ID: 916801570

View in Genome Browser
Species Human (GRCh38)
Location 1:168221164-168221186
Sequence GTGTGTTCACCTGATTTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916801570_916801572 -9 Left 916801570 1:168221164-168221186 CCACTAAAATCAGGTGAACACAC No data
Right 916801572 1:168221178-168221200 TGAACACACAAAGCAATCTAGGG No data
916801570_916801573 -4 Left 916801570 1:168221164-168221186 CCACTAAAATCAGGTGAACACAC No data
Right 916801573 1:168221183-168221205 ACACAAAGCAATCTAGGGCTTGG No data
916801570_916801574 10 Left 916801570 1:168221164-168221186 CCACTAAAATCAGGTGAACACAC No data
Right 916801574 1:168221197-168221219 AGGGCTTGGAGCGATACATAAGG No data
916801570_916801571 -10 Left 916801570 1:168221164-168221186 CCACTAAAATCAGGTGAACACAC No data
Right 916801571 1:168221177-168221199 GTGAACACACAAAGCAATCTAGG No data
916801570_916801575 14 Left 916801570 1:168221164-168221186 CCACTAAAATCAGGTGAACACAC No data
Right 916801575 1:168221201-168221223 CTTGGAGCGATACATAAGGCTGG No data
916801570_916801576 17 Left 916801570 1:168221164-168221186 CCACTAAAATCAGGTGAACACAC No data
Right 916801576 1:168221204-168221226 GGAGCGATACATAAGGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916801570 Original CRISPR GTGTGTTCACCTGATTTTAG TGG (reversed) Intergenic
No off target data available for this crispr