ID: 916797643

View in Genome Browser
Species Human (GRCh38)
Location 1:168181500-168181522
Sequence TATGGAGAGGAGGCCGGGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 976
Summary {0: 1, 1: 2, 2: 11, 3: 114, 4: 848}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916797643_916797649 5 Left 916797643 1:168181500-168181522 CCGCACCCGGCCTCCTCTCCATA 0: 1
1: 2
2: 11
3: 114
4: 848
Right 916797649 1:168181528-168181550 TTCTGTGACAAATTGCCGATTGG 0: 1
1: 0
2: 0
3: 3
4: 55
916797643_916797651 22 Left 916797643 1:168181500-168181522 CCGCACCCGGCCTCCTCTCCATA 0: 1
1: 2
2: 11
3: 114
4: 848
Right 916797651 1:168181545-168181567 GATTGGTGCAAAAGTAATTGCGG 0: 136
1: 1359
2: 2020
3: 1460
4: 947

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916797643 Original CRISPR TATGGAGAGGAGGCCGGGTG CGG (reversed) Intronic
900074436 1:801704-801726 TGTGGAAAGGTGGCCAGGTGCGG - Intergenic
900253550 1:1684463-1684485 TAAGAATAGGAGGCCGGGCGCGG + Intronic
900332068 1:2140360-2140382 TATGAGCAGGAGGCCGGGCGCGG + Intronic
900345987 1:2210472-2210494 TTTGGGGAGGAGGCCAGGTGGGG + Intronic
900813632 1:4826725-4826747 TATGTAGAGGTGGCCCTGTGAGG + Intergenic
900894943 1:5476855-5476877 TGTGAAGAGGAGGAGGGGTGGGG - Intergenic
901258036 1:7848805-7848827 GATGTACAGAAGGCCGGGTGCGG - Intronic
901553687 1:10015055-10015077 TGTTGAGAGTAGGCCAGGTGTGG + Intronic
901800808 1:11706849-11706871 TAAGGGGAGGAGGCTGGGAGAGG + Intronic
901862455 1:12083396-12083418 TATCGAGAGCAGGCCCGGAGTGG + Intronic
902190903 1:14762433-14762455 AAAGAAGAAGAGGCCGGGTGCGG + Intronic
902363736 1:15957368-15957390 TGTGGAGAGGAGGAGGTGTGTGG + Intronic
902363746 1:15957407-15957429 TGTGGAGAGGAGGAGGTGTGTGG + Intronic
902415145 1:16234107-16234129 TACACAGAGGAGGCCTGGTGCGG + Intronic
902423660 1:16302250-16302272 TAAGAAGGGCAGGCCGGGTGCGG + Intronic
902979124 1:20110378-20110400 AAGACAGAGGAGGCCGGGTGGGG + Intergenic
903080570 1:20808389-20808411 AATGAAGAGGTGGCCGGGCGCGG + Intronic
903465938 1:23552872-23552894 TAGGTATAGGAGGCCGGGCGCGG + Intergenic
903484929 1:23682570-23682592 GATTGAGAGGGGGCCGGGTATGG + Intergenic
903778922 1:25809583-25809605 CAGGGAGAGGAGGCTGAGTGTGG - Intronic
903852716 1:26317900-26317922 GAGGCAGAGGAGGCGGGGTGAGG - Intronic
904080772 1:27871460-27871482 CAGGGAGAAGAGGCTGGGTGTGG - Intergenic
904100252 1:28019990-28020012 TATGGAGAAGTAGCCGGGCGTGG - Intronic
904173453 1:28608461-28608483 GAAAGAGAGCAGGCCGGGTGTGG + Intronic
904373720 1:30066477-30066499 CATGGAGAGTAGGCTGGGAGCGG - Intergenic
904432211 1:30471562-30471584 TAAGGAGGGGAGGCAGGATGTGG + Intergenic
904476449 1:30768094-30768116 AATGGTGAAAAGGCCGGGTGTGG - Intergenic
904841763 1:33376638-33376660 TCTACAGAGAAGGCCGGGTGCGG + Intronic
905183964 1:36183043-36183065 TGAGGAGGGGAGGCCGGGAGGGG - Intergenic
905973854 1:42161720-42161742 CAGGGTGAGGAGGCAGGGTGTGG - Intergenic
906072365 1:43026365-43026387 AAGGGAGAACAGGCCGGGTGCGG + Intergenic
906117563 1:43366630-43366652 TTAGGAGAGGATGCTGGGTGTGG - Intronic
906165650 1:43684212-43684234 AAAGAAGAGGTGGCCGGGTGTGG + Intronic
906258995 1:44372121-44372143 AATGGAGACACGGCCGGGTGTGG + Intergenic
906291046 1:44619346-44619368 TCTAGAGAAGAGGCGGGGTGTGG + Intronic
906960740 1:50418382-50418404 TTTGGAAAGGGGGCCGGGTGAGG + Exonic
907118391 1:51989533-51989555 CCTGGGGAGGAGGCCAGGTGTGG - Intronic
907331664 1:53675890-53675912 TAGGGAGAGGAGGTGGGATGGGG - Intronic
907400143 1:54220216-54220238 CTTGGAGAGGAGGGAGGGTGAGG + Intronic
907508063 1:54936436-54936458 GATAAAGAGGAGGCTGGGTGCGG - Intergenic
908352863 1:63303164-63303186 GATGGAAAGGCGGCCAGGTGAGG - Intergenic
908546629 1:65168580-65168602 TATGGAGAGCAGGCCAGATGTGG - Intronic
908697306 1:66857874-66857896 TGTGGGCAGAAGGCCGGGTGCGG - Intronic
909017203 1:70393170-70393192 TTTGGGGAGGAGGCTGGATGTGG + Intergenic
910434910 1:87196285-87196307 TAGGGAGAGGTAGCAGGGTGGGG - Intergenic
911995288 1:104758222-104758244 TATGGGGAAGAGGGGGGGTGGGG + Intergenic
912051620 1:105536296-105536318 AATGGAGACAGGGCCGGGTGTGG - Intergenic
912538073 1:110390784-110390806 TCTGGTGAGCAGGCTGGGTGGGG + Intronic
912567884 1:110601481-110601503 TGTAGAGAGGAGGCCCGGGGTGG + Intronic
912685533 1:111759682-111759704 AATGAAGAGCAGGCCGGGCGCGG + Intronic
912703448 1:111895190-111895212 GAGGGGGAGGAGGCAGGGTGAGG + Intronic
912811295 1:112796892-112796914 TAAAGAAAGTAGGCCGGGTGTGG + Intergenic
913187807 1:116385834-116385856 AGTAGAGAAGAGGCCGGGTGCGG + Intronic
913188861 1:116396041-116396063 TCCTGAGAGTAGGCCGGGTGTGG - Intronic
913715501 1:121530256-121530278 TATGGACAGGAAGCCAGGCGGGG - Intergenic
914475084 1:148015602-148015624 AATAGAGAGAAGGCCGGGCGCGG - Intergenic
914749118 1:150521089-150521111 TATGAAAATGAGGCCGGGCGTGG - Intergenic
915393578 1:155564829-155564851 TATTGAAATGAGGCTGGGTGTGG + Intergenic
915959719 1:160255422-160255444 GAGGGAGAAGAGGCCAGGTGTGG - Intronic
916415611 1:164589349-164589371 TAAGGAGAGGGGGCGGGGAGAGG + Intronic
916617136 1:166453584-166453606 GATGGAGAGGCGGCCTGGTGTGG - Intergenic
916797643 1:168181500-168181522 TATGGAGAGGAGGCCGGGTGCGG - Intronic
917351924 1:174087320-174087342 AAGGCAGAGTAGGCCGGGTGTGG - Intergenic
917831017 1:178886382-178886404 TATGGGGAGGAGGAAGAGTGTGG + Intronic
917869577 1:179229538-179229560 TGCCGTGAGGAGGCCGGGTGCGG - Exonic
918077847 1:181183872-181183894 GATGTATAGGAGGCCGGGTGTGG - Intergenic
918107885 1:181428889-181428911 GCTGTAAAGGAGGCCGGGTGCGG + Intronic
918223031 1:182453488-182453510 GATGGAGAGAAGGCCATGTGAGG + Intronic
918398612 1:184141900-184141922 GATGGGGAGGAGACGGGGTGCGG - Intergenic
918455800 1:184712214-184712236 TATGTTGAGTAGGCCAGGTGCGG - Intronic
919842678 1:201620757-201620779 TATGGCCATGAGGCTGGGTGCGG - Intergenic
919856746 1:201711381-201711403 CAGGGAGGGGAGGCTGGGTGGGG - Intronic
919888690 1:201954418-201954440 TATGGGGACCAGGCCGGGCGTGG - Intergenic
919999625 1:202787595-202787617 TATGTGAAGTAGGCCGGGTGCGG + Intronic
920079013 1:203358665-203358687 CCTGGAGAGGAGCCTGGGTGTGG - Intergenic
920130630 1:203729254-203729276 AGTGGAAAAGAGGCCGGGTGCGG + Intronic
920283503 1:204861777-204861799 AAGTGAGAAGAGGCCGGGTGCGG - Intronic
920375444 1:205505509-205505531 GAGGGAAAGGAGGCTGGGTGGGG + Intronic
921148008 1:212377815-212377837 TTTGGAGAGGAGGCAGGGAGTGG - Intronic
921243306 1:213209403-213209425 AATGTAAAGGAGGCCAGGTGTGG + Intronic
921517948 1:216120667-216120689 AGTGGAGACGAGGCCGGGTGCGG - Intronic
921660357 1:217793823-217793845 ACTGAAAAGGAGGCCGGGTGCGG + Intronic
922022944 1:221722471-221722493 TCTGAAGAGCAGGCCTGGTGTGG + Intronic
922178407 1:223215065-223215087 GATGGAGAGGAGGCTGGGTAGGG - Intergenic
922270283 1:224026608-224026630 TGTGGAAAGGTGGCCAGGTGCGG - Intergenic
922898369 1:229117913-229117935 AATGGACAGGAGGCCGAGAGGGG + Intergenic
923005434 1:230045673-230045695 TCTTGGGAGGAGGCCGGGCGCGG + Intergenic
923477235 1:234345574-234345596 CATGGAGAGGATGCCCAGTGAGG + Intergenic
923717914 1:236441818-236441840 GAGGGTTAGGAGGCCGGGTGCGG - Intronic
923788982 1:237094879-237094901 TAGGAAGACAAGGCCGGGTGCGG - Intronic
923911095 1:238444854-238444876 TTTGGAGAGGAGTCTGGCTGGGG + Intergenic
923958360 1:239048699-239048721 TCTGTGGAGGAGGCTGGGTGGGG + Intergenic
924582519 1:245334638-245334660 TCTGGAGAGGAGTATGGGTGCGG + Intronic
924604074 1:245517073-245517095 AATGGGGATGGGGCCGGGTGTGG + Intronic
924671183 1:246127603-246127625 TATGAAAAGGAGGCTGGGTGCGG + Intronic
1063159580 10:3409382-3409404 GATGGAGAGAAGGCCCAGTGAGG + Intergenic
1063326048 10:5103176-5103198 GATGAAGAGGAGGCCAGGAGCGG - Intronic
1063788780 10:9415695-9415717 TTTGGAGAAGAGACCGTGTGGGG - Intergenic
1064056919 10:12105803-12105825 TGTGGTGATGAGGCCGGGCGTGG + Intronic
1064142543 10:12802808-12802830 AATGAAGAGCAGGCCGGGGGCGG - Intronic
1064292481 10:14048513-14048535 TATGGTGGGTGGGCCGGGTGTGG + Intronic
1065371935 10:24996155-24996177 TATGTTGAGGAGGCCGGGCACGG + Intronic
1065629024 10:27658920-27658942 TTATCAGAGGAGGCCGGGTGTGG - Intergenic
1065772281 10:29088604-29088626 AAATGAAAGGAGGCCGGGTGTGG - Intergenic
1066025986 10:31361554-31361576 GATGGTGAGGGGGCCGGGTGGGG + Intronic
1067130368 10:43558737-43558759 AAAGGAAAGTAGGCCGGGTGTGG - Intronic
1067491783 10:46714857-46714879 GAAGCAGAGGGGGCCGGGTGCGG + Intergenic
1067558300 10:47287267-47287289 CATGGGGAGGCGGCAGGGTGGGG + Intergenic
1067602876 10:47625519-47625541 GAAGCAGAGGGGGCCGGGTGCGG - Intergenic
1068588330 10:58826459-58826481 GAAAGAAAGGAGGCCGGGTGCGG + Intronic
1069036264 10:63648936-63648958 AGTGGAGAGGAGGCCGGGTGTGG + Intergenic
1069415469 10:68196773-68196795 AAGGGAGAGGGGGCCAGGTGTGG - Intronic
1069480559 10:68777928-68777950 TCTGAAAAGAAGGCCGGGTGCGG + Intronic
1069505165 10:68990978-68991000 TATGTAGAAAAGGCCGGATGTGG + Intronic
1069575069 10:69521217-69521239 AAGGCAGAGGAGGCCAGGTGTGG + Intergenic
1070032065 10:72686631-72686653 TCTGGGCAGGAGGCCGGGTGCGG + Intergenic
1070060034 10:72973052-72973074 AAAGGAGAGCAGGCTGGGTGTGG - Intergenic
1070240314 10:74673875-74673897 TTTGGAGAGGAGTCTGGCTGGGG - Intronic
1070611186 10:77933890-77933912 TACGGAGAGTAGGCCGGGCACGG + Intergenic
1070622491 10:78024071-78024093 ACTGGAGAGCTGGCCGGGTGTGG + Intronic
1070718160 10:78737582-78737604 CATGGAGAGGAGGGAGAGTGGGG + Intergenic
1072149340 10:92673111-92673133 TATGGACAGTAGGCCAGGCGCGG - Intergenic
1072354203 10:94589975-94589997 AAGGGAGAAGAGGCCGGGTACGG - Intronic
1073042535 10:100617416-100617438 TTTGAAGAGGAGTCCAGGTGGGG - Intergenic
1073118725 10:101108357-101108379 TAGGGAGAGGAGGCGGGGTCTGG - Intronic
1073986402 10:109214791-109214813 TAAAGAAAGTAGGCCGGGTGTGG + Intergenic
1074569802 10:114614159-114614181 CTTGGAAAGTAGGCCGGGTGCGG + Intronic
1074690641 10:116001340-116001362 AATGGGGAGTAGGCGGGGTGGGG - Intergenic
1075037002 10:119077841-119077863 AATTCAGAGGAGGCCGGGCGTGG - Intronic
1075086136 10:119415608-119415630 GATGGAGAGGAGGCAGTGGGTGG + Intronic
1076283918 10:129275212-129275234 GATGGAGCGGGGGCGGGGTGGGG - Intergenic
1076595056 10:131620157-131620179 TAAAGAGAGGAGGCGGGGGGGGG + Intergenic
1076977011 11:180917-180939 TATAGATAGCAGGCCAGGTGTGG + Intronic
1076979106 11:195857-195879 CATGGTGAGGGGGCCTGGTGAGG + Intronic
1077099980 11:818422-818444 AAATGAGAGGAGGCCGGGTGTGG - Intergenic
1077601516 11:3578047-3578069 TATGGTGGGGAGGCGGGGGGGGG - Intergenic
1077885811 11:6386929-6386951 TATGGCAAAGTGGCCGGGTGCGG + Intergenic
1078005082 11:7526579-7526601 TGTGCAGAAGCGGCCGGGTGCGG + Intronic
1078114427 11:8431153-8431175 TATGTTAAGGAGGCCGGGTGCGG - Intronic
1078191244 11:9093844-9093866 TGTGGAGAGGAGACAGGGAGAGG - Intronic
1078770424 11:14345274-14345296 TTTTGAGTGGAGGCCAGGTGCGG - Intronic
1079054928 11:17197308-17197330 AATGGAGTGGGGGCCAGGTGCGG - Intronic
1079101556 11:17545041-17545063 TATCCAGAGAAGGCCGGGCGCGG - Intergenic
1079599899 11:22298374-22298396 TATGGGGAGGGGGCGGGGAGGGG + Intergenic
1080418916 11:32093102-32093124 ACTGGAGAGGAGGCAGGGAGAGG + Intronic
1081755641 11:45542392-45542414 TCTGGAGAGGGAGCTGGGTGTGG - Intergenic
1081985337 11:47298076-47298098 TATGTAAAGAAGGCCGGGCGCGG - Intronic
1082772589 11:57219854-57219876 AATGGAGAAGAGGAGGGGTGGGG + Intergenic
1083309160 11:61775681-61775703 TATGGACATGAGGGAGGGTGGGG + Intronic
1083319343 11:61835680-61835702 AAAGAAGAGGGGGCCGGGTGCGG - Intronic
1083420885 11:62552595-62552617 TATGGGGTGGAGGCGGGGTCTGG - Intronic
1083461859 11:62818927-62818949 AATGAAGGTGAGGCCGGGTGCGG + Intronic
1083604054 11:63966851-63966873 AATGGAAAGGAGGCTGGGCGCGG + Intergenic
1083722865 11:64611993-64612015 TGTGGAGAGGAAGTGGGGTGTGG - Intronic
1083823659 11:65186411-65186433 TCTGGAGCGGAGCCTGGGTGGGG - Intronic
1084077501 11:66792098-66792120 TAGAGAGAGGAAGCTGGGTGCGG - Intronic
1084138270 11:67204089-67204111 AATGTAGGGGAGGCCAGGTGTGG - Intronic
1084165219 11:67372369-67372391 TGTGGAAAGGAAGGCGGGTGGGG + Intronic
1084185953 11:67471315-67471337 AATGAACATGAGGCCGGGTGTGG - Intergenic
1084224710 11:67708730-67708752 TATAGAGCTGAGGCCGGGCGTGG - Intergenic
1084262529 11:67988595-67988617 TATAGAGCTGAGGCCGGGCGTGG - Intergenic
1084664159 11:70567336-70567358 GCTGGAGATGAGGCCGGGCGTGG + Intronic
1084872937 11:72109928-72109950 CCTGGAGAGGAGGCTGGGTGTGG + Exonic
1085043386 11:73339886-73339908 TATGGAGAGGAGGGCTGGGTAGG + Intronic
1085632779 11:78133123-78133145 TAGGAAGAAGAGGCTGGGTGTGG - Intronic
1086336915 11:85810086-85810108 TGTGCAGAGGAAGCCCGGTGGGG - Intronic
1087279377 11:96193076-96193098 TATGGTGTTGGGGCCGGGTGCGG + Intronic
1087814314 11:102641722-102641744 TAAAGTGAGAAGGCCGGGTGTGG + Intergenic
1088024033 11:105156123-105156145 TATGCAGAGGAGGTTAGGTGTGG + Intergenic
1088619645 11:111668911-111668933 TGTGGAGAGAGGGCAGGGTGTGG + Intronic
1089345941 11:117791805-117791827 TCTGGAGAGGGGGCAGGGAGAGG + Intronic
1089531254 11:119131377-119131399 AATGGAGGAGTGGCCGGGTGCGG - Intronic
1090040300 11:123284912-123284934 AATGAAGATGAGGCCGGGCGCGG + Intergenic
1090362803 11:126185332-126185354 AGTGGAGAGGAGGCCGCCTGGGG - Intergenic
1090365496 11:126201908-126201930 AATGGAGAAGAGGCTGGGCGCGG - Intergenic
1090388035 11:126367855-126367877 TATGCATAGCAGGCCGGGTGTGG + Intronic
1090389530 11:126379766-126379788 TAAGGATAACAGGCCGGGTGTGG - Intronic
1090398478 11:126434220-126434242 GATGGAGGGGAGGCTGAGTGGGG - Intronic
1090501742 11:127267593-127267615 GTGGGAGAGGAGGCTGGGTGCGG - Intergenic
1091339109 11:134796448-134796470 CATAGAGCGGGGGCCGGGTGTGG - Intergenic
1091634227 12:2185306-2185328 TATGGAGAGTAGACGGGGTGGGG - Intronic
1091694163 12:2616838-2616860 TCTGGAGAGGAGCCGTGGTGAGG - Intronic
1092153226 12:6265580-6265602 TATGAAGAAGCGGCCGGGCGTGG + Intergenic
1092158138 12:6298242-6298264 AGTGAAAAGGAGGCCGGGTGTGG + Intergenic
1092176128 12:6408530-6408552 TAAGAAGAAGAGGCTGGGTGTGG - Intergenic
1092587294 12:9912329-9912351 CATGGAGGGGAGGCAGAGTGAGG + Intronic
1092729671 12:11517745-11517767 AATGAAGATGTGGCCGGGTGCGG - Intergenic
1093058013 12:14574085-14574107 TATGTAGAGTAAACCGGGTGTGG + Intergenic
1093304659 12:17499317-17499339 TATGGCAAGGAGGCCAGTTGTGG + Intergenic
1093462488 12:19419297-19419319 TATGGAAAATAGGCCGGGTGCGG + Intronic
1093865090 12:24216630-24216652 TATGGACATGAGCTCGGGTGCGG + Intergenic
1093953803 12:25194108-25194130 TAGGGAGTGGAGGCCTGGCGCGG - Intronic
1094067785 12:26379643-26379665 CATGCAGAGGAGGCGTGGTGGGG - Intronic
1094364314 12:29663805-29663827 TATGGAGAATTGGCTGGGTGTGG - Intronic
1094401520 12:30066091-30066113 AAAGGAAAGGAGGCCGGGTGTGG + Intergenic
1094454612 12:30618792-30618814 GATGGGAAGCAGGCCGGGTGCGG + Intergenic
1094619642 12:32067639-32067661 TCTGAATATGAGGCCGGGTGCGG - Intergenic
1095966280 12:47869244-47869266 TAGGAAGAGAAGGCCGGGCGCGG + Intronic
1096067361 12:48751774-48751796 TATTGTGGAGAGGCCGGGTGCGG + Intergenic
1096462541 12:51829996-51830018 TACTGAGAGTAGGCCTGGTGTGG + Intergenic
1096492943 12:52023042-52023064 AATGGAGAGGAGGCGGGGCTGGG + Intronic
1096517172 12:52163362-52163384 AATGAAGAGTAGGCCGGGCGCGG + Intergenic
1096725709 12:53560210-53560232 AGTAAAGAGGAGGCCGGGTGCGG - Intronic
1096974391 12:55691302-55691324 GCTGGAGTGGAGGCGGGGTGTGG + Intronic
1097890740 12:64774800-64774822 TATGGAAAGAAGGCCGGGCATGG + Intergenic
1099956198 12:89353999-89354021 GATGGAGGCGTGGCCGGGTGGGG + Intergenic
1099973177 12:89521391-89521413 AAGTGAGGGGAGGCCGGGTGCGG - Exonic
1100108917 12:91213131-91213153 TATGAAGTCCAGGCCGGGTGTGG - Intergenic
1100277233 12:93082272-93082294 TATGGAAAGCAGGCCGGGCGCGG + Intergenic
1100476039 12:94936190-94936212 AATTGATATGAGGCCGGGTGTGG - Intronic
1100545597 12:95599063-95599085 TATAGGGAAGAGGCCGGGCGCGG - Intergenic
1100599543 12:96101069-96101091 GAAGAAAAGGAGGCCGGGTGCGG - Intergenic
1100976714 12:100130248-100130270 TAATGAAATGAGGCCGGGTGTGG - Intronic
1101319324 12:103659336-103659358 TGCAGAGAGGAGGCTGGGTGAGG + Intronic
1101325978 12:103716323-103716345 TCTGGAGAGCAGGCTGGGGGAGG + Intronic
1101354472 12:103964406-103964428 TAACGTGAGGAGGCCGGGCGTGG - Intronic
1102061321 12:109933889-109933911 TATGCAGTCGAGGCCGGGTGTGG - Intronic
1102370322 12:112377578-112377600 TACTGGGAAGAGGCCGGGTGCGG + Intronic
1102406671 12:112679714-112679736 TCTGGTAAGTAGGCCGGGTGTGG - Intronic
1102478986 12:113207911-113207933 TATGGAGGGGATGCTGGGGGAGG - Exonic
1102494626 12:113311022-113311044 TTATGTGAGGAGGCCGGGTGTGG + Intronic
1102905060 12:116668068-116668090 TAAGTGGAGGAGGCCGGGTGCGG + Intergenic
1103019474 12:117522395-117522417 AATGGAGAGAAGGCCAGGGGTGG + Intronic
1103400032 12:120637552-120637574 ACTGGAGAGGAGGCCGGGCATGG - Intergenic
1103568333 12:121828204-121828226 TAGGGAGAGGAGGACATGTGAGG + Intronic
1103620503 12:122184382-122184404 TCTAGAGAGTAGGCCAGGTGCGG - Intronic
1103685881 12:122731551-122731573 AATGGGGTGGAGGCCGGGCGCGG + Intergenic
1103831885 12:123786845-123786867 TATATAGATGAGGCCGGGTGCGG + Intronic
1103927559 12:124432365-124432387 TCTGCAGAGGAGGCCAGGTCTGG - Intronic
1104122193 12:125810183-125810205 TAAGGAAACTAGGCCGGGTGCGG + Intergenic
1104656667 12:130578710-130578732 TGTGGAGACGGGGCAGGGTGAGG - Intronic
1105297569 13:19102805-19102827 TAAAGACAGCAGGCCGGGTGTGG + Intergenic
1105381453 13:19891251-19891273 CATGGAGAAGAGGCCGCGTGAGG + Intergenic
1105414163 13:20194120-20194142 TGTGCAGAGCAGGCTGGGTGGGG + Intergenic
1105416113 13:20212760-20212782 TATGGAGGCCAGGCTGGGTGTGG + Intergenic
1105985592 13:25563117-25563139 TTTCAAGAGGAGGCCAGGTGCGG + Intronic
1105993576 13:25648373-25648395 AATGGTGAGTAGGCTGGGTGTGG + Intronic
1106038909 13:26070915-26070937 AATGATGAGTAGGCCGGGTGTGG - Intergenic
1106264209 13:28095562-28095584 TTTGGAGAGGGGGCCGGGCAAGG - Intronic
1106325473 13:28684783-28684805 AATGGAGAGGAGACCTGGAGTGG - Intergenic
1106368467 13:29107046-29107068 TAGGGATAGAAGGCCGGGGGAGG - Intronic
1106503155 13:30348425-30348447 TATGATGGGGAGGCTGGGTGTGG - Intergenic
1107389070 13:39944550-39944572 TATGGAGAAGAGGGGTGGTGAGG - Intergenic
1107475442 13:40731279-40731301 AAGACAGAGGAGGCCGGGTGTGG + Intronic
1107585367 13:41841494-41841516 TATAAACAGTAGGCCGGGTGCGG + Intronic
1107640739 13:42440796-42440818 TAAGGAAAAGAGGCCGGGCGCGG + Intergenic
1108349963 13:49582884-49582906 AGTGGAGTGGAGGCCGGGTGTGG + Intronic
1108921597 13:55681394-55681416 AATGTAGAGAAGGCCAGGTGTGG - Intergenic
1109406787 13:61910732-61910754 TATAGAGAGGTGCCCCGGTGAGG - Intergenic
1111534631 13:89586776-89586798 TATGGAGGGGAGGCTGGGAGTGG + Intergenic
1111813264 13:93118912-93118934 ATTGGAGAAGAGGCTGGGTGTGG + Intergenic
1112338853 13:98536652-98536674 AATGGAGAGAAGGGCAGGTGTGG - Intronic
1112380781 13:98887324-98887346 TATGGATAATAGGCCGGGTGGGG + Intronic
1112456859 13:99570917-99570939 AATCCAGTGGAGGCCGGGTGCGG - Intergenic
1112724134 13:102282342-102282364 TAGGGATAGGAGGCTGGGCGTGG - Intronic
1113111052 13:106823958-106823980 CATGAAGAAGAGGCCGGGCGCGG - Intergenic
1113581056 13:111429434-111429456 AATGGAGAGCAGCACGGGTGTGG - Intergenic
1113647860 13:112011635-112011657 GAAGGAGAAGAGGCCGGGCGCGG - Intergenic
1113748776 13:112764533-112764555 TCTGGATGGGAGGCAGGGTGGGG - Intronic
1114416591 14:22548948-22548970 TAAGAAAAGCAGGCCGGGTGTGG - Intergenic
1114428567 14:22640809-22640831 TATCAAGAAGAGGCTGGGTGTGG - Intergenic
1115311311 14:31981019-31981041 AATGTAGAGAAGGCCGGGCGCGG - Intergenic
1115534411 14:34358929-34358951 TATGAAGAAAAGGCCAGGTGCGG - Intronic
1115564223 14:34611491-34611513 AAAGGGGGGGAGGCCGGGTGTGG + Intronic
1115761493 14:36581910-36581932 CATGGAGAGGGGGCGGGGGGTGG + Intronic
1115766910 14:36632401-36632423 TGTGGGGAGGTGGCCGGGCGCGG + Intergenic
1115975634 14:38993492-38993514 TAGAGAGAGGAGGCAGGGAGGGG + Intergenic
1116280507 14:42900845-42900867 AAGGGAGAGGAGGCTGGGCGCGG + Intergenic
1117017861 14:51536705-51536727 TATGGACAAGAGGCCAGGTGCGG - Intronic
1117099384 14:52331210-52331232 AAGAGAGAGGAGGCCGGGCGCGG + Intergenic
1117684120 14:58236256-58236278 TAAGAAGAGGAAGCCGGTTGTGG + Intronic
1118026684 14:61775542-61775564 TATAGAGGGTAGGCCAGGTGTGG - Intronic
1118027398 14:61783319-61783341 TATGCACTGGAGGCCGCGTGCGG - Intronic
1118045626 14:61967968-61967990 AGTGGAGATGAGGCTGGGTGCGG + Intergenic
1118776765 14:68978535-68978557 TATGGAGAGGTGGCCAGGGGCGG + Intronic
1119030626 14:71189402-71189424 AAGAGAGAGGAGGCCAGGTGTGG - Intergenic
1119036462 14:71233786-71233808 TATGAATAACAGGCCGGGTGTGG + Intergenic
1119051803 14:71377174-71377196 GATGGGGCGGCGGCCGGGTGGGG + Intronic
1119349759 14:73954551-73954573 TATGGATTTGGGGCCGGGTGCGG + Intronic
1119658685 14:76435537-76435559 TATGGAAATGAGGCGGGGTGTGG + Intronic
1119746660 14:77049497-77049519 GATAGAATGGAGGCCGGGTGCGG + Intergenic
1120315755 14:82890575-82890597 TATATAGAGGAGGCCAGGCGTGG - Intergenic
1121068549 14:90994163-90994185 TATAGAGGATAGGCCGGGTGTGG - Intronic
1121090624 14:91179459-91179481 TATATAGATGAGGCTGGGTGCGG + Intronic
1121172938 14:91869519-91869541 AATGGAGAGGAGACTGGGTTTGG + Intronic
1121518546 14:94570059-94570081 TATGGAAAGGGGACTGGGTGTGG + Intronic
1122096700 14:99377653-99377675 AAGGCAGAGGAGGCCGGGCGCGG + Intergenic
1122220208 14:100233676-100233698 TATAGTTAGGAGGCTGGGTGCGG + Intergenic
1122504916 14:102226360-102226382 AATGGGGAGGAGGACGGCTGAGG + Intronic
1122605717 14:102946311-102946333 GAAGCAGACGAGGCCGGGTGCGG - Intronic
1122686801 14:103512440-103512462 TTTAGGGAGGAGGCCGGGTGTGG - Intergenic
1122749518 14:103922215-103922237 TATGCAGAGCAGGCCGGGCGCGG - Intronic
1122801272 14:104230823-104230845 TATGGAGATGAGGCCTGAGGAGG + Intergenic
1123047823 14:105527102-105527124 TACGGAGAGGTGGCCGGGCCGGG + Intronic
1123167899 14:106344056-106344078 AATGCACAGGAGGCCAGGTGGGG - Intergenic
1202907967 14_GL000194v1_random:89244-89266 AATTGAAGGGAGGCCGGGTGCGG - Intergenic
1125366031 15:38917096-38917118 AATAGAAAGTAGGCCGGGTGCGG - Intergenic
1125587920 15:40834563-40834585 TATGCATAGAGGGCCGGGTGCGG - Intergenic
1125810306 15:42534417-42534439 TCAGTGGAGGAGGCCGGGTGTGG - Intronic
1126414274 15:48401626-48401648 TATGGAGAGGAGGCAGGCTGGGG + Intergenic
1127515573 15:59689807-59689829 TAAGGGGAGGAGGTCGGGCGCGG + Intergenic
1127535164 15:59883327-59883349 GATGGTGGGGAGGCCGTGTGGGG + Intergenic
1128047498 15:64631832-64631854 TATAGAGTTGTGGCCGGGTGTGG - Intronic
1128277492 15:66365833-66365855 TATGCAGAGCAGGCTGGGCGCGG - Intronic
1128367601 15:67015450-67015472 TAAGAAGTGGAGGCCGGGCGCGG - Intergenic
1128442564 15:67725887-67725909 TATTGAAAGGAGGTGGGGTGGGG + Intronic
1128930613 15:71702024-71702046 GATGGAGAGGAGGCCTGGCAGGG - Intronic
1129260889 15:74366608-74366630 AATTGGGAGAAGGCCGGGTGCGG - Intronic
1130318230 15:82815058-82815080 TATGAAAAACAGGCCGGGTGCGG - Intronic
1130343626 15:83021462-83021484 TATGGAACTGAGGCTGGGTGTGG + Intronic
1130917576 15:88318065-88318087 TGGGGAGAGGAGGCCAGATGAGG - Intergenic
1131043306 15:89293394-89293416 AAGGGAGGGGAGGCCAGGTGCGG + Intronic
1131056485 15:89378208-89378230 TCTGGAGCGGAGTGCGGGTGCGG - Intergenic
1131144138 15:90000816-90000838 TCTGGAGAGGAGAGCCGGTGCGG - Intergenic
1131229192 15:90647537-90647559 TGTGGAGAGGAGAAGGGGTGAGG - Intergenic
1131282904 15:91035002-91035024 CATGGAGAGCATGCCGCGTGTGG - Intergenic
1131810444 15:96167955-96167977 AATTTAGAGGAGGCCAGGTGTGG + Intergenic
1131828293 15:96337150-96337172 TAAGGGGGGGAGGCGGGGTGGGG - Intronic
1131853402 15:96566529-96566551 GAAGGAGAGGGGGCTGGGTGAGG - Intergenic
1132015234 15:98309464-98309486 AAAGAAGAGGAGGCCGGGTGAGG - Intergenic
1132163209 15:99562473-99562495 TTTGGAGATGAGGGCGGGAGGGG + Intergenic
1132520576 16:385912-385934 TATTCAGAGTAGGCCGGGCGCGG - Intronic
1132521512 16:392155-392177 TGTGGACAGGAGGCTGGGTGGGG + Intergenic
1132839738 16:1973149-1973171 TAGGTAGGGGAGGCCGGGCGCGG + Intronic
1132898798 16:2242281-2242303 TATGGACAGTGGGCCAGGTGCGG - Intronic
1133573150 16:7062025-7062047 AATGGCAACGAGGCCGGGTGTGG + Intronic
1133935288 16:10264441-10264463 TAAAAGGAGGAGGCCGGGTGCGG + Intergenic
1133964439 16:10520077-10520099 AAAGGAAAGGAGGCTGGGTGCGG - Intergenic
1134133588 16:11665985-11666007 AATGGAGATGAGGCCGGGTGCGG - Intergenic
1134263566 16:12673754-12673776 AATAAAGATGAGGCCGGGTGCGG + Intronic
1134331004 16:13251194-13251216 TATGGAGAGGAGGAAGCTTGGGG - Intergenic
1134542531 16:15079098-15079120 TATGAAGAGGAGGCCGGGCGTGG - Intronic
1134683868 16:16145409-16145431 TATGAAGAGGAGGCAGAGTGAGG + Intergenic
1134795811 16:17035772-17035794 TAAGGAGAGGAGGAGGGGAGGGG + Intergenic
1135032285 16:19047987-19048009 CATCAAGAGTAGGCCGGGTGCGG - Intronic
1135055437 16:19228206-19228228 TATGGAGAGGGGGTGTGGTGTGG - Intronic
1135064461 16:19297955-19297977 TATGTACAGGTGGCCGGGTGCGG + Intronic
1135198194 16:20412053-20412075 TAAGGAAAGAAGGCCGGGCGCGG + Intronic
1135220036 16:20606515-20606537 TAAGGAAAGAAGGCCGGGCGCGG - Intergenic
1135360108 16:21805176-21805198 TATGAAGAGGAGGCTGGGTGTGG - Intergenic
1136262698 16:29091764-29091786 TATGAAGAGGAGGCCGGGTGTGG + Intergenic
1136502843 16:30682052-30682074 TACGTATAGGAGGCCGGGTGCGG + Intergenic
1137964371 16:52916086-52916108 TATGCAGATTAGGCCGGGAGCGG - Intergenic
1138959059 16:62007194-62007216 TATGAAATGGGGGCCGGGTGTGG - Intronic
1139570363 16:67807768-67807790 TATGGTACGTAGGCCGGGTGTGG - Intronic
1139610848 16:68057440-68057462 AAAAGAGAGGAGGCCGGGAGTGG + Intronic
1139740279 16:69029815-69029837 TAAGAAGAACAGGCCGGGTGTGG + Intronic
1139870095 16:70100945-70100967 AATGGAGATGAGGCCGGGCATGG + Intergenic
1140098911 16:71897653-71897675 TATTGAGTGGAGGCCGGGCACGG + Intronic
1140217739 16:73022051-73022073 TGTGGAGAGGAGGCGGGACGAGG - Intronic
1140226249 16:73079627-73079649 TAAAGATAGGAGGCCAGGTGTGG - Intergenic
1140284728 16:73591401-73591423 AAAGCAGAGGGGGCCGGGTGCGG + Intergenic
1140385352 16:74531615-74531637 AATGGAGATGAGGCCGGGCATGG - Intronic
1140759164 16:78096028-78096050 AAGGGAGAAGAGGCCGGGAGTGG + Intergenic
1140813783 16:78602520-78602542 TATCGAGAAGAGGCCGGGTGTGG - Intronic
1140912629 16:79467835-79467857 TATGGAGGGGAGGAAGGGAGAGG + Intergenic
1141601896 16:85131847-85131869 TAATCATAGGAGGCCGGGTGCGG - Intergenic
1141996255 16:87638207-87638229 TTTTAAAAGGAGGCCGGGTGTGG - Intronic
1142039502 16:87883618-87883640 TACGAAAAGTAGGCCGGGTGCGG - Exonic
1142443245 16:90115753-90115775 TATAGATAGCAGGCCAGGTGTGG - Intergenic
1142464149 17:119091-119113 TATAGATAGCAGGCCAGGTGTGG + Intergenic
1142466596 17:140675-140697 CATGGTGAGGGGGCCTGGTGAGG + Intergenic
1142584735 17:964955-964977 TAATGAGAGGAGGCGGGGAGAGG + Intronic
1142695181 17:1629314-1629336 CGTGGGGAGGAGGCGGGGTGGGG - Intergenic
1142737048 17:1907699-1907721 AATGGAGAAGGGGCCGGGTGGGG + Intergenic
1143035219 17:3991292-3991314 GAGGAGGAGGAGGCCGGGTGTGG - Intergenic
1143190186 17:5034810-5034832 GAGGGAGAGGTGGCCGGGGGCGG + Intronic
1143621564 17:8083866-8083888 TTTGGAAATGTGGCCGGGTGCGG + Intronic
1143681885 17:8481888-8481910 CATGGAGAGGAGGCAGGTGGGGG + Intronic
1143955937 17:10669260-10669282 AGTGGAGTTGAGGCCGGGTGCGG + Intergenic
1144101827 17:11948518-11948540 GAGCCAGAGGAGGCCGGGTGCGG - Intronic
1144295816 17:13873937-13873959 TACAGAGAGAAGGCCGTGTGAGG + Intergenic
1144552370 17:16252360-16252382 AAAGGAAAAGAGGCCGGGTGGGG - Intronic
1144555000 17:16274430-16274452 GAAGTAAAGGAGGCCGGGTGCGG + Intronic
1144644892 17:16965650-16965672 CAGGGAGAGGTGGCCTGGTGGGG + Intronic
1145115883 17:20210674-20210696 GAGGGAGTGGAGGCCTGGTGGGG - Intronic
1146069723 17:29668956-29668978 TGAGTAGAGCAGGCCGGGTGTGG + Intronic
1146175230 17:30661887-30661909 AAGAGAGAGGCGGCCGGGTGCGG + Intergenic
1146230332 17:31102450-31102472 AAGGGAGAGTAGGCCAGGTGCGG + Intronic
1146348682 17:32077930-32077952 AAGAGAGAGGCGGCCGGGTGCGG + Intergenic
1147962387 17:44176062-44176084 TTAGGAGATAAGGCCGGGTGTGG + Intronic
1147975167 17:44243369-44243391 TATAGGGGTGAGGCCGGGTGCGG + Intergenic
1148001279 17:44388953-44388975 TGCAGAGAGGAGGCCGGGCGCGG - Intronic
1148342966 17:46884375-46884397 CTTGGAGAGGGGGCTGGGTGTGG - Intronic
1148463555 17:47851369-47851391 CAGGGAGAGGGGCCCGGGTGGGG + Intronic
1148710614 17:49678144-49678166 AATGGGGAGGAGGCCGCGCGGGG - Intronic
1148740298 17:49889062-49889084 TCAGGAGGGTAGGCCGGGTGCGG + Intergenic
1149054765 17:52350317-52350339 AATGGAAAATAGGCCGGGTGTGG - Intergenic
1149134816 17:53352143-53352165 ACTGGGGAGGAGGCCGGGCGCGG + Intergenic
1149151510 17:53570235-53570257 TAAACAGAGGAGGCCGGGTGCGG + Intergenic
1149546928 17:57510716-57510738 AACCAAGAGGAGGCCGGGTGTGG - Intronic
1149710278 17:58735485-58735507 TATAGAAATGAGGCCAGGTGTGG - Exonic
1149802336 17:59581482-59581504 TATGTATTGTAGGCCGGGTGCGG + Intronic
1149809384 17:59653481-59653503 GAGGGAGAGGAGGCCGGGCGTGG - Intronic
1149844156 17:59994008-59994030 TATGTATTGTAGGCCGGGTGCGG - Intergenic
1150100221 17:62416787-62416809 TTAGGAAAGGGGGCCGGGTGCGG - Intergenic
1150255172 17:63738859-63738881 AATGGGGAACAGGCCGGGTGCGG + Intronic
1151210950 17:72543348-72543370 TTTGGAGAGGAGGATGGGTTGGG - Intergenic
1151260185 17:72910040-72910062 AAAGTTGAGGAGGCCGGGTGCGG - Intronic
1151583978 17:74997366-74997388 GGTGGATAGGAGGCTGGGTGCGG - Intronic
1152177459 17:78797337-78797359 AAGGGAGAGGTGGCTGGGTGGGG + Exonic
1152410560 17:80120565-80120587 TAGGGAGGGGAGGTCAGGTGAGG - Intergenic
1152410592 17:80120646-80120668 TAGGGAGGGGAGGTCAGGTGAGG - Intergenic
1152423704 17:80207786-80207808 AGTGGAGCTGAGGCCGGGTGGGG - Intronic
1152480671 17:80550130-80550152 TGTGGAGAGGACGCAAGGTGAGG - Intronic
1153273293 18:3344267-3344289 GAGGGAAAGGAGGCTGGGTGCGG + Intergenic
1153457445 18:5295944-5295966 TTTGGGGAGGGGGCGGGGTGGGG + Exonic
1153639728 18:7146497-7146519 TATCTAGAAGAGGCCAGGTGCGG + Intergenic
1153765680 18:8372362-8372384 TATAGAGTGGAGGCCGGGCGCGG - Intronic
1153837012 18:8972371-8972393 CATGGAGAGGAGGTCAGCTGTGG - Intergenic
1154166460 18:12018229-12018251 GATGGGGTTGAGGCCGGGTGTGG - Intronic
1154167910 18:12029709-12029731 TATGGAATGGAGGCCGGGCATGG - Intronic
1154313703 18:13286828-13286850 TGTGGAGAAGAGGCCTGGGGTGG + Intronic
1155932047 18:31718675-31718697 AGTGGAGAGGAGGCAGGGGGTGG - Intergenic
1156474133 18:37394955-37394977 CAGTGAGTGGAGGCCGGGTGGGG - Intronic
1156537844 18:37880907-37880929 TAGGAGGAGCAGGCCGGGTGCGG - Intergenic
1156606014 18:38668363-38668385 GATGCAAAGCAGGCCGGGTGCGG + Intergenic
1157063093 18:44316090-44316112 TAAGGAGTCTAGGCCGGGTGCGG - Intergenic
1157868335 18:51205931-51205953 TATGGAAAAAAGGCCAGGTGCGG + Intronic
1158478252 18:57799418-57799440 TAAGAAAATGAGGCCGGGTGCGG + Intronic
1158720202 18:59917875-59917897 TAGAGACAGGAGGCCAGGTGCGG + Intergenic
1158892017 18:61881200-61881222 GAGAGAGAGAAGGCCGGGTGCGG - Intronic
1158970895 18:62665449-62665471 TATGCAGAGTTGGCCGGGCGTGG + Intergenic
1158977657 18:62726935-62726957 TAGGAAGGAGAGGCCGGGTGCGG + Intronic
1159038664 18:63302031-63302053 AAAAGAGAGGAGGCCAGGTGTGG + Intronic
1159556933 18:69955575-69955597 TTTCCACAGGAGGCCGGGTGCGG + Intronic
1160715699 19:575607-575629 GGTGGGGAGGAGGGCGGGTGGGG + Intronic
1160724706 19:612968-612990 GGTGGAAAGGAGGCCGGGTGCGG - Intronic
1160753825 19:747643-747665 GATGGAGAAGAGGCCGGGGGCGG - Exonic
1160860261 19:1234593-1234615 TTGGGAGAGGTGGCCGGGTGGGG + Exonic
1160867503 19:1262375-1262397 CTGGGAGAGGAGGGCGGGTGGGG - Intronic
1160904458 19:1445921-1445943 GGCGGGGAGGAGGCCGGGTGGGG - Intergenic
1160939941 19:1615522-1615544 TATGGGGAGGGCGCCGGGAGGGG + Intronic
1160964033 19:1737927-1737949 AATGAGGATGAGGCCGGGTGCGG + Intergenic
1161017070 19:1988302-1988324 TAGGGAGGGGAGGCCAGGAGGGG + Intronic
1161020680 19:2009861-2009883 AAAGGAGGGGAGGCCAGGTGCGG + Intronic
1161349574 19:3784451-3784473 TCTGCAGAGGGGGCCGGGAGAGG + Exonic
1161492995 19:4572564-4572586 AGTGGAGGGGAGGCCGGGCGCGG - Intergenic
1161649669 19:5476708-5476730 AAAGGAGAGGCGGCCGGGTGCGG + Intergenic
1161706196 19:5823124-5823146 GAGAGAGAGGAGGCTGGGTGCGG + Intergenic
1161845336 19:6708975-6708997 TTTGGAATGGAGGCCAGGTGCGG - Intronic
1162110518 19:8397415-8397437 TGAGGAGAGGAGTCGGGGTGTGG + Intronic
1162527010 19:11211954-11211976 TATGAAGGGGAGGCGGGGCGGGG + Intronic
1162941791 19:14014863-14014885 AAAGTAGATGAGGCCGGGTGCGG + Intergenic
1163034998 19:14564989-14565011 TGTGGTAAGGAGGCTGGGTGTGG + Exonic
1163041389 19:14605384-14605406 TGTGGGGAGGTGGCCGGGCGCGG - Intronic
1163264920 19:16214640-16214662 TATGAAAAGAAGGCCGGGTGTGG - Intronic
1163306571 19:16483359-16483381 TATGGAGAGGAGCAGCGGTGTGG + Intronic
1163355375 19:16807201-16807223 TATGAACACCAGGCCGGGTGTGG + Intronic
1163557944 19:18002810-18002832 ACTGGAGAGGCAGCCGGGTGCGG + Intronic
1163575215 19:18107104-18107126 TAGCCAGAGTAGGCCGGGTGCGG - Intronic
1163630388 19:18415375-18415397 CCTGCAGAGGAGGCCGGGTTGGG - Intergenic
1163689901 19:18732798-18732820 TAACTACAGGAGGCCGGGTGTGG + Intronic
1163766466 19:19166023-19166045 TATGTAAATGAGGCGGGGTGTGG - Intronic
1163921183 19:20290388-20290410 AAAGGAGAAGAGGCCGGGCGCGG - Intergenic
1164578594 19:29420601-29420623 GGTGGAGAGGAGGCCGGGGGAGG - Intergenic
1164578605 19:29420650-29420672 GGTGGAGACGAGGCCGGGGGAGG - Intergenic
1164578623 19:29420748-29420770 GGTGGAGAGGAGGCCGGGGGAGG - Intergenic
1164578634 19:29420797-29420819 GGTGGAGAGGAGGCCGGGGGAGG - Intergenic
1164578644 19:29420834-29420856 GGTGGAGAGGAGGCTGGGGGAGG - Intergenic
1164578655 19:29420883-29420905 GGTGGAGATGAGGCCGGGGGAGG - Intergenic
1164578665 19:29420932-29420954 GGTGGAGAGGAGGCCGGGGAAGG - Intergenic
1164578675 19:29420981-29421003 GGTGGAGACGAGGCCGGGGGAGG - Intergenic
1164578685 19:29421030-29421052 GGTGGAGACGAGGCCGGGGGAGG - Intergenic
1164968492 19:32509342-32509364 TATGAACAACAGGCCGGGTGCGG - Intergenic
1165034680 19:33024143-33024165 ACTGCACAGGAGGCCGGGTGTGG + Intronic
1165043118 19:33082946-33082968 AATAGAGATGAGGCCGGGCGTGG + Intronic
1165077239 19:33286696-33286718 AAGGCAGAGAAGGCCGGGTGCGG - Intergenic
1165133057 19:33645219-33645241 GCTGGAGATGAGGCCGTGTGGGG + Intronic
1165309434 19:35021607-35021629 TAGGGACAGAAGGCCGGCTGGGG + Intronic
1165434880 19:35790237-35790259 TGTGGACCGGAGGCTGGGTGTGG + Intergenic
1165635522 19:37336588-37336610 TATGCATAGGTAGCCGGGTGTGG - Intronic
1165758462 19:38307528-38307550 GAGGGAGAGGAGGCTGTGTGAGG + Intronic
1165793355 19:38505281-38505303 GATGGAGGGGAGGCAGGGTGAGG - Intronic
1165799334 19:38537957-38537979 AATGGTGAGGAGGAGGGGTGTGG + Exonic
1165844992 19:38812519-38812541 TCTGGAGAAGAGGCCTGGTGAGG + Exonic
1166703202 19:44893937-44893959 TGTGGAGAGGAGGGGGTGTGAGG - Intronic
1166907296 19:46120180-46120202 TTTGGAGAGGAGCCCAGCTGGGG - Exonic
1166914095 19:46182798-46182820 TAGGGAGAGGAGGCAGGGAAAGG - Intergenic
1166986602 19:46663803-46663825 AATGCAAATGAGGCCGGGTGGGG + Intergenic
1167103097 19:47416184-47416206 CAAGGAGAGGAGGCTGGGTGCGG - Intronic
1167214880 19:48157834-48157856 TATGGAGAGAAGGCTGGGCACGG - Intronic
1167261550 19:48461791-48461813 GATGAAGAGGAGGCCGGGCCCGG + Exonic
1167421781 19:49408202-49408224 TAAGGAGGGGAGGCTGGGTGTGG - Intronic
1167625872 19:50588810-50588832 TAGGGAAAGTAGGCCGGGCGCGG + Intergenic
1167859009 19:52268171-52268193 TAGGGATATAAGGCCGGGTGCGG + Intergenic
1168065699 19:53919121-53919143 CATGGTGAGGAGGCTGGGTTGGG - Intronic
1168110621 19:54189674-54189696 TCTGGAAAGGAGGCGGGGTCTGG + Exonic
1168711474 19:58502914-58502936 GATGGATAGGTGGCTGGGTGAGG + Intronic
925236852 2:2286270-2286292 AATGAAGAACAGGCCGGGTGTGG - Intronic
925315867 2:2922598-2922620 AATGAAGATGAGGCCGGGTGCGG + Intergenic
925404729 2:3598687-3598709 TGTGGAGAGGAGGCTGGAGGCGG + Intronic
925404741 2:3598725-3598747 TGTGGAGAGGAGGCTGGAGGCGG + Intronic
925784797 2:7421568-7421590 AATGGAGAGAAGGCAGGGTATGG - Intergenic
925968988 2:9093954-9093976 GGGGGAGAGGAGGCTGGGTGGGG - Intergenic
926057999 2:9787370-9787392 TATGGAGGGCAGGCAGGTTGGGG + Intergenic
926911268 2:17853620-17853642 CCTGGAGAGGAGGACAGGTGTGG - Intergenic
927041303 2:19233091-19233113 TAGGAACAGGAGGTCGGGTGTGG - Intergenic
927419783 2:22918445-22918467 GATAGAGATTAGGCCGGGTGTGG + Intergenic
927549941 2:23989541-23989563 TATAGAAATAAGGCCGGGTGTGG - Intronic
927886794 2:26723773-26723795 CAGGGAGAGGAGGCTGGGAGAGG + Intronic
928074663 2:28253111-28253133 TATGGAGTGAAGGCTGAGTGCGG + Intronic
928650377 2:33397810-33397832 GATGGAGAAGAGGCCAGGCGTGG - Intronic
928667708 2:33567277-33567299 TATGGAGTATAGGCCGGGTGCGG + Intergenic
929032724 2:37663882-37663904 CAGGCAGAGGAGGCCGGGCGCGG + Intronic
929833184 2:45366769-45366791 AAAGAAGAGCAGGCCGGGTGCGG - Intergenic
930097288 2:47574939-47574961 TATCCCAAGGAGGCCGGGTGCGG + Intergenic
930330658 2:49979006-49979028 TAGGGGAAGGAGGTCGGGTGCGG + Intronic
930478077 2:51910734-51910756 AAAAGCGAGGAGGCCGGGTGCGG + Intergenic
930808447 2:55516636-55516658 TATGTATAACAGGCCGGGTGCGG - Intergenic
930864719 2:56111176-56111198 TATGGAAGGCAGGCCGGGCGTGG - Intergenic
931265122 2:60653745-60653767 TGTGGAGAGGAGGAGGGTTGGGG - Intergenic
931367313 2:61629990-61630012 TTTGAAGTGGAGGCGGGGTGAGG + Intergenic
932932297 2:76056591-76056613 TAAGTTCAGGAGGCCGGGTGTGG - Intergenic
933676190 2:85059922-85059944 TATAGAAATGAGGCCAGGTGTGG - Intergenic
933871670 2:86572536-86572558 CATGGAGAAGAGGCCATGTGTGG - Intronic
933991978 2:87640366-87640388 TATGGAGGTGATGCCGGGGGCGG - Intergenic
934554372 2:95279583-95279605 TATGCAGAAGCGGCCGGGCGCGG - Intronic
935551550 2:104463023-104463045 TACAGACAGGAGGCAGGGTGGGG - Intergenic
935690644 2:105728296-105728318 AATGGAAAGCAGCCCGGGTGCGG - Intergenic
935761772 2:106327530-106327552 AATGCACAGGGGGCCGGGTGCGG + Intergenic
936008957 2:108912551-108912573 TAGGGAGGTGAGGCCAGGTGGGG + Intronic
936301865 2:111310452-111310474 TATGGAGGTGATGCCGGGGGCGG + Intergenic
936697267 2:114965686-114965708 GATAAAGAGGAGGCCGGGCGCGG + Intronic
936915189 2:117633063-117633085 AATTGAGATGAGGCTGGGTGCGG - Intergenic
937409714 2:121663171-121663193 TGTGTAAATGAGGCCGGGTGTGG + Intergenic
937788841 2:125935293-125935315 AAGGCAGGGGAGGCCGGGTGTGG + Intergenic
938115106 2:128597202-128597224 CCAGGAGAGGAGGCAGGGTGAGG + Intergenic
938342047 2:130542054-130542076 GAGGGAGAGGAGGCCGGGCACGG + Intronic
938347785 2:130578657-130578679 GAGGGAGAGGAGGCCGGGCACGG - Intronic
938853367 2:135284759-135284781 TAAGGAAAGGTGGCCGGGTGCGG - Intronic
939380126 2:141424400-141424422 TAAGAAGATGAGGCCGGGTGCGG - Intronic
939669736 2:144995449-144995471 TAAGGGGAAAAGGCCGGGTGTGG - Intergenic
939990878 2:148875921-148875943 GGTGGAGAGGCGGCCGGGAGCGG + Intronic
940767873 2:157809527-157809549 CAGGGAGAGGAGGCAGGGAGAGG + Intronic
941821738 2:169850467-169850489 GATCCAGAGCAGGCCGGGTGCGG - Intronic
941945959 2:171097632-171097654 TAAGAATAGGCGGCCGGGTGTGG + Intronic
943749345 2:191495072-191495094 TGTGGAGAGGAGACTGTGTGGGG + Intergenic
943752042 2:191519635-191519657 TATGAAGCTCAGGCCGGGTGTGG - Intergenic
944238032 2:197457910-197457932 AATGTAATGGAGGCCGGGTGCGG - Intronic
944239053 2:197468148-197468170 TAGTCAGAGGAGGCCGGGTGTGG + Intronic
944245855 2:197529940-197529962 TAAGGCCAGGAGGCCAGGTGGGG - Intronic
944743324 2:202633492-202633514 CCTAGAGAGGAGGCCGGGTGTGG - Intergenic
944809957 2:203318290-203318312 TAAAGAGAAAAGGCCGGGTGTGG + Intergenic
945330918 2:208538057-208538079 GAGAGAGAGGAGGCCGGGCGCGG + Intronic
946281737 2:218670880-218670902 AATGAAAAGGAGGCCGGGTGTGG + Intronic
946634001 2:221704561-221704583 TATGGAGAGGGAGCAAGGTGTGG - Intergenic
946725129 2:222654906-222654928 TATGGGGTGGGGGCCGGGCGCGG + Intronic
947457448 2:230268231-230268253 TAGACAGAAGAGGCCGGGTGTGG + Intronic
947935115 2:233997831-233997853 TAGGGAGTGGTGGCTGGGTGGGG - Intronic
948389935 2:237604712-237604734 AATGGAGAAACGGCCGGGTGTGG + Intergenic
1169038089 20:2470200-2470222 GATGGAGAGGAGGGCGGAGGAGG - Intronic
1169442201 20:5641876-5641898 AAAGGTGAGGAGGCTGGGTGCGG + Intergenic
1170691480 20:18619713-18619735 GCAGGAGAGGAGGCCAGGTGCGG - Intronic
1171201415 20:23245100-23245122 GATGGAGAGGAGTCCGTGAGGGG - Intergenic
1171393947 20:24818981-24819003 AATGGAGAGGAGGAAGGGAGGGG - Intergenic
1172029944 20:31974914-31974936 CAAGGGGAGGAGGCAGGGTGGGG - Intronic
1172180343 20:32999705-32999727 TTTGGAGTGGAGGCTGGGGGTGG - Intronic
1172504658 20:35452710-35452732 TATGAGGAGTCGGCCGGGTGCGG - Intronic
1173502166 20:43561948-43561970 GATGGAGTGGAGGCGGAGTGAGG + Intronic
1173504567 20:43576648-43576670 TTTGGGGTGGGGGCCGGGTGCGG + Intronic
1174413157 20:50349163-50349185 GATGGAGATCCGGCCGGGTGTGG - Intergenic
1174489019 20:50879224-50879246 GATGGAAAGTTGGCCGGGTGAGG + Intronic
1174841219 20:53903112-53903134 GAATGAAAGGAGGCCGGGTGCGG - Intergenic
1175637938 20:60601161-60601183 AATCGAGACCAGGCCGGGTGTGG - Intergenic
1175730710 20:61352005-61352027 TAACTAAAGGAGGCCGGGTGCGG - Intronic
1175893709 20:62326873-62326895 CATGGAGAGCAGGCCGGATGTGG - Exonic
1176138784 20:63536183-63536205 AGTGGGGAGGAGGCCAGGTGAGG - Intronic
1176244636 20:64091566-64091588 TGTCGAGAGCTGGCCGGGTGGGG + Intronic
1176258460 20:64166262-64166284 TGTGCAGAGGAGGCTGGGTCAGG + Intronic
1176363349 21:6016920-6016942 GAGGGAGAGTTGGCCGGGTGTGG + Intergenic
1176600691 21:8791020-8791042 AATTGAAGGGAGGCCGGGTGTGG + Intergenic
1177001515 21:15619340-15619362 GATGAAGATGAGGCTGGGTGCGG - Intergenic
1177365800 21:20133942-20133964 TATGTAAGGGAGGCCGGGTGCGG - Intergenic
1177679511 21:24347556-24347578 TATTGAGAAGAGGCTGGGCGTGG - Intergenic
1178073557 21:28994819-28994841 TACAGAGAATAGGCCGGGTGCGG + Intergenic
1178138569 21:29656071-29656093 TGAAGAGAGAAGGCCGGGTGCGG + Intronic
1178320424 21:31600974-31600996 AAAAGAGAAGAGGCCGGGTGTGG + Intergenic
1178430787 21:32517075-32517097 GATGCAGAGGAGGGTGGGTGTGG + Intergenic
1178463586 21:32825919-32825941 GAGGGAGAGGAGGCTGGGCGCGG + Intergenic
1178897687 21:36573009-36573031 ATTGGAGGGGAGGCCGGGCGTGG + Intronic
1179196873 21:39172204-39172226 AAAGGAGAGCAGGCAGGGTGGGG + Intergenic
1179242367 21:39603558-39603580 GGGGGAGAGGAGGCTGGGTGTGG + Intronic
1179480126 21:41671688-41671710 TTTGGAGAGGAGGCAGGGAAGGG + Intergenic
1179514055 21:41894381-41894403 TTTGGAGAGGTGGCTGGCTGGGG + Intronic
1179572547 21:42286535-42286557 GATGGAGAGGAGACAGGGCGAGG + Intronic
1179760169 21:43521625-43521647 GAGGGAGAGTTGGCCGGGTGTGG - Intergenic
1180094520 21:45549787-45549809 TGTGGGGAGGAGGACAGGTGGGG + Intergenic
1180627569 22:17204324-17204346 TAAGAAGAGGAGGCCAGGCGTGG + Intronic
1180701455 22:17783582-17783604 TAGGGGGAGGAGGCTGGGGGTGG + Intergenic
1180795050 22:18599267-18599289 AATAGAGATGAGGCCGGGTGTGG + Intergenic
1181163407 22:20970891-20970913 AATGGAGAGAAGGCCAGGTGTGG - Intronic
1181226688 22:21396049-21396071 AATAGAGATGAGGCCGGGTGTGG - Intergenic
1181251961 22:21538803-21538825 AATAGAGATGAGGCCGGGTGTGG + Intergenic
1181541944 22:23578367-23578389 CAAGGAGCGGGGGCCGGGTGAGG - Intronic
1181613684 22:24036967-24036989 CATGGAAACCAGGCCGGGTGCGG + Intronic
1182008673 22:26982326-26982348 AAAGGAGAGCTGGCCGGGTGCGG + Intergenic
1182165615 22:28170195-28170217 AATGGAAATTAGGCCGGGTGCGG + Intronic
1182183630 22:28378049-28378071 AATGCAGAGGGGGCCAGGTGAGG + Intronic
1182536502 22:31007756-31007778 TAAGAAGAGGAGGCCGGGTGTGG + Intergenic
1182619971 22:31613551-31613573 TGTGGGGAGCAGGCAGGGTGTGG + Intronic
1183022693 22:35039928-35039950 GATGGAGAGGAGCCAGAGTGAGG - Intergenic
1183149351 22:36025972-36025994 AATGTATAGAAGGCCGGGTGTGG + Intronic
1183259092 22:36782701-36782723 TATGGAGTGGGGGCCGGGGAAGG - Intergenic
1183273584 22:36877425-36877447 AAGGGAGAAGAGGCTGGGTGCGG - Intronic
1183346839 22:37312727-37312749 TAGGGAGGGGTGGCTGGGTGAGG + Intronic
1183745242 22:39688098-39688120 GAGGGAGAGGGGGCCGGGAGGGG + Exonic
1183961384 22:41413775-41413797 TGTGGAGAGGAGCCGGGGTGGGG - Intergenic
1184047774 22:41982216-41982238 CTTTGAGAGAAGGCCGGGTGTGG + Intronic
1184686393 22:46098298-46098320 GATGGTGAGGAGGCTGGGTGCGG - Intronic
1184862740 22:47183909-47183931 TAGGGGGATGAGGCCGGGTATGG + Intergenic
1184932427 22:47691287-47691309 TCAGGACAGGAGGCTGGGTGGGG - Intergenic
1184955840 22:47885455-47885477 GATGGAGAGGAGCCTGGGGGTGG - Intergenic
1185326090 22:50226538-50226560 GATGGAGTGGGGGCAGGGTGGGG + Intronic
1185326102 22:50226563-50226585 TGTGGAGTGGGGGCAGGGTGGGG + Intronic
1203296224 22_KI270736v1_random:45301-45323 TGTGGTGGGGAGGCCGGGGGAGG - Intergenic
949105506 3:197164-197186 TATGGAAAGGAAGCGGGGCGCGG + Intronic
949519584 3:4837583-4837605 TATGGATAGGAAGCAGGATGCGG + Intronic
950098915 3:10345585-10345607 CAGGGACAGGAGGCTGGGTGGGG + Intronic
950119657 3:10473339-10473361 TATGAAGAGCAGGCCAGGTGTGG + Intronic
950196784 3:11014944-11014966 TGCGGGGAGGAGGCCGCGTGGGG + Intronic
951103044 3:18711412-18711434 AAAGGAGAGGAGGAGGGGTGGGG - Intergenic
951530354 3:23693141-23693163 TTGGGAGTGGAGGCTGGGTGTGG - Intergenic
952349043 3:32516849-32516871 AATGAAGAGGTGGCCCGGTGTGG + Intergenic
952651246 3:35729346-35729368 TCTGGAGAGGTGGATGGGTGCGG - Exonic
954259489 3:49428429-49428451 TGGGGAGGGGTGGCCGGGTGCGG + Intronic
954409579 3:50364613-50364635 AAAGGCGAAGAGGCCGGGTGAGG + Intronic
954606984 3:51919696-51919718 TATACAGATGAGGCCGGGTGCGG + Intergenic
954669226 3:52279182-52279204 TAAGAAAACGAGGCCGGGTGCGG - Intronic
955014799 3:55059842-55059864 GTTGGAGAGGAGAACGGGTGTGG - Intronic
955189538 3:56747545-56747567 TAAAGAGACTAGGCCGGGTGCGG + Intronic
955315239 3:57933131-57933153 TATGAAAAAGACGCCGGGTGTGG + Intergenic
955677361 3:61462876-61462898 TAGGGACAAGAGGCCGGGTGCGG + Intergenic
956214913 3:66838748-66838770 TAAAGAAAGGGGGCCGGGTGCGG - Intergenic
956258833 3:67314507-67314529 TATGAGGAAGAGGCAGGGTGAGG - Intergenic
956446877 3:69334340-69334362 AATGGTGGGGAGGCCAGGTGCGG + Intronic
956465587 3:69517701-69517723 TCTGAAGAAGAGGCTGGGTGGGG - Intronic
956606502 3:71078120-71078142 TATACAGAGGAGGCCGGGCGGGG - Intronic
956863024 3:73342892-73342914 TATGGAAATAAGGCCGGGCGCGG - Intergenic
957529685 3:81425349-81425371 TATTTCCAGGAGGCCGGGTGTGG + Intergenic
959155692 3:102663961-102663983 TATGGAGAGGAGTTTGGCTGGGG + Intergenic
960328886 3:116332128-116332150 AATAGAGTGAAGGCCGGGTGTGG - Intronic
961434784 3:126909408-126909430 CATGGTGAGGAGGCCGGGGAAGG - Intronic
961514806 3:127425849-127425871 GATGCAGAAGGGGCCGGGTGAGG + Intergenic
962443854 3:135447999-135448021 GATGGCTAGGAGGCCGAGTGGGG - Intergenic
962459092 3:135592106-135592128 TCTGGAGAGCAGGCTGTGTGGGG - Intergenic
962668036 3:137675801-137675823 TGGGGAGAAGAGGCCAGGTGTGG + Intergenic
962743540 3:138381061-138381083 AACGGAGAGAAGGCCGGGCGTGG - Intronic
962756697 3:138470287-138470309 TAAGGAGATGAGGCCTTGTGGGG - Intronic
963084749 3:141426517-141426539 GGAGGAGAGGAGGCCGGGGGAGG + Intronic
964616999 3:158676988-158677010 AATGGAGGTGAGGCCGGGCGTGG - Intronic
965472301 3:169109704-169109726 TACTTAGAAGAGGCCGGGTGCGG - Intronic
966163750 3:176993968-176993990 AATGGAGCTGAGGCCGGGTGCGG - Intergenic
966402947 3:179565155-179565177 TATGTAGAAGGGGCCGGGTGCGG + Intronic
966780759 3:183582050-183582072 AATGGAAAGGGGGCCAGGTGTGG + Intergenic
966844217 3:184114473-184114495 TATTCAGGGCAGGCCGGGTGCGG + Intergenic
966880066 3:184345127-184345149 TTTGGAGAGGAGGCAGGGGCTGG + Exonic
966941019 3:184747111-184747133 AAAGAAGATGAGGCCGGGTGCGG + Intergenic
966951712 3:184825609-184825631 TCTGGAAAGTAGGCCGGGCGTGG + Intronic
967347583 3:188475610-188475632 TATGAAAAGCAGGCCGGGCGTGG + Intronic
967594670 3:191315301-191315323 TTTGTAGAGTAGGCCGGGCGTGG - Intronic
967865406 3:194186186-194186208 AGTGGAGAGGAGGCTGGGTGTGG + Intergenic
967963286 3:194941953-194941975 GGTGGAGAGGAGGCCTGGAGGGG - Intergenic
968061655 3:195730638-195730660 TGGGGAGAGGGGGCCGGGTGCGG - Intronic
968096419 3:195933820-195933842 GAAGGACGGGAGGCCGGGTGCGG + Intergenic
968363562 3:198167141-198167163 TATAGATAGCAGGCCAGGTGTGG - Intergenic
968539105 4:1154105-1154127 TGTCGAGGGGAGGCTGGGTGCGG + Intergenic
968823763 4:2877675-2877697 AATCAAGAGGGGGCCGGGTGTGG + Intronic
969010763 4:4060257-4060279 AAAGAAGAGGAGGCTGGGTGTGG - Intergenic
969185091 4:5468770-5468792 TATCTAGAGGAGGCCGGGCGCGG + Intronic
969684103 4:8659951-8659973 TATGAAAATTAGGCCGGGTGCGG - Intergenic
970067525 4:12116062-12116084 TTTGGAGAGATGGCTGGGTGTGG + Intergenic
970127902 4:12834902-12834924 TATGAGAAGGAGGCCGGGTGTGG - Intergenic
970349880 4:15191806-15191828 TATGCATAGGAGGCCGGGCGCGG + Intergenic
970798121 4:19939371-19939393 TATGAAGACTGGGCCGGGTGCGG + Intergenic
971161950 4:24142380-24142402 AATGGGGAGGGGGCTGGGTGCGG + Intergenic
971715135 4:30166356-30166378 TACTGAGAGCAGGCCGGGCGTGG + Intergenic
972163375 4:36252958-36252980 AATGGATTGGAGGCTGGGTGGGG + Intergenic
972417811 4:38859854-38859876 AATGGTGAAGAGGCCGGGCGGGG - Intergenic
972634553 4:40871433-40871455 AAAGGAGTTGAGGCCGGGTGCGG - Intronic
972644874 4:40957872-40957894 TATGAGGTGGAGGCCGGGTGTGG - Intronic
972812885 4:42609779-42609801 TATGGAGAGGTGGCAAGGAGAGG - Intronic
972852588 4:43069215-43069237 TAAGGAGAGGAGGCAGCTTGTGG + Intergenic
972879766 4:43409047-43409069 AATGCAGAGGAGGCCGGGAGTGG + Intergenic
973313353 4:48732983-48733005 TAGTGAGAAAAGGCCGGGTGTGG + Intronic
973330663 4:48907421-48907443 TATAGAAAACAGGCCGGGTGCGG + Intergenic
973559233 4:52117874-52117896 AAGGGAGAGGAGGCCGAGTGCGG + Intergenic
973816190 4:54621606-54621628 TATGGACTGCAGGCCAGGTGCGG - Intergenic
973830683 4:54756049-54756071 AAAGGGGAGGAGGCCGGGCGCGG - Intergenic
974258822 4:59498057-59498079 TGTGAGAAGGAGGCCGGGTGCGG + Intergenic
974676388 4:65095072-65095094 AATGGTTGGGAGGCCGGGTGTGG + Intergenic
975613234 4:76221608-76221630 AATGGGGAATAGGCCGGGTGCGG - Intronic
976042042 4:80898322-80898344 TTTGGAGAGGAGTCTGGCTGGGG - Intronic
978340181 4:107714263-107714285 TATGGTGAGGGAGCAGGGTGGGG - Intronic
978520733 4:109612554-109612576 TAAGAGGAGGAGGCTGGGTGTGG - Intronic
978600057 4:110418643-110418665 TAAGAAGATTAGGCCGGGTGGGG + Intronic
979480788 4:121214530-121214552 TATGGAGAGGTGGCCGGGTGAGG + Intronic
979486491 4:121276541-121276563 TATGGAGAGAAGGGAGGGTATGG - Intergenic
979499463 4:121422590-121422612 TCACGAGAGGAGGCCGGGTGCGG - Intergenic
980246587 4:130253127-130253149 TAAAGAGATGAGGCTGGGTGTGG + Intergenic
980496549 4:133592326-133592348 TTTGGAGAGGAGGCCAGCTGGGG + Intergenic
980643858 4:135616247-135616269 GAAGAAGATGAGGCCGGGTGTGG - Intergenic
980932181 4:139192518-139192540 AAGGGAGAGTAGGCCGGGCGCGG - Intergenic
980933342 4:139202696-139202718 TAGTGAAAGGAGGCCGGGCGAGG + Intergenic
981075296 4:140585414-140585436 GCAGGAGAGCAGGCCGGGTGAGG - Intergenic
981781812 4:148439574-148439596 TTTGGAGAGGGGTCTGGGTGGGG - Intronic
983216675 4:165008403-165008425 GAAGGAGAGGAAGCCTGGTGGGG - Intergenic
983566897 4:169162934-169162956 TAAGGAGAGGATGGAGGGTGTGG - Intronic
983961996 4:173765868-173765890 TATGGAGTGGAGTGGGGGTGCGG - Intergenic
984037218 4:174684666-174684688 TAGAGAGAGGAGGCACGGTGTGG + Intronic
984049516 4:174846301-174846323 AATGTAAAGGAGGCCGGGCGCGG - Intronic
984102536 4:175502535-175502557 TTATGAGAGGAGGCCGGGCGCGG - Intergenic
984579862 4:181499683-181499705 GATGGAAAGGAAGCTGGGTGGGG + Intergenic
985049688 4:185976753-185976775 AATGGAAAAGAGGCCAGGTGCGG + Intergenic
985281717 4:188293571-188293593 TAGAGAGAGGAGGCCGGGTACGG + Intergenic
985731080 5:1549258-1549280 TGGGGAGAGGACGCCGGGTGGGG + Intergenic
985776682 5:1847991-1848013 TGTTGGGAGGAGGCTGGGTGTGG + Intergenic
985898256 5:2763543-2763565 TCTGGAGAGGAGGCCAGGAGAGG - Intergenic
986406636 5:7432125-7432147 TTTGGAGAGGAGTCCGGCTGGGG + Intronic
986529398 5:8720100-8720122 TATAGAGAGGCAGCCGGGTGCGG + Intergenic
986607860 5:9540297-9540319 TATGGAGAGAAGGCCGGGCGCGG + Intronic
987139209 5:14928452-14928474 AAAGTAGATGAGGCCGGGTGTGG + Intergenic
987875182 5:23672573-23672595 TTTGGAAAGCAGGCCGGGCGCGG + Intergenic
987926016 5:24342874-24342896 TATAAAGATGGGGCCGGGTGCGG + Intergenic
988882016 5:35514395-35514417 TGTGGAGAAGAGGCCAGCTGTGG + Intergenic
988983663 5:36596404-36596426 TAAGGAAAGGAGGCCTGCTGAGG - Intergenic
989231802 5:39095572-39095594 AATGTATAAGAGGCCGGGTGTGG + Intergenic
989802647 5:45563157-45563179 TATATAGTGAAGGCCGGGTGCGG + Intronic
989962248 5:50430177-50430199 TATGGACAGGAAGCCAGGCGGGG + Intronic
990467550 5:56084162-56084184 TAGGGAGATGAGGCTGGGCGCGG - Intergenic
990805295 5:59653913-59653935 AAGGGAGGGGAGGCCAGGTGTGG + Intronic
990936662 5:61157586-61157608 TAAGCACAGGAGGCCGGGTGCGG - Intergenic
990963472 5:61419110-61419132 TATAAAGAGGAGGCCGGGCGTGG - Intronic
992224244 5:74604047-74604069 TAGGGAGTAGAGGCTGGGTGCGG + Intergenic
994891260 5:105639580-105639602 CATGGGAAGGAGGCCGAGTGGGG + Intergenic
994985790 5:106932231-106932253 TATGGTGAGGGGGCCTGGAGTGG - Intergenic
995576890 5:113546028-113546050 AATGGAGATCAGGCCGGGCGCGG - Intronic
995580785 5:113599814-113599836 AACGCAGATGAGGCCGGGTGTGG + Intergenic
996131841 5:119790930-119790952 TATGGAGAGGATTCTGGGTTGGG - Intergenic
996472531 5:123877169-123877191 CCTGGAGTGGAGGCCGGGAGGGG - Intergenic
996555737 5:124777339-124777361 TATCTAGAGAAGGCCGGGTGTGG + Intergenic
997013292 5:129904247-129904269 TCCGGAGAGGAGGCCGGCTCTGG + Intergenic
997367405 5:133334868-133334890 TCTGGGGAGGAGGCTGGGTGGGG + Intronic
997822453 5:137078353-137078375 CATGGAGAGGAGGCTTAGTGTGG - Intronic
997991269 5:138546048-138546070 AAGGAAGAGGAGGCCAGGTGTGG - Intergenic
998156989 5:139792557-139792579 TCAGGTGAGGAGGCGGGGTGGGG + Intergenic
998510251 5:142707117-142707139 ACTGGAGAGATGGCCGGGTGTGG - Intergenic
999450518 5:151674302-151674324 AAAACAGAGGAGGCCGGGTGCGG - Intronic
999790927 5:154938590-154938612 TATGCACAAGAGGCCGGGTGCGG + Intergenic
999851221 5:155541650-155541672 TTTGGAGAGGAGTCCGGCTGGGG + Intergenic
1000023533 5:157339270-157339292 TGTGCAGAGGGGGCCGGGTGGGG + Intronic
1000190907 5:158909646-158909668 GAAGGAGGGGAGGCCGGGTGCGG + Intronic
1000387343 5:160687471-160687493 TATGTATTGGTGGCCGGGTGTGG + Intronic
1001050022 5:168406649-168406671 TAGGGAGAGTCGGCCGGGCGCGG + Intronic
1001587842 5:172845285-172845307 GCTGGAGAGGAGGCCGGGCCTGG + Intronic
1002276318 5:178106636-178106658 GATGGTTAAGAGGCCGGGTGTGG - Intergenic
1002282102 5:178137125-178137147 GATGGAGAGCAGGCCAGGTGAGG + Intronic
1002625484 5:180525244-180525266 TTTGAAAAGTAGGCCGGGTGCGG + Intronic
1002968535 6:1991358-1991380 TGTGGGGAGTAGGCCAGGTGCGG - Intronic
1003661667 6:8068005-8068027 TTTGGAAATGCGGCCGGGTGCGG + Intronic
1004105232 6:12661217-12661239 AATGGAGAAGAGGCCGGGCGCGG - Intergenic
1004239035 6:13902173-13902195 TCTGTAGTAGAGGCCGGGTGCGG + Intergenic
1005083369 6:21979905-21979927 AATGGATATGAGGCCAGGTGCGG - Intergenic
1005235803 6:23760977-23760999 TTGGGAGAGTTGGCCGGGTGTGG + Intergenic
1005572311 6:27157255-27157277 TAAAGAGAAGAGGCCGGGCGCGG + Intergenic
1005642795 6:27812860-27812882 TATGGACAACAGGCCGGGCGCGG + Intergenic
1005925003 6:30436274-30436296 CATGGAGAGGGGGCTGGGAGAGG + Intergenic
1006402223 6:33824591-33824613 TAGGGCCAGGAGGCTGGGTGCGG + Intergenic
1006470083 6:34223818-34223840 TCTTGAGAGGAGGCCAGGGGAGG - Intergenic
1006856686 6:37138451-37138473 TGTGTGGGGGAGGCCGGGTGCGG + Intergenic
1007154146 6:39725506-39725528 TAGGGAGGGGAGGGCGGGGGTGG + Intergenic
1007385537 6:41518044-41518066 TATGAGGAGGAGGCTGGGGGTGG - Intergenic
1007502252 6:42307283-42307305 TGAGGGGAGGAGGCCGTGTGGGG - Intronic
1007511390 6:42376829-42376851 TAGCTAGAGGAGGCCAGGTGCGG - Intronic
1007989773 6:46243134-46243156 CATGGGGAGGAGGAAGGGTGTGG + Intronic
1008124240 6:47650571-47650593 TATGGAGGGGAGGAGGGATGAGG + Intergenic
1008697355 6:54055174-54055196 GATAGTGATGAGGCCGGGTGCGG - Intronic
1008881964 6:56389070-56389092 TATGCAAAGGAGGCTGGGCGTGG + Intronic
1009581505 6:65540626-65540648 TAGAGAAAGGTGGCCGGGTGCGG + Intronic
1010145486 6:72664361-72664383 TTTGGAAATCAGGCCGGGTGCGG + Intronic
1010149862 6:72718737-72718759 GATGGAGCAGAGGCTGGGTGCGG - Intronic
1010159690 6:72838658-72838680 TATGGAGCTGAGGCCGGGCGCGG + Intronic
1010169780 6:72961324-72961346 AGTGGACTGGAGGCCGGGTGCGG + Intronic
1011272323 6:85592697-85592719 TATAGGGATGTGGCCGGGTGCGG + Intronic
1011603736 6:89081830-89081852 GAAGGAGGCGAGGCCGGGTGGGG + Intronic
1011664382 6:89620773-89620795 AATAAAGACGAGGCCGGGTGCGG + Intronic
1012503422 6:99916252-99916274 TGAGGAGAGGAGGCCCGGCGTGG + Intergenic
1013390800 6:109684582-109684604 TAGGCAAAGGAGGCCGGGCGCGG + Intronic
1013557476 6:111271083-111271105 AATGCAGTTGAGGCCGGGTGCGG + Exonic
1014820089 6:125979461-125979483 TAGGTAAAGTAGGCCGGGTGTGG + Exonic
1016959240 6:149655660-149655682 TATGTAGGGAAGGCTGGGTGCGG - Intergenic
1017121359 6:151027117-151027139 AAAGGACAGGAGGCCTGGTGCGG - Intronic
1017457354 6:154613751-154613773 TATGGTGGGGTGGCAGGGTGGGG + Intergenic
1017807472 6:157958180-157958202 TACTGAAAGGAGGCCAGGTGTGG - Intergenic
1017833637 6:158155852-158155874 AATAGAGATTAGGCCGGGTGCGG + Intronic
1019229832 6:170550844-170550866 AAAGGAGAGGAGGCCGGGCACGG + Intronic
1019252138 7:21542-21564 TATAGATAGCAGGCCAGGTGTGG + Intergenic
1019512598 7:1425562-1425584 TGTGGGCAGGAGGCCAGGTGCGG - Intergenic
1020054343 7:5106893-5106915 TACAGAGGAGAGGCCGGGTGTGG - Intergenic
1020068397 7:5208054-5208076 GTTGGTGAGGAGGCTGGGTGTGG - Intronic
1020174026 7:5868026-5868048 AATGGAAAAGATGCCGGGTGCGG - Intergenic
1020404469 7:7816449-7816471 TGTAGAGATGAGGCCGGGAGAGG + Intronic
1020447752 7:8286713-8286735 TAAAGAAAAGAGGCCGGGTGCGG - Intergenic
1020669105 7:11083748-11083770 TAGGGAAAGCAGGCCAGGTGTGG - Intronic
1021099149 7:16569135-16569157 TAAGGACAGGTGGCCAGGTGCGG + Intronic
1021656152 7:22875799-22875821 AATGCAGAGGAGGCTGGGTGCGG + Intergenic
1021850236 7:24800950-24800972 TTTTTAAAGGAGGCCGGGTGTGG + Intronic
1022021950 7:26408518-26408540 TATAGAGAAGAGGCCGGGTGCGG + Intergenic
1023066343 7:36381378-36381400 TATAGGAAGGAGGCCAGGTGCGG + Intronic
1023710398 7:42986487-42986509 TGTGGAGAGGGGGTGGGGTGGGG - Intergenic
1023751506 7:43377416-43377438 TATTGTGAGGGGGCAGGGTGAGG - Intronic
1023861085 7:44218053-44218075 TATGGAGATAAGGCGGGCTGGGG - Exonic
1024345571 7:48310143-48310165 TATGGAGAGCATGCTGGCTGGGG + Intronic
1024539286 7:50463056-50463078 AAGGAAGAGAAGGCCGGGTGCGG - Intronic
1024938180 7:54733817-54733839 TATGTTAAGTAGGCCGGGTGCGG - Intergenic
1026069834 7:67108981-67109003 TATACTGATGAGGCCGGGTGCGG + Intronic
1026456616 7:70578118-70578140 TATGGACAAAAGGCCAGGTGCGG - Intronic
1026568639 7:71510654-71510676 AATGGAGAGGAAGCCTGGTAAGG - Intronic
1026683351 7:72487393-72487415 AATAGAGAGGTGGCCAGGTGCGG + Intergenic
1027196911 7:76037072-76037094 TAAGAAGAGCTGGCCGGGTGCGG - Intronic
1027229125 7:76261958-76261980 CATGGATAGGAGGCAGGGTCGGG + Intronic
1027528953 7:79306008-79306030 TTTGGAGACGAGGCAGGGTGGGG + Intronic
1027583848 7:80032537-80032559 AATAGAGGGGAGGTCGGGTGTGG + Intergenic
1028485558 7:91353651-91353673 TAGGGAGTGGCGGCGGGGTGGGG + Intergenic
1029156634 7:98521910-98521932 TGGGGGGAGGAGGACGGGTGAGG - Intergenic
1029443717 7:100601705-100601727 TGTGAAGTGGAGGCCAGGTGTGG + Intergenic
1029446378 7:100615143-100615165 CATGGTGAGGAGGCCTGGAGGGG - Exonic
1029537330 7:101164152-101164174 AATTGAGAGGGGGCCGGGGGCGG + Exonic
1029983700 7:104902494-104902516 TAGTGAGATTAGGCCGGGTGCGG + Intronic
1030421885 7:109317431-109317453 TTCTGAGATGAGGCCGGGTGTGG + Intergenic
1031028858 7:116713103-116713125 TAAGGAAAAGAGGCCGGGCGCGG + Intronic
1032197446 7:129797560-129797582 TATGGAGAGGAGTCTGGGGAAGG + Intergenic
1032338206 7:131045939-131045961 TAAGAAGTGGAAGCCGGGTGTGG + Intergenic
1032393755 7:131574361-131574383 TATGATGAGAAGGTCGGGTGCGG - Intergenic
1032584132 7:133130834-133130856 TAGGGAGGAGAGGCTGGGTGCGG + Intergenic
1033071765 7:138209509-138209531 TTTGGAGAGGAGTCTGGTTGGGG - Intergenic
1034168770 7:149046435-149046457 TATGGCCAGGAGGCCGGGCACGG - Intergenic
1034358126 7:150470177-150470199 AATGGAGAGGATGCAGGGAGAGG + Intronic
1034533855 7:151714504-151714526 CAGGGAGAGGTGGCAGGGTGTGG - Intronic
1034624851 7:152484776-152484798 AAAGCAGAGTAGGCCGGGTGCGG - Intergenic
1034978891 7:155463359-155463381 TGAGGAGAGGGAGCCGGGTGAGG - Exonic
1035541207 8:439775-439797 TGTGGAAAGGTGGCCAGGTGCGG + Intronic
1035749602 8:1987114-1987136 TCTGAAGAGGAGGCCGGGGACGG - Intronic
1036061352 8:5324974-5324996 TAGGCAGAGCAGGCCGGGCGCGG + Intergenic
1036403789 8:8435152-8435174 GATGCAGTAGAGGCCGGGTGCGG - Intergenic
1036439886 8:8772867-8772889 TATGGAGAGGAGGAGGCGCGGGG - Intergenic
1036677964 8:10850789-10850811 TATGGAGCGGAGGCGGTGGGCGG + Intergenic
1036929774 8:12944389-12944411 TATATAGAAGAGGCCAGGTGTGG + Intergenic
1037611584 8:20480648-20480670 TATGGCTTGGAGGCTGGGTGTGG + Intergenic
1037735445 8:21562176-21562198 CATGTAGAGGAGGCTGGGTGTGG - Intergenic
1037830905 8:22188458-22188480 AATTGAGATGGGGCCGGGTGCGG - Intronic
1037852405 8:22342976-22342998 TAGGTAGATAAGGCCGGGTGTGG + Intronic
1037869001 8:22473754-22473776 AATGGATAAGGGGCCGGGTGTGG - Intronic
1038062383 8:23927658-23927680 AATTGAAAGGAGGCTGGGTGTGG - Intergenic
1038126382 8:24677886-24677908 AATAGAGAAGAGGCTGGGTGTGG + Intergenic
1039599614 8:38824082-38824104 TATGGAGAGATGGCTGGGGGAGG - Intronic
1040417937 8:47212471-47212493 TATTGAGAGACAGCCGGGTGTGG - Intergenic
1041037047 8:53803044-53803066 TAGAGAAAGGAGGCTGGGTGCGG + Intronic
1041722617 8:60989833-60989855 GAGGCAGAGGAGGCTGGGTGCGG + Intergenic
1042262398 8:66872665-66872687 TTTGGTAATGAGGCCGGGTGCGG + Intronic
1042277986 8:67025712-67025734 AAAGGACAGTAGGCCGGGTGCGG + Intronic
1042688255 8:71465330-71465352 AAGGAAGAAGAGGCCGGGTGTGG + Intronic
1043384551 8:79735160-79735182 TATTGGTAGTAGGCCGGGTGCGG - Intergenic
1044357389 8:91239078-91239100 TATATAGATGAGGCCGGGTGTGG + Intronic
1044646864 8:94452785-94452807 TAAGGATAGTAGGCTGGGTGTGG - Intronic
1045015756 8:98000306-98000328 TATGGATAACAGGCCAGGTGCGG + Intronic
1045044250 8:98259363-98259385 TATTTAAAGGAGGCCGGGTGCGG - Intronic
1045265845 8:100618054-100618076 AATGGTGTGGAGGCCGGGCGTGG - Intronic
1045286033 8:100792419-100792441 TATGGTTAAGTGGCCGGGTGTGG + Intergenic
1045446342 8:102268492-102268514 TAGGAAGATAAGGCCGGGTGCGG - Intronic
1045526410 8:102944363-102944385 AATGGAGAACAGGCCGGGTGTGG + Intronic
1045867300 8:106882506-106882528 AAAGGAGACCAGGCCGGGTGCGG - Intergenic
1046012007 8:108560382-108560404 AAAGGAGAGGCGGCTGGGTGCGG - Intergenic
1046229280 8:111332241-111332263 TAAGGACAGGAGGCTGGGCGTGG - Intergenic
1046644954 8:116776077-116776099 TATGGGGAAGGGGCCAGGTGGGG - Intronic
1046996656 8:120531402-120531424 GAGGAAGAAGAGGCCGGGTGTGG + Intronic
1047731408 8:127731888-127731910 GAAGGAGAGGAGGCTGGGTATGG + Intergenic
1048037318 8:130689500-130689522 CATGGAGAGGAGACCAGGAGAGG - Intergenic
1049200158 8:141336192-141336214 TCTGCAGGGGAGGCCGGGTCCGG - Intergenic
1049201735 8:141343702-141343724 AACAGGGAGGAGGCCGGGTGGGG + Intergenic
1049254319 8:141605715-141605737 GGTGGAGAGGAGCCCGGATGTGG - Intergenic
1049373858 8:142279939-142279961 TGTGAGGAGGAGGCCGGGGGCGG + Intronic
1049434285 8:142579337-142579359 CGTGGCGAGGAGACCGGGTGAGG - Intergenic
1049456098 8:142690110-142690132 TGTGGAGGGGAGGCGGGGGGTGG + Intergenic
1049660191 8:143816295-143816317 TAGGGCGAGGAGGCAGGGTTGGG - Intergenic
1049888793 9:47857-47879 TAATAACAGGAGGCCGGGTGCGG + Intergenic
1050150836 9:2618066-2618088 AAAGTAGAGGAGGCTGGGTGTGG - Intergenic
1050756339 9:9008514-9008536 AATGAAGGGGAGGCCGGGCGCGG - Intronic
1051679542 9:19593384-19593406 TGGGGAGAGGAGGTTGGGTGTGG + Intronic
1053044993 9:34908129-34908151 TACTGTGAAGAGGCCGGGTGTGG - Intergenic
1053191065 9:36069247-36069269 TATGAAGAGCAGGCCGGGTGCGG + Intronic
1053368637 9:37542117-37542139 AAGGGACTGGAGGCCGGGTGTGG - Intronic
1053417928 9:37958522-37958544 TGTGGAGAGGAGGCAGAGTGAGG + Intronic
1053435782 9:38073220-38073242 GAAGTAGATGAGGCCGGGTGCGG - Intergenic
1054947360 9:70810186-70810208 GATGGAGAGGAGGGTGGGGGTGG - Intronic
1056922268 9:90801596-90801618 GGTGTAGAGGAGCCCGGGTGGGG - Intergenic
1056925508 9:90830873-90830895 AAGAAAGAGGAGGCCGGGTGTGG - Intronic
1057077138 9:92143813-92143835 CATGGAGAAGAGCCAGGGTGGGG + Intergenic
1057353743 9:94319435-94319457 GATGGAGAGGAGCCAGGGAGGGG - Intronic
1057477809 9:95418885-95418907 GCTGGGGAGGCGGCCGGGTGCGG - Intergenic
1057654007 9:96938157-96938179 GATGGAGAGGAGCCAGGGAGGGG + Intronic
1058286223 9:103182975-103182997 TATGAAATTGAGGCCGGGTGTGG + Intergenic
1058730539 9:107845808-107845830 AATGGAGGTGAGGCTGGGTGTGG + Intergenic
1058803941 9:108571880-108571902 AATGGAGAGGAGGCCAGGAGCGG + Intergenic
1058815199 9:108676450-108676472 AATGAAAATGAGGCCGGGTGTGG - Intergenic
1059034758 9:110742164-110742186 TTTGGAGACTGGGCCGGGTGCGG + Intronic
1059075668 9:111191305-111191327 GATGAATAGGAGGCCAGGTGAGG + Intergenic
1059475108 9:114540312-114540334 TATGCAAAGGAGGCCGGGTGCGG + Intergenic
1059535608 9:115077478-115077500 TATGATGAGGAGGCCGGGCGTGG - Intronic
1059753851 9:117274058-117274080 TCTGGAGTGGAGGTCTGGTGTGG + Intronic
1059800609 9:117746027-117746049 CATGGACAGGAGGGAGGGTGGGG + Intergenic
1060161807 9:121370858-121370880 AAAGGAGAGGAGGCCGGGCGCGG + Intergenic
1060265232 9:122108235-122108257 GAGAGAGAGGAAGCCGGGTGTGG + Intergenic
1060642178 9:125248332-125248354 TATGAAGAGCTGGCCGGGCGCGG + Intergenic
1060657367 9:125381123-125381145 TCTGGAGAGCAGGCCAGCTGGGG + Intergenic
1060725383 9:126002673-126002695 CATGGGGAGGAGGCCAGGGGAGG + Intergenic
1061177178 9:129004791-129004813 AAAGAAGATGAGGCCGGGTGCGG - Intronic
1061240294 9:129366518-129366540 TATGTAAAAGAGGCTGGGTGCGG - Intergenic
1061449352 9:130660151-130660173 TGTGCCGAGGAGCCCGGGTGGGG + Intergenic
1061537157 9:131257389-131257411 AATGGAGATGTGGCCAGGTGTGG - Intergenic
1061942690 9:133891790-133891812 TATGGAGGGGAGGGAGGGAGAGG + Intronic
1062126055 9:134863741-134863763 TAGGGAGAGGTGGCAGGCTGTGG - Intergenic
1062594444 9:137292322-137292344 TCTTGAAAAGAGGCCGGGTGCGG - Intergenic
1062748203 9:138230373-138230395 TATAGATAGCAGGCCAGGTGTGG - Intergenic
1185509068 X:649326-649348 AAGAGAGAGGAGGCCGGGCGCGG - Intronic
1185689753 X:2144679-2144701 TAAGAACAGGAGGCCGGGCGTGG + Intergenic
1185697736 X:2207901-2207923 TCTGAAAAGGCGGCCGGGTGCGG + Intergenic
1185714149 X:2327788-2327810 AGAGGAGATGAGGCCGGGTGTGG + Intronic
1185859068 X:3560939-3560961 TTTGGAGGGGGGGCGGGGTGTGG + Intergenic
1186234330 X:7491226-7491248 AAGGGAGTGGAGGCCGGGCGCGG + Intergenic
1186801469 X:13096577-13096599 TATACAGAGGAGGCCGGGCGTGG - Intergenic
1186964748 X:14775120-14775142 AACAGAGTGGAGGCCGGGTGCGG - Intergenic
1187054563 X:15730469-15730491 GAGGTAGAGGAGGCTGGGTGCGG + Intronic
1187137683 X:16563976-16563998 TATGTATAACAGGCCGGGTGTGG - Intergenic
1187144548 X:16625800-16625822 CATGGAGAGGAGTCCGGCTGGGG - Intronic
1187340961 X:18421146-18421168 AATGGAGATGAAGCCGGGCGCGG - Intergenic
1187469757 X:19558975-19558997 GATGGAATGGAGGCTGGGTGTGG + Intronic
1187943405 X:24403120-24403142 TATGGGGAGGGGGCAGGGGGAGG - Intergenic
1188320397 X:28729705-28729727 GATAGGGATGAGGCCGGGTGTGG + Intronic
1188390016 X:29608534-29608556 TAAGAGGAGGAGGCCGGGCGCGG + Intronic
1188554788 X:31399287-31399309 TTTGGAGAGGAGTCCAGCTGTGG - Intronic
1189347470 X:40252893-40252915 CAGTGAAAGGAGGCCGGGTGCGG + Intergenic
1189393803 X:40602358-40602380 AAAGAAGAGGAGGCCGGGTGCGG + Intronic
1189783957 X:44542863-44542885 CAGGGAGAGGAGGGCGGGTGGGG - Exonic
1190007115 X:46750638-46750660 TATGAAGATCAGGCTGGGTGTGG - Intronic
1190098900 X:47505087-47505109 AATGGAATGCAGGCCGGGTGTGG + Intergenic
1190156600 X:47998564-47998586 TGCTTAGAGGAGGCCGGGTGTGG + Intronic
1190247935 X:48702772-48702794 TGTGGAGAGCAGGAAGGGTGAGG - Intronic
1190291345 X:48994512-48994534 TATTGCAAGCAGGCCGGGTGCGG - Intronic
1190958795 X:55224909-55224931 AATGCAAAGAAGGCCGGGTGCGG - Intronic
1191057258 X:56254698-56254720 TTTGGAGAGGAGTCCAGATGGGG - Intronic
1192175292 X:68881241-68881263 TATGGAGAACAGGCTGGGGGAGG + Intergenic
1192431431 X:71114799-71114821 AAAGGAGTGGAGGCCGGGCGCGG + Intergenic
1192581484 X:72286400-72286422 TAAGGAGATGGGGCCAGGTGCGG - Intronic
1192791630 X:74387866-74387888 AATGAAGAAGAGGCTGGGTGCGG + Intergenic
1194214932 X:91118303-91118325 TAAAGAGTGTAGGCCGGGTGCGG - Intergenic
1194658927 X:96606729-96606751 TATGGAGAGAAGGCAGGGCTTGG - Intergenic
1195660542 X:107373688-107373710 TATAGAAAGAAGGCTGGGTGTGG + Intergenic
1195778292 X:108432543-108432565 AAACAAGAGGAGGCCGGGTGCGG + Intronic
1195892357 X:109709814-109709836 AATGAAGGCGAGGCCGGGTGCGG + Intronic
1196301584 X:114054565-114054587 TATGTTGAGAAGGCCGGGCGTGG - Intergenic
1196437882 X:115691481-115691503 ACTGGACAGGTGGCCGGGTGTGG + Intergenic
1196735360 X:118976879-118976901 TGTGGAGTGGAGGAGGGGTGTGG + Intronic
1196824916 X:119733436-119733458 GCTTGAAAGGAGGCCGGGTGTGG + Intergenic
1197014290 X:121605011-121605033 TATGGAAAGGAGGCAGGGACAGG - Intergenic
1197686085 X:129441145-129441167 TTAGGAAAAGAGGCCGGGTGCGG + Intergenic
1198086550 X:133287703-133287725 ATTGGAGAGGAGGCCATGTGGGG + Intergenic
1198341722 X:135720526-135720548 TGTAGAGAGGAGGCTGGTTGAGG + Intronic
1198350084 X:135797383-135797405 TGTAGAGAGGAGGCTGGTTGAGG - Intronic
1198351994 X:135814656-135814678 TGTAGAGAGGAGGCTGGTTGAGG - Intronic
1198355810 X:135849174-135849196 TGTAGAGAGGAGGCTGGTTGAGG - Intronic
1198357721 X:135866453-135866475 TGTAGAGAGGAGGCTGGTTGAGG - Intergenic
1200210195 X:154343715-154343737 CCTGGGGAGGAGGCCCGGTGGGG - Intergenic
1200220657 X:154388377-154388399 CCTGGGGAGGAGGCCCGGTGGGG + Intergenic
1201163824 Y:11189251-11189273 AATTGAAGGGAGGCCGGGTGCGG - Intergenic
1202079701 Y:21071674-21071696 AATGGAGAGGAGGCCTGCAGTGG - Intergenic