083375-43083397 GGCTGCTGAGCTGGTGCTCAGGG + Intronic
1166761695 19:45228185-45228207 GGCTGCTGGGCTGGTCCTCCAGG + Exonic
1166978096 19:46616877-46616899 GTCTGCTCACCCGCTCCGCAGGG - Intergenic
1167436255 19:49480464-49480486 GCCTGCTCACCTGCTCCCCAGGG - Exonic
925132341 2:1502927-1502949 GGCTGGCCACCTGCTCCCCAGGG - Intronic
925406978 2:3612411-3612433 GCCTTCTCACCTGGTTCTCCGGG - Intronic
926246198 2:11123746-11123768 GGCTGATCTCCTGGTGATCAGGG + Intergenic
926621391 2:15049646-15049668 GGCTGCTCCCCTGCCCCTCTGGG - Intergenic
927640916 2:24844749-24844771 GCATGCTCACCTTGTCCTAATGG - Intronic
927710950 2:25325572-25325594 GGATGCTGACCTCGTCCTCGGGG + Intronic
929597866 2:43187402-43187424 GGCTGGTAACCTGGAGCTCAAGG - Intergenic
930200469 2:48548044-48548066 GGCTGGTCACCAGGACATCAGGG - Intronic
932589384 2:73055027-73055049 GGCTGCTCCCCTGGACATGAGGG + Intronic
932790184 2:74648284-74648306 GCCCCCTCACCTGGTCCTCCCGG + Intronic
934729826 2:96649520-96649542 GGGTTCACACCTGGTCCTCCTGG - Intergenic
935413318 2:102788404-102788426 GTGTGCTCACCTGGTCCCCTGGG + Intronic
936154287 2:110037949-110037971 GGCTGCTCATTTACTCCTCAGGG - Intergenic
936190396 2:110333466-110333488 GGCTGCTCATTTACTCCTCAGGG + Intergenic
936518854 2:113199214-113199236 GGCCGCTCACCTCGTACTCCAGG - Exonic
937029111 2:118723405-118723427 GGCAACTGCCCTGGTCCTCAGGG - Intergenic
937711011 2:124979948-124979970 GGCGGCGCATCTGGTCCCCAAGG - Intergenic
937862610 2:126722783-126722805 GGCTACTCTTCTGGGCCTCATGG - Intergenic
938420100 2:131138840-131138862 GGCTCCCCACATGGTCTTCATGG + Intronic
938610726 2:132945110-132945132 GGCTGTGCTGCTGGTCCTCAGGG + Intronic
938902899 2:135812935-135812957 GGTGGCTCACTTGGTCCTCAAGG - Exonic
939667379 2:144968284-144968306 GGCTGCTCAACTTGTCATAAGGG - Intergenic
940259329 2:151764113-151764135 GGCTCCTCACCTTGTAGTCATGG + Intergenic
944109744 2:196119658-196119680 ACCTCCTCACCTTGTCCTCAGGG - Intergenic
945690050 2:213022385-213022407 GACTGATCACCAGGCCCTCAAGG - Intronic
946440860 2:219694011-219694033 TGATGCTCTCCTGGTCCTGATGG + Intergenic
947877303 2:233476268-233476290 TGCTTGTCACCTGGGCCTCACGG - Exonic
948716567 2:239869352-239869374 AGCTGCTCTCCAGGACCTCAGGG + Intergenic
948809893 2:240469060-240469082 GGCTGCTCACCTGTCCCCTAGGG - Intergenic
948864831 2:240770001-240770023 GGCTGAGCACCTGGGCCTCTTGG - Intronic
1169678505 20:8182174-8182196 TGCTGCACACCTGGTTCACATGG - Intronic
1169786578 20:9365949-9365971 TGCTGCTCCTCTGGTGCTCAGGG + Intronic
1172520613 20:35563090-35563112 AGCTGCTCTCCTAGTCCACAGGG - Intergenic
1173227956 20:41172883-41172905 TGCTGCTCATCTGGGCTTCAGGG + Intronic
1175979154 20:62728287-62728309 GGCTACTCAGCTGGACCCCAGGG + Intronic
1176416897 21:6481163-6481185 GGCTGCTCATCTGGACCGAAGGG + Intergenic
1178899496 21:36587884-36587906 GGCTTCTCCATTGGTCCTCACGG + Intergenic
1179655582 21:42842372-42842394 GGCTTCTCACCTGAACCACAGGG + Intergenic
1179692395 21:43089496-43089518 GGCTGCTCATCTGGACCGAAGGG + Intergenic
1181458959 22:23075091-23075113 GGCTGGTCACAGGGACCTCAAGG + Intronic
1184176959 22:42794087-42794109 TGCTCCTCCCCTGGGCCTCAGGG + Intergenic
1184779402 22:46638968-46638990 GTGCGCTCACCTGGTGCTCAAGG + Intronic
1185055631 22:48577040-48577062 GCCTGCGCACCTGTTCCCCAGGG + Intronic
950457764 3:13102829-13102851 GGCTGCACCCCTGGTGCTGAGGG + Intergenic
952388221 3:32858565-32858587 GGCTGTTCAGCTGGGCCTCCCGG - Intronic
954290330 3:49646571-49646593 AGCATCTCACCTGGTTCTCACGG - Intronic
960974263 3:123159847-123159869 GGCAGCTCACCTGGGCATGAGGG + Intronic
962316514 3:134362821-134362843 GGCAGCTGACCTGCTCCTCAGGG - Intronic
968577532 4:1374879-1374901 GGGTGCTCACATGGTCCTCAAGG - Intronic
968764558 4:2461507-2461529 GGCTGCCCACCAGCTCCCCAAGG + Intronic
969595637 4:8148037-8148059 GCCTGCCCACCTGGGCCTCAGGG - Intronic
969608645 4:8215035-8215057 GTGTGCGCACCTGGTGCTCAGGG + Intronic
978621569 4:110638331-110638353 GCCTTCACACCTGGTCCTCCAGG - Intronic
979099634 4:116598931-116598953 GGTGGCTCAGCTGGTCCTCCAGG - Intergenic
979334032 4:119446590-119446612 GGCTGCTCCCCAGGTCCTGAAGG + Intergenic
979683109 4:123482952-123482974 GGCTGTTCCCCTGATCTTCAGGG - Intergenic
983035795 4:162864650-162864672 GGAAGCTCTCTTGGTCCTCAGGG + Intergenic
983318286 4:166161497-166161519 TGCTGCTGACTTGGTACTCATGG - Intergenic
992619117 5:78575096-78575118 GGCTGCTCAGCTGTGCCTCAGGG + Intronic
995480954 5:112592181-112592203 GTCTCCTCACCTAGTCCACAGGG - Intergenic
996304945 5:122036355-122036377 GGATGCTCACCTGATCCTTGGGG - Intronic
997336253 5:133110840-133110862 GACAGCTCACCGGCTCCTCATGG - Intergenic
998338254 5:141393431-141393453 TGCTCACCACCTGGTCCTCACGG + Exonic
1001478146 5:172065558-172065580 GTCAGTTCACCTGGACCTCAGGG - Intronic
1001484677 5:172111132-172111154 GGCGGCTCCCCTGGGCCTCCAGG + Intronic
1001720004 5:173849167-173849189 GGCAGTTCTTCTGGTCCTCATGG + Intergenic
1002679746 5:180951877-180951899 GGCTGCTCACCTGGATCTTCTGG - Intergenic
1002725121 5:181289495-181289517 GGCTGCTCCCCAGGTCCTGAAGG - Intergenic
1004002569 6:11608886-11608908 GGCTGCAAACCTGGACCCCATGG + Intergenic
1006378851 6:33686241-33686263 GACAGCTCACCTGGTTCTCATGG - Exonic
1013329724 6:109087965-109087987 GGCGGGTCTCCTGGTCCTTAGGG + Intronic
1017567925 6:155708771-155708793 GCCTCCTCACCTTGTACTCAAGG + Intergenic
1018923540 6:168191748-168191770 GGCTGCCCACCTTCTCCTCAAGG - Intergenic
1019507081 7:1396899-1396921 TGCTGCTCACCCGATCGTCATGG - Intergenic
1019891769 7:3952959-3952981 GGCTGCTCTCATAGTCATCACGG - Intronic
1020084947 7:5305218-5305240 GGCCGCCCACCTGGGCCCCAGGG - Exonic
1020182956 7:5936373-5936395 GGATGCTAACCAGGTCCGCAGGG - Intronic
1020299956 7:6788384-6788406 GGATGCTAACCAGGTCCGCAGGG + Intronic
1021291519 7:18851152-18851174 TGCAGCTCAGCTGCTCCTCATGG - Intronic
1022214352 7:28243506-28243528 GGCTCCTCACAAGGTCCTGATGG - Intergenic
1024286886 7:47765593-47765615 GGTTGCTCACTTACTCCTCAGGG + Intronic
1025209341 7:57011894-57011916 GGCTGCCCACCTGGACCCCAGGG + Intergenic
1025662604 7:63564960-63564982 GGCTGCCCACCTGGACCCCAGGG - Intergenic
1026463631 7:70635426-70635448 GGCTGCTCACCATGGCCTCGAGG - Intronic
1026960399 7:74404177-74404199 GGCCGCTAAGATGGTCCTCAGGG - Exonic
1030741412 7:113114086-113114108 GGCTACCCACATGGTCTTCATGG - Intergenic
1031331637 7:120473070-120473092 GGCTGATCTGCTGGTCCTTATGG - Intronic
1031873917 7:127116584-127116606 GGCCACTCACCTGGTCCGCAAGG + Intronic
1032431123 7:131862552-131862574 TGGTCCTCACGTGGTCCTCACGG - Intergenic
1032477612 7:132223155-132223177 GACTCCTCAGCTGTTCCTCAGGG - Intronic
1034092516 7:148377137-148377159 GGCTGGTCATCTGGGCCTCTTGG - Intronic
1034922906 7:155098609-155098631 AGCTGCTCAAATGGTGCTCAGGG + Intergenic
1035674928 8:1449801-1449823 GGCCGCCCACCTCGTCTTCACGG - Intergenic
1035698744 8:1621673-1621695 GGCTGCCCTCCTGGTGCTGACGG - Intronic
1035715915 8:1754838-1754860 AGCTGCTCACCTGGTGCCCTGGG + Intergenic
1036488560 8:9202249-9202271 GGTTGCTCATTTGGTTCTCAGGG - Intergenic
1036788876 8:11704767-11704789 GGCAGCTCCGCTGGGCCTCAGGG + Intronic
1037844158 8:22267922-22267944 GGCTTCTCAAATGGTCCTGACGG + Intergenic
1038426631 8:27468220-27468242 GGCTGGTCACCTGGGCTTCAGGG - Intronic
1038644351 8:29350388-29350410 GGCCGCAAACTTGGTCCTCAAGG + Exonic
1039773709 8:40715189-40715211 TGCTGCTCACCTCATGCTCAAGG - Intronic
1042841154 8:73125199-73125221 GGCTGATCTCAGGGTCCTCATGG - Intergenic
1045016604 8:98006142-98006164 TGCTGCACAGCTGGTCCTCCGGG - Intronic
1046097068 8:109575034-109575056 GGCTGCCCCCGTGGTCCCCACGG - Exonic
1046596344 8:116265566-116265588 GGCTGCTTTCCTGTTCCTAATGG - Intergenic
1048266550 8:132992323-132992345 GCCTGCTCACCTGGGCCTTCTGG + Intronic
1050433224 9:5583457-5583479 GGCAGCTCATCTAGTCCCCAGGG + Intergenic
1050593886 9:7186777-7186799 GGCTGCATACCTGGACCTTAGGG + Intergenic
1050600609 9:7246445-7246467 GTCTCCTCACCTAGCCCTCAGGG - Intergenic
1053146828 9:35717726-35717748 TGCAGCTGCCCTGGTCCTCAAGG - Exonic
1056810936 9:89763516-89763538 GGTTCCTCAGCTGGTCCTAATGG + Intergenic
1057444864 9:95106731-95106753 TGCTGCTCTCCTCCTCCTCATGG - Intronic
1060025185 9:120164782-120164804 GGCTGCTTACCAGGTACTGAAGG - Intergenic
1060733569 9:126052451-126052473 CAGGGCTCACCTGGTCCTCAAGG - Intergenic
1060872145 9:127051073-127051095 AGCTGCTCTACTGGCCCTCATGG + Intronic
1060934937 9:127509249-127509271 GGATGGCCACCTGGTGCTCATGG + Intronic
1061404469 9:130385750-130385772 GGTTGCTCACCTGGGCTTCCTGG - Intronic
1062355168 9:136158448-136158470 GGCTGCTCAGCATCTCCTCATGG + Intergenic
1062357693 9:136172649-136172671 GGCCGCTCACCTGCACCTCCTGG - Intergenic
1062697896 9:137884766-137884788 GCCTCCTCTCCTGGCCCTCAAGG - Intronic
1200216176 X:154369166-154369188 AGCGGCTCACCTGGCCCTCCAGG - Intronic