ID: 916801571

View in Genome Browser
Species Human (GRCh38)
Location 1:168221177-168221199
Sequence GTGAACACACAAAGCAATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916801569_916801571 -7 Left 916801569 1:168221161-168221183 CCACCACTAAAATCAGGTGAACA No data
Right 916801571 1:168221177-168221199 GTGAACACACAAAGCAATCTAGG No data
916801570_916801571 -10 Left 916801570 1:168221164-168221186 CCACTAAAATCAGGTGAACACAC No data
Right 916801571 1:168221177-168221199 GTGAACACACAAAGCAATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916801571 Original CRISPR GTGAACACACAAAGCAATCT AGG Intergenic
No off target data available for this crispr