ID: 916802469

View in Genome Browser
Species Human (GRCh38)
Location 1:168227282-168227304
Sequence CTCATTTCACAGATGGGGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 807
Summary {0: 1, 1: 1, 2: 26, 3: 149, 4: 630}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916802469_916802477 26 Left 916802469 1:168227282-168227304 CCGTTCCCCATCTGTGAAATGAG 0: 1
1: 1
2: 26
3: 149
4: 630
Right 916802477 1:168227331-168227353 AAACTAATCAGTGTTTCTTCTGG 0: 1
1: 0
2: 1
3: 11
4: 229
916802469_916802475 3 Left 916802469 1:168227282-168227304 CCGTTCCCCATCTGTGAAATGAG 0: 1
1: 1
2: 26
3: 149
4: 630
Right 916802475 1:168227308-168227330 GTTAAGATGATATGGCCAACTGG 0: 1
1: 0
2: 0
3: 5
4: 77
916802469_916802474 -5 Left 916802469 1:168227282-168227304 CCGTTCCCCATCTGTGAAATGAG 0: 1
1: 1
2: 26
3: 149
4: 630
Right 916802474 1:168227300-168227322 ATGAGGATGTTAAGATGATATGG 0: 1
1: 0
2: 0
3: 37
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916802469 Original CRISPR CTCATTTCACAGATGGGGAA CGG (reversed) Intronic
900656341 1:3760277-3760299 CACATTTAACATTTGGGGAATGG - Intronic
900867204 1:5277029-5277051 CCCATTTCACAGACCGGGCATGG + Intergenic
900932939 1:5748022-5748044 CCCATTTTACATGTGGGGAAAGG - Intergenic
901094138 1:6664771-6664793 CTCATTTTACAGAAGAGAAAAGG + Intronic
901377619 1:8850762-8850784 CTCAATTCAAAAATGGGCAAAGG + Intergenic
901566441 1:10119714-10119736 TTCATTTTACAGGTGAGGAAGGG - Intronic
901762992 1:11482663-11482685 ACCATTTCAAAGAGGGGGAAGGG - Intronic
902281304 1:15376625-15376647 ATCATTTTACAGCTGGGAAATGG - Intronic
902398426 1:16144695-16144717 CTCATTTTACAGATGGGGGTGGG + Intronic
902419324 1:16265566-16265588 CTCATTTTACAGATGAATAATGG + Intronic
902667723 1:17951343-17951365 TCCATTTTACAGATGAGGAAAGG - Intergenic
902923566 1:19681126-19681148 CTCATGTCATACATGGGAAATGG - Intergenic
903422203 1:23226042-23226064 CTCATTTCGCAGATGAGCAGGGG - Intergenic
903466738 1:23557157-23557179 CCTATTTCAGAAATGGGGAAAGG - Intergenic
903608160 1:24590134-24590156 TTCATTTGAGAGAAGGGGAAAGG + Intronic
903705050 1:25279566-25279588 CCCATTTTAGAGATGGGGAAAGG - Intronic
903722178 1:25413755-25413777 CCCATTTTAGAGAGGGGGAAAGG + Intronic
903795902 1:25928747-25928769 CTCACTTCACAGAGTGGGATAGG - Intergenic
903848485 1:26292177-26292199 TCCATTTCACAGATGGGTAAAGG - Intronic
904040806 1:27583761-27583783 CTTATTTCACAGATAGGAATCGG - Intronic
904416704 1:30366265-30366287 ATCATTTTACAGAATGGGAATGG - Intergenic
904420349 1:30387100-30387122 CTTACATCACACATGGGGAAGGG - Intergenic
904454690 1:30640530-30640552 CCCATTTCACAACTGGGAAATGG - Intergenic
904455942 1:30648105-30648127 CCCATTTCCCAGATGGAGAACGG + Intergenic
904594975 1:31638256-31638278 CCCATTTTACAGATGGGGGAGGG + Intronic
904751689 1:32744566-32744588 CTCACTTTACAGATGGGAAATGG + Intronic
904809070 1:33151530-33151552 CTGACTTCTCAGAGGGGGAAGGG - Intronic
905523779 1:38621268-38621290 CTCATATCACATATGTGTAAAGG - Intergenic
905860366 1:41346552-41346574 CTCATTTCACAGATGAAAAGAGG + Intergenic
906326338 1:44848452-44848474 CTCACTTCAAGTATGGGGAAAGG + Intergenic
906542817 1:46601238-46601260 TTCATTTTATAGATGGGGAAAGG - Intronic
907126142 1:52052864-52052886 CCCATTTTGCAGATGAGGAACGG + Intronic
907306526 1:53516257-53516279 CTCCTTTCATGGATGGGGTAAGG + Intronic
907318498 1:53588010-53588032 CCCATTTTATAGATGGGGAAAGG - Intronic
907574047 1:55509900-55509922 CCCATTTTACAGGTGAGGAAAGG + Intergenic
907579241 1:55556981-55557003 CTCATTTCTCAGTGTGGGAAGGG - Intergenic
907625308 1:56023753-56023775 CTCATTTCACAGTTAGAAAATGG + Intergenic
907940018 1:59078504-59078526 CTCATTTTACAAATGAGGAATGG - Intergenic
907967243 1:59344334-59344356 TTCTTTTCAAAGATGTGGAAGGG + Intronic
908034419 1:60036591-60036613 CCCATTTTACAGTTGGAGAATGG + Intronic
908439348 1:64137962-64137984 CTCATTTCACAGATGAAGAAGGG - Intronic
908536205 1:65080039-65080061 CTCATTTTACAGTTGAAGAAAGG - Intergenic
908647997 1:66300479-66300501 CTCATTTCACATGTGAGGGAGGG + Intronic
909079214 1:71088991-71089013 CTCAGTTCATGGGTGGGGAAGGG + Intergenic
909478300 1:76107356-76107378 CTCATTTCACTGAGAAGGAATGG + Intronic
909623105 1:77687542-77687564 CTCACTTCCCAGATGGGGTGGGG - Intergenic
909658312 1:78055175-78055197 CTCATGTAACAGAAGGGGAAAGG + Intronic
909684136 1:78326992-78327014 CTGATTTTACAAATGGGGAAAGG - Intronic
909726312 1:78840274-78840296 CTCATTTGACACAGGGGGATTGG + Intergenic
910891746 1:92026465-92026487 CTCACTTCCCAGATGGGGTGGGG + Intergenic
911011567 1:93286748-93286770 CTCATATCAGAGAAGAGGAAAGG + Intergenic
912200177 1:107448358-107448380 CCCATTTAACAGATGATGAATGG + Intronic
912244853 1:107950692-107950714 CTCATGTTACAGAAGGTGAAGGG + Intronic
912482034 1:109990247-109990269 CCCATTTTACAGATGAGAAAAGG - Intronic
912591599 1:110826297-110826319 CTCAATTTACAAATGGGCAAGGG + Intergenic
912699910 1:111869706-111869728 CTGCTTTCACAGATGAGGAAGGG + Intronic
913002386 1:114593847-114593869 TTCATTTTACAGATGAGAAAAGG - Intronic
913699663 1:121362214-121362236 CTCCTTTCACAGATGATAAAAGG - Intronic
914137881 1:144917822-144917844 CTCCTTTCACAGATGATAAAAGG + Intronic
914515751 1:148372699-148372721 CCATCTTCACAGATGGGGAAGGG - Intergenic
914947211 1:152078541-152078563 CTCACTTCCCAGATGGTGAGGGG + Intergenic
914947377 1:152079265-152079287 CTCACTGCCCAGATGGGGCAGGG + Intergenic
915075402 1:153304437-153304459 CTCATTTGACAGCTGGGGCTAGG - Intronic
915603533 1:156937173-156937195 CACATCTCACTCATGGGGAATGG + Intronic
916314862 1:163437960-163437982 CTCGGTTTACAGACGGGGAATGG - Intergenic
916351830 1:163859044-163859066 CCCATTTCACAGATAAGAAAAGG + Intergenic
916732599 1:167580049-167580071 CTCATTTCAAAGAACTGGAAAGG + Intergenic
916802469 1:168227282-168227304 CTCATTTCACAGATGGGGAACGG - Intronic
916833020 1:168512507-168512529 TCCATTTTACAGATGAGGAAGGG + Intergenic
916972719 1:170041830-170041852 CCCTTTTTACAGATTGGGAAGGG - Intronic
917002816 1:170378777-170378799 CTCAATTCAAAAATGGGCAAAGG - Intergenic
917174699 1:172220573-172220595 CTCAGTTCACAGAGGCGGATGGG + Intronic
917256515 1:173121994-173122016 CCCATTTCAGAGATGGGGCGTGG + Intergenic
917454508 1:175174477-175174499 CTCATTTCTCAGATGAGGAAAGG - Intronic
919837932 1:201589314-201589336 CCCATGTTACAGATAGGGAAAGG + Intergenic
920045957 1:203132529-203132551 TTCATTTAACAGATGGTGAAGGG - Intronic
920154260 1:203935592-203935614 CTCATTTCTCAGATCTGCAAGGG - Intergenic
920487071 1:206380923-206380945 CTCCTTTCACAGATGATAAAAGG - Intronic
920977892 1:210803055-210803077 CTCATTTCACAGATCTGGGATGG + Intronic
921571958 1:216790340-216790362 TCCATTTTACAGATGGGGAATGG - Intronic
921803336 1:219426918-219426940 CTTATTTCACAAATGAAGAAAGG + Intergenic
922216839 1:223526709-223526731 CTCTTTTGCCAGCTGGGGAAGGG - Intergenic
922433402 1:225579076-225579098 CCCATTTTACAGATAGGAAATGG + Intronic
922570619 1:226632782-226632804 CTTCTTTCACAGATGGAGTAAGG + Exonic
923279442 1:232428726-232428748 CTCATTTCACAAATGTGAAATGG - Intronic
923362480 1:233225360-233225382 CCCATTTAACAGATAGGAAACGG + Intronic
924658466 1:245994632-245994654 CTCATTTCAGAAATAGGGGAGGG + Intronic
1063005628 10:1967981-1968003 CTCATTTTATAAATGGAGAAAGG + Intergenic
1063430928 10:5987574-5987596 TCCATTTTACAGATGAGGAAAGG - Intergenic
1063756097 10:9010450-9010472 CTGATTTCAAAGGTGGGGGATGG - Intergenic
1064185796 10:13161137-13161159 CTCACTGCACAGATGGTGAAGGG + Intergenic
1064714089 10:18157597-18157619 CCCGTTTCACAGATGAGAAATGG + Intronic
1065054084 10:21825848-21825870 CTCAGTTCAAAGATGAGCAAAGG - Intronic
1066025978 10:31361543-31361565 CTCACTTCCCAGATGGTGAGGGG + Intronic
1066281256 10:33920281-33920303 CATATTTCACATCTGGGGAAGGG + Intergenic
1066366449 10:34781452-34781474 CTCCTTTCACAGATGAGGCTTGG + Intronic
1066474143 10:35728242-35728264 CACATTTCTGACATGGGGAATGG + Intergenic
1067174385 10:43932666-43932688 CTCAATTCAAAAATGGGCAAAGG - Intergenic
1067189659 10:44058790-44058812 TTCAGATCTCAGATGGGGAAGGG + Intergenic
1067522697 10:47020247-47020269 CTCATTTCAAAGATGGACATGGG + Intergenic
1068660968 10:59622958-59622980 CTCACTTGTCAGATGAGGAACGG + Intergenic
1069503062 10:68971592-68971614 CTCATCACACAAATGAGGAAAGG + Intronic
1069635218 10:69920901-69920923 CTCATTTCACAGATTTGGTGAGG - Intronic
1069828423 10:71268284-71268306 CCCATTTCACAGATTGGCAAAGG + Intronic
1069832927 10:71291918-71291940 CCCATCTCACAGATGGGGAAAGG + Intronic
1069863617 10:71486620-71486642 CTCATTTTCTAGATGGGAAACGG + Intronic
1069920017 10:71810768-71810790 CCCATGTTACAGATGGGGAGAGG - Intronic
1070357014 10:75649943-75649965 CTCAATTCAAAAATGGGCAAAGG - Intronic
1070658574 10:78288713-78288735 CCCATTTTACAGATGGGGAAGGG - Intergenic
1070688734 10:78509275-78509297 CCCATTTCACAGATGGACAAGGG + Intergenic
1070780755 10:79136195-79136217 CTCATTTTACAGATAAGAAAAGG - Intronic
1070789924 10:79182920-79182942 CTCACTGCTCAGATGGTGAAGGG - Intronic
1071040073 10:81296886-81296908 CTCATTTAAAAAATGGGAAAGGG - Intergenic
1071071149 10:81696025-81696047 CTGATTTCTCACATGGTGAAAGG + Intergenic
1071261490 10:83923449-83923471 TTCATTTCACAGATACGGAATGG - Intergenic
1071262866 10:83936763-83936785 CTCATTACACAGATGAGGGAAGG + Intergenic
1071383782 10:85099231-85099253 CTCCCTTCACAGATGAGGATAGG + Intergenic
1071542157 10:86495811-86495833 CTCAATTCAAAAATGGGCAAAGG + Intronic
1071586132 10:86823369-86823391 CTCATTTTACAGATTGGGTACGG + Intronic
1072035507 10:91559775-91559797 CACATTTGATAGATGGGAAAGGG - Intergenic
1072615797 10:97048267-97048289 CTAATTTTACAGGTGGGGACGGG + Intronic
1073322941 10:102626611-102626633 CTCATTTTACAGATGACAAAGGG - Intronic
1073445545 10:103578202-103578224 CTTACCTCACAGATGTGGAAAGG + Intronic
1073468027 10:103705540-103705562 CCCATTTTACAGATGAGAAATGG + Intronic
1073675926 10:105646989-105647011 TGGATTCCACAGATGGGGAAAGG + Intergenic
1073910604 10:108338614-108338636 CTTATTTTACAGATATGGAAAGG + Intergenic
1074072288 10:110084614-110084636 CTCATTTCTCATATGGAGAAAGG - Intronic
1074156307 10:110802930-110802952 CTCAGTTTACAGATCAGGAAAGG + Intronic
1074494456 10:113967706-113967728 CCCATTTCAAAGATGGGCAAAGG + Intergenic
1074806017 10:117053430-117053452 CTCAATTTAAAAATGGGGAAAGG + Intronic
1074889436 10:117722843-117722865 CTCCTTTTGCAGATGGTGAAAGG + Intergenic
1075411459 10:122231604-122231626 CCCATTTTACAGATGGGAGATGG + Intronic
1075926634 10:126256415-126256437 CCCATTTTACAGATGGAGACTGG - Intronic
1076250899 10:128983095-128983117 TCCATTTCACAGGTGGGAAAAGG + Intergenic
1077455656 11:2677925-2677947 TTCATTTCATAGATGAGAAATGG + Intronic
1078402979 11:11044494-11044516 CTCATTTTACAGTTGAGGGAAGG - Intergenic
1078427383 11:11262896-11262918 CCCATTTTATAGATGAGGAAAGG - Intergenic
1079067447 11:17308193-17308215 CTCATTCCAGAGCTGGGGCAAGG - Intronic
1079425051 11:20332492-20332514 CCCATTTTACAGAAGAGGAAGGG - Intergenic
1080943258 11:36943094-36943116 GTCATGTCACAGAATGGGAAAGG + Intergenic
1081659695 11:44880417-44880439 CTCATTTTACAGATGAGGAGAGG - Intronic
1082884392 11:58067722-58067744 CTCATTTTACAAGTGGGAAATGG + Intronic
1082959056 11:58901717-58901739 CCCATTTCACAGATTAGGACAGG - Intronic
1082974570 11:59059301-59059323 CCCATTTCACAGATTAGGACAGG - Intergenic
1082978988 11:59103098-59103120 CCCATTTCACAGATCAGGACAGG - Intergenic
1083488663 11:62999079-62999101 CTCCTCCCACAGATGTGGAATGG - Exonic
1083607519 11:63987525-63987547 CCCATTTTACAGTTGAGGAAAGG + Intronic
1083775100 11:64890729-64890751 CTGAGCTCACAGATGGGGAGAGG + Intergenic
1083831364 11:65236031-65236053 CTTATTTTACAGATGAGGACAGG + Intergenic
1083939135 11:65885811-65885833 CTCTTCGCACAGATGGGGAAGGG - Intronic
1084521688 11:69666974-69666996 CTCATTTTACAGAGGAGGGAGGG - Exonic
1084553587 11:69863314-69863336 CCCATTTCACAGATAAGAAAGGG + Intergenic
1084877084 11:72140976-72140998 CTCATCTTACAGGTGGGGAAAGG + Intergenic
1084958600 11:72704312-72704334 CTCTTCTTACAGCTGGGGAATGG - Exonic
1085393364 11:76193845-76193867 CCCTTTTTACAGATAGGGAAAGG - Intronic
1085612006 11:77959031-77959053 CTCCTTTCAGACATGGGGTAGGG - Intronic
1085906626 11:80772184-80772206 CTCATTGCTGAGATGAGGAAAGG - Intergenic
1085976499 11:81661465-81661487 CACAATGCACAGATGGGGCATGG - Intergenic
1087529792 11:99365201-99365223 CTCATTTTAAAGATGGGAAAAGG - Intronic
1088418471 11:109616515-109616537 CTCATTTTAAAAATGGGCAAAGG + Intergenic
1089523977 11:119084774-119084796 CTCATGTCACAGCTGGGGAATGG + Intergenic
1090253156 11:125264862-125264884 CCCATTTCACAGATGGGGCCAGG - Intronic
1090452396 11:126818204-126818226 GTGTTTTCACAGCTGGGGAAAGG + Intronic
1090772140 11:129930717-129930739 CTCAATTCACAGATTGGAAGTGG - Intronic
1091341913 11:134822706-134822728 CTCACTTTATAGATGAGGAAAGG + Intergenic
1091380424 12:54636-54658 CCCAGTTCACAGATGAGGATAGG + Intergenic
1091627795 12:2136342-2136364 CCCATTTTAAAGATGAGGAAGGG + Intronic
1091660476 12:2379595-2379617 CTCATTTTACTGGTGAGGAAGGG + Intronic
1091919744 12:4294714-4294736 CTCGTTTCCCAGCTAGGGAATGG - Intronic
1091949310 12:4580016-4580038 CTCATTTTACAGATGGAGAAAGG - Intronic
1093399023 12:18720553-18720575 CCCATTCCACAGATAGGGAGAGG - Intronic
1094038014 12:26091184-26091206 CTCATTCCCCAAATGGGAAAAGG - Intergenic
1094095839 12:26703571-26703593 TTATTTTCACAGTTGGGGAATGG - Intronic
1094504570 12:31050785-31050807 CTCATGACACAGATGAAGAAAGG - Intergenic
1095934241 12:47659513-47659535 CACATTTAACAGATTGGAAAAGG - Intergenic
1096021148 12:48326614-48326636 CTGATTTTAAAGATGGGAAAAGG + Intergenic
1096320630 12:50609541-50609563 CCCATTTCACCCATTGGGAAGGG + Intronic
1096427548 12:51516936-51516958 CTCATCTCTAAGATGGGAAAAGG + Intergenic
1096536079 12:52275691-52275713 CCCATTTCACAGATGGAGAAAGG + Intronic
1096603168 12:52745013-52745035 CTCATTTCTCAGACAGGGATTGG - Intergenic
1097272970 12:57789946-57789968 CCCATTCCACAGTTGGGGAAAGG - Intronic
1097780683 12:63700385-63700407 CTTATTTTACAGATGAGAAAAGG - Intergenic
1097989344 12:65818727-65818749 GACATTTCACGGATGGTGAAAGG + Intergenic
1100226839 12:92566095-92566117 CTCATTTTACAGACGAGAAACGG - Intergenic
1100588699 12:96003769-96003791 CTCCTTTGAAAGATGGAGAAAGG - Intronic
1100946185 12:99786511-99786533 CACATTGCACAGAAGGGGAAAGG + Intronic
1101164094 12:102010235-102010257 CCCAGTTCCCAGATGGGGTAGGG + Intronic
1101652907 12:106693976-106693998 CCCATTTCACAGAAGGGGAACGG + Intronic
1102198767 12:111043203-111043225 GCCATTTCACAGACGGGCAAGGG + Intronic
1102448128 12:113019351-113019373 CACATTTTACAGAGGGGGAAAGG + Intergenic
1102600361 12:114025110-114025132 CTCATCTCAAAGGTGTGGAAAGG - Intergenic
1102638117 12:114342348-114342370 CCCTTTTCAGAGGTGGGGAAGGG - Intergenic
1102917623 12:116766443-116766465 CCCATTTTACAGATGAGGAAAGG + Intronic
1102973414 12:117189563-117189585 CCCATTTTAGAGATGGGGAATGG - Intronic
1103149131 12:118621836-118621858 CCCATTTTACAGATGAGGAAAGG - Intergenic
1103242023 12:119421637-119421659 CCCATTTCACAGATGGGGATTGG + Intronic
1103529485 12:121590773-121590795 CCCAGTTCACAGCTGGGGAGAGG + Intergenic
1103620190 12:122182853-122182875 CCCATCTGACAGATGGAGAAAGG - Intronic
1104349333 12:128031151-128031173 TTCATTTCAAAGAAAGGGAAGGG + Intergenic
1104526653 12:129530465-129530487 ATCAATTCACAGCTGGGCAAAGG - Intronic
1104752677 12:131250056-131250078 CTTATTTCCCAGAGGGAGAAGGG - Intergenic
1105322350 13:19339737-19339759 AACATTTCATAGATTGGGAAAGG - Intergenic
1105343830 13:19555169-19555191 CTCATTTTATAGGTGGGGAAAGG + Intergenic
1105536212 13:21266445-21266467 CTCATTTTATAGGTGGGGAAAGG - Intergenic
1105634294 13:22202485-22202507 CTCATTTTACAGAGAGGAAAAGG + Intergenic
1105730145 13:23205681-23205703 TCCATTTCACTGATGGAGAAGGG + Intronic
1105831006 13:24162740-24162762 CCCATTTGACAGATGAGAAAAGG + Intronic
1105875321 13:24547395-24547417 AACATTTCATAGATTGGGAAAGG + Intergenic
1105926924 13:25017382-25017404 GTCCTTTCACAGCTGGGGAGTGG - Intergenic
1106238841 13:27890812-27890834 CTCCTTTCAAAAATGGGCAAAGG - Intergenic
1106590088 13:31091494-31091516 CTCACTTCACAGATGAGGGTTGG - Intergenic
1106645731 13:31631736-31631758 ATCATCTCAGAGATGGGTAAAGG - Intergenic
1106958941 13:34975039-34975061 CACAATTTACATATGGGGAAAGG + Intronic
1107541951 13:41397016-41397038 CTCAATTAACAAATGGGCAAAGG + Intergenic
1108168846 13:47720611-47720633 CCCATTTTACAGAGGAGGAAAGG - Intergenic
1108325302 13:49324700-49324722 CTGACTTCACAGATGGGGTGAGG + Intronic
1108420982 13:50249226-50249248 TTGATTTTACAGATGAGGAATGG + Intronic
1108505970 13:51112714-51112736 ATCAATTCACAGATGAAGAAGGG + Intergenic
1108520357 13:51241542-51241564 CTCATTTTACAGTTGGGGTCAGG - Intronic
1108666285 13:52634831-52634853 CTCATTTTACAGTTGGGGAAAGG - Intergenic
1109766109 13:66900266-66900288 CTTATTCTACAGATGGGAAAAGG - Intronic
1110182750 13:72636819-72636841 CTCATTTTACACATGAGGACTGG + Intergenic
1110310534 13:74044254-74044276 CCCATTTTACAGATGAGGAATGG - Intronic
1110626322 13:77660001-77660023 CTCACTTCCCAGATGGTGAGGGG + Intergenic
1110626409 13:77660319-77660341 CTCATTTCCCAGACGGTGAGGGG + Intergenic
1110626426 13:77660399-77660421 CTCATTTCCCAGACGGTGAGGGG + Intergenic
1110626451 13:77660519-77660541 CTCATTTCCCAGACGGTGAGGGG + Intergenic
1111077506 13:83257139-83257161 TTCGGTGCACAGATGGGGAATGG + Intergenic
1113156251 13:107326278-107326300 CTCATTTATCAGAAGGAGAATGG - Intronic
1115161679 14:30403449-30403471 CTCATTTTAAAGAAGAGGAAAGG - Intergenic
1117128743 14:52662627-52662649 TTCATATTACAGATGGGGTAGGG + Intronic
1117319705 14:54609268-54609290 CTGACTTCAAAGATGGAGAAAGG + Intronic
1117331239 14:54713932-54713954 CTCATTTTATAGATGAGGAAAGG - Intronic
1117522068 14:56560796-56560818 CTCATTTCACTGGTGGAGATAGG + Intronic
1119014400 14:71035264-71035286 TTACTTTCACATATGGGGAAAGG - Intronic
1119178647 14:72588573-72588595 CTCATTACTCAGAAGGGGGAAGG - Intergenic
1119206255 14:72796200-72796222 CTCCTTTTATAGATGGGGAAAGG - Intronic
1119602079 14:75982922-75982944 CCCATTTCCCAGATGGGTGAGGG + Intronic
1119654943 14:76410553-76410575 CCCATTTTACAGATGGAGAATGG + Intronic
1119921191 14:78447822-78447844 CCCATTTCACAGATGAAGAAAGG - Intronic
1121548435 14:94780030-94780052 CCCATTTTACAGATGAGAAAAGG - Intergenic
1121563982 14:94894980-94895002 CTCAACTCATAGATGAGGAAGGG - Intergenic
1122105243 14:99448197-99448219 CTCATTTTTCAAATGGGGAATGG - Intronic
1122458449 14:101875660-101875682 CTCACTTTACAAATGGGGAAAGG + Intronic
1122603974 14:102935922-102935944 CCCATTTCAAAAATGGGTAAAGG + Intronic
1122690437 14:103529593-103529615 CTCATCTCACATCTTGGGAATGG + Intronic
1122855900 14:104559944-104559966 CACTCTTGACAGATGGGGAAGGG + Intronic
1123439608 15:20281052-20281074 CTCATTTTACAGCTGGGAATGGG + Intergenic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1125415273 15:39445896-39445918 TTCATTTTATAGATGAGGAAAGG - Intergenic
1125839232 15:42783269-42783291 CTCATGTGGTAGATGGGGAAAGG - Intronic
1126105550 15:45144756-45144778 CTCCTTTTACAGAAGAGGAAAGG - Intronic
1126275577 15:46875581-46875603 CACCTTTCACAGATGGAGAGAGG + Intergenic
1127966983 15:63929862-63929884 CTCATTTTACAAGGGGGGAAGGG - Intronic
1127975822 15:63996726-63996748 CCCATTTCACAGACGGCTAAAGG + Intronic
1128723894 15:69973775-69973797 CTGATTTCACAGATGGGGGCAGG - Intergenic
1128869127 15:71138981-71139003 CCCATTTTACAGATGAAGAAAGG + Intronic
1129159291 15:73738380-73738402 CTCATTTGAAAAATGGGGATAGG + Exonic
1129236748 15:74228318-74228340 CTCATTTTACAGATGAGGAAAGG - Intergenic
1129670106 15:77602986-77603008 ATCATCTTATAGATGGGGAAAGG + Intergenic
1130154890 15:81341764-81341786 CTCTTTTCACAGCTGAGCAAAGG + Intronic
1130735716 15:86546492-86546514 CTCATTTTACAGATGGCAGAAGG - Intronic
1130759782 15:86806619-86806641 CCCATTTTACAGATTAGGAAGGG - Intronic
1130773641 15:86952508-86952530 CTCATTTAAAAAATGGGCAAAGG - Intronic
1131337838 15:91566875-91566897 CTCAGCCCATAGATGGGGAAAGG + Intergenic
1131421073 15:92305842-92305864 CTCATTTTCCGGATGAGGAAGGG - Intergenic
1132024259 15:98391599-98391621 CTCATCTGCCAGATGGGGCAAGG + Intergenic
1132057659 15:98664342-98664364 TCCATTTTACAGATGAGGAAAGG - Intronic
1132096062 15:98985749-98985771 CCCATTTTGCAGATGAGGAAAGG - Intronic
1132163519 15:99564879-99564901 CCCATTTTACAGATGAGGAAAGG - Intergenic
1132355308 15:101167406-101167428 CTCAGTTTACAGATGAGGACTGG - Intergenic
1132898161 16:2238581-2238603 CCCGTCCCACAGATGGGGAACGG - Exonic
1133604819 16:7376406-7376428 CCCATTTCACAGATGAGCACTGG + Intronic
1133625798 16:7569395-7569417 CTGATTTTGAAGATGGGGAAAGG - Intronic
1133921754 16:10159627-10159649 CCCATTTTACAGATGAGGAAAGG + Intronic
1134186671 16:12090173-12090195 CTCATTTCACAAATGAGGACAGG - Exonic
1134307830 16:13049313-13049335 ATTATTTTACAGATGGGGAAAGG - Intronic
1135940816 16:26820117-26820139 CTCCTTTTACAGATGGGGAAAGG - Intergenic
1136845561 16:33573346-33573368 CTCATTTTACAGCTGGGAATGGG - Intergenic
1137674393 16:50297103-50297125 CCTATTGCACAGATGGGGAAAGG + Intronic
1138291483 16:55851310-55851332 CTCAATTCAAAAATGGGCAAGGG + Intronic
1138293652 16:55868859-55868881 CTCATTTCACAGCTGGAAAATGG - Intronic
1138317173 16:56080383-56080405 CTCATTTGGCAGAAGGGGCAAGG + Intergenic
1138347536 16:56329229-56329251 TTAATTTTAAAGATGGGGAATGG - Intronic
1138456893 16:57126290-57126312 CTCCTTTTAGAGCTGGGGAATGG + Intronic
1138505494 16:57476342-57476364 CCCATTTTATAGATGGGGAAAGG + Intronic
1138829136 16:60357802-60357824 CTCACTTCCCAGATGGTGAGGGG + Intergenic
1139433636 16:66924315-66924337 CCCACTTCATAAATGGGGAAAGG - Intronic
1139804782 16:69555338-69555360 CTTATTTCACAGAGAGGGGACGG + Intergenic
1139852753 16:69960859-69960881 CTCAGGTCACAGGTGTGGAAGGG - Exonic
1139881724 16:70183767-70183789 CTCAGGTCACAGGTGTGGAAGGG - Exonic
1140370784 16:74411739-74411761 CTCAGGTCACAGGTGTGGAAGGG + Exonic
1140458133 16:75116316-75116338 CCCATTTTACAGATGAGAAATGG + Intronic
1140909317 16:79437599-79437621 CTCATTTTACAGCTGAGGAAAGG + Intergenic
1141096433 16:81166195-81166217 CCCATTGGACAGATGGGGGATGG + Intergenic
1141135767 16:81464170-81464192 CGCATTTCACAGGTGAGAAAAGG + Intronic
1141169890 16:81684659-81684681 CCCATTTCACAGATGAGAAACGG - Intronic
1141522521 16:84590483-84590505 CCCATTTCACAGATGGGAAATGG + Intronic
1141533255 16:84661305-84661327 CCCATTTCCCAGATGGGGCAAGG + Intronic
1141552760 16:84817196-84817218 TTCATTTCACAGATGGGGCATGG + Intergenic
1141800946 16:86308843-86308865 AACATTTCCCAGATGGGGACAGG - Intergenic
1141881885 16:86865722-86865744 CTAATTCCACAGATGAGGAAAGG - Intergenic
1142421832 16:89975631-89975653 CTACTTTCTCAGATGGGCAATGG + Intergenic
1203107269 16_KI270728v1_random:1421999-1422021 CTCATTTTACAGCTGGGAATGGG - Intergenic
1142476986 17:194437-194459 CTCAATTCACGGAGGTGGAAGGG + Intergenic
1143121800 17:4612551-4612573 CTGATTCCACAGTTGGGGCAAGG - Intergenic
1143349507 17:6277112-6277134 TCCATTTTACAGATGAGGAAAGG - Intergenic
1143874859 17:9983976-9983998 CTCATTTTACATAGGAGGAAAGG - Intronic
1144260050 17:13509772-13509794 TTCATTTCACAGATGTTGAAAGG + Intronic
1144394229 17:14827969-14827991 CTCCTTTAACAGAAGAGGAAAGG - Intergenic
1144597181 17:16580523-16580545 CTGATTTCACAAATGGCGGAGGG + Intergenic
1144754530 17:17671168-17671190 CCCATTTTACAGATGAGGAGAGG - Intergenic
1144798616 17:17910290-17910312 CTCACATCCCAGAGGGGGAAGGG - Intronic
1145063665 17:19747842-19747864 TGCATTTTACAGATGAGGAAAGG + Intronic
1146032146 17:29375446-29375468 CTCATTTTACAGATGGGGAAAGG + Intergenic
1146176900 17:30670938-30670960 CTCATTTTATAAATGAGGAAAGG - Intergenic
1146866691 17:36342267-36342289 CTCAATTCAAAAATGGGCAAAGG - Intronic
1146905443 17:36614995-36615017 CTCCTTCCCCAGATTGGGAAAGG + Intergenic
1146923604 17:36729543-36729565 CCCATTTCACAGATGGGAAAGGG - Intergenic
1147069559 17:37942876-37942898 CTCAATTCAAAAATGGGCAAAGG - Intergenic
1147081089 17:38022414-38022436 CTCAATTCAAAAATGGGCAAAGG - Intronic
1147097031 17:38146371-38146393 CTCAATTCAAAAATGGGCAAAGG - Intergenic
1147705975 17:42424997-42425019 CTCATTTGACAGACAGGAAAAGG + Intergenic
1148127109 17:45242560-45242582 GCCATTTCACAGATGAGGAGGGG + Intronic
1148219176 17:45850080-45850102 CCCATTTCACAGATGGGGCTGGG + Intergenic
1148598485 17:48876082-48876104 TCCATTTCACAGATGGGTCACGG + Intergenic
1148867409 17:50635634-50635656 CCCTTCTCACAGATGGAGAAAGG + Intronic
1149489611 17:57074113-57074135 CTCAGTTCACAGATGAGACAAGG + Intergenic
1149889850 17:60378115-60378137 CTCAATTCAAAAATGGGCAAAGG + Intronic
1149949971 17:60975318-60975340 CTCATTTCACATCTGGGGTTGGG - Intronic
1150012411 17:61517302-61517324 CCCATTTTACAGATGAGAAATGG + Intergenic
1150226102 17:63525256-63525278 TTCATTTCATAGATGTGGAAGGG + Intronic
1150290189 17:63976671-63976693 GTCTGTTCACAGATGGGGAGAGG - Intergenic
1150333015 17:64309540-64309562 CTCATTTCATTGATGAAGAAAGG + Intergenic
1150337800 17:64343097-64343119 CTCCTTTTACAGATGGGGAAAGG + Intronic
1150379551 17:64709823-64709845 CTAATACCACAGATGGGGAAGGG - Intergenic
1151288851 17:73133830-73133852 CCCATCTTACAGATGGGGAAGGG + Intergenic
1151532588 17:74716215-74716237 CTGCTTTCACATATGGGGACAGG - Intronic
1151551361 17:74824288-74824310 CTCATCTCACAGAGGGGCAGGGG + Intronic
1152049889 17:77965139-77965161 CCCATTTTACAGATGAGCAAAGG + Intergenic
1152108424 17:78343647-78343669 CCCATTGTACAGATGGGGAGCGG + Intergenic
1154260262 18:12825431-12825453 TCCATTTTACAGATGAGGAAGGG + Intronic
1155417774 18:25618812-25618834 CCCATTTTACAGATGAGAAAAGG + Intergenic
1156485786 18:37464703-37464725 GGCATCTCACAGATGGGGAGTGG + Intronic
1156977350 18:43238545-43238567 CTCCTTTCACACATGGGTATTGG + Intergenic
1157120899 18:44910294-44910316 CTCATTCAAGAGATGGCGAAGGG + Intronic
1158203989 18:54970676-54970698 ATCATTTCAAAAATGGAGAAAGG + Intergenic
1158325643 18:56311535-56311557 CCCATTTCACAGATGAAGAAAGG + Intergenic
1158427586 18:57353279-57353301 CTCATTTCAGAAATGGGGGTTGG + Intronic
1158932063 18:62332212-62332234 CACATCCCACAGATGGGAAATGG + Intronic
1158997720 18:62940215-62940237 CACATTGCAAAGCTGGGGAATGG - Intronic
1160105726 18:75973991-75974013 CCCATTTTACAGATGAGGAAAGG - Intergenic
1160114917 18:76069126-76069148 TTGATTTCAAAGATGGGCAAAGG - Intergenic
1162209587 19:9080732-9080754 CTCATTTCACAGGGGAGGGAGGG + Intergenic
1162418871 19:10554349-10554371 CCCATTTTACAGACAGGGAAAGG + Intronic
1162981919 19:14245972-14245994 CTCATTTTATAAATGAGGAAAGG + Intergenic
1163168246 19:15512199-15512221 CCCATTTCACAGATTGGCAAAGG + Intronic
1163324494 19:16594418-16594440 CGCATCTCACAAGTGGGGAAGGG + Intronic
1163725439 19:18920783-18920805 CTCATCTCACACGTGGGAAAAGG - Intronic
1164730313 19:30498774-30498796 CCCATTTCACAGTGGGGGACAGG + Intronic
1165226243 19:34357314-34357336 CCCATTTCTCAGATGGGCCAAGG - Intergenic
1165602699 19:37070605-37070627 GGCATTTCACAGAAGAGGAAGGG + Intronic
1165762643 19:38330727-38330749 TACATTTTACAGATGGGGGAAGG + Intergenic
1166130600 19:40743600-40743622 CCCAATTTCCAGATGGGGAAAGG + Intronic
1166164660 19:40978872-40978894 CTCATTTTACAGATGAGAAACGG + Intergenic
1166705267 19:44904922-44904944 CTCATTTCACATGTGGGGAGGGG + Intergenic
1166939511 19:46354215-46354237 CTCATTTCACGGATATGGAAAGG - Intronic
1167459545 19:49617329-49617351 CTCATTTTAAAGATGGGGGCTGG + Intronic
1168496993 19:56861598-56861620 CCTATTTTACAGATGAGGAAGGG + Intergenic
925141088 2:1550329-1550351 CGCATTTCACAGCTAAGGAATGG + Intergenic
925665565 2:6251755-6251777 CTCACATCACAGATGGGGACAGG + Intergenic
926266602 2:11328077-11328099 TTCATATCAGAGATGTGGAAGGG - Intronic
927266324 2:21156160-21156182 CCCATTTTAAAAATGGGGAAAGG + Intergenic
927853229 2:26512903-26512925 CCCATCTCACAAATGGGGAGGGG + Intronic
928170841 2:29002169-29002191 CCCATTTCACAGAAGTGTAATGG + Intronic
929040846 2:37743042-37743064 CCCATTTTACAGATGAGGATAGG - Intergenic
929583936 2:43101738-43101760 CCCATTTCACAGGCGGGAAATGG + Intergenic
929588013 2:43128088-43128110 CCCATTTGACAGATGAGGAAAGG + Intergenic
929863993 2:45702359-45702381 CCCATTTCACAGGTGCAGAAAGG - Intronic
929873819 2:45779527-45779549 CTCAGTTCACAAATGGAGCAAGG - Intronic
930698710 2:54438188-54438210 ATCATTTTACAGATGAGCAAAGG + Intergenic
930734260 2:54759114-54759136 CACATTTCACAAATGGAAAATGG - Intronic
930867076 2:56132647-56132669 CTCATGTTACAGATGAGAAACGG + Intergenic
931217182 2:60257047-60257069 CTGATTTTCCAGGTGGGGAAAGG + Intergenic
931745149 2:65285433-65285455 CCCATTTCACAGAAAAGGAACGG - Intergenic
931915092 2:66945573-66945595 CCCTTATCACAGATGAGGAATGG + Intergenic
932062923 2:68527038-68527060 CTCACTTCCCAGATGGTGAGGGG + Intronic
932085978 2:68761554-68761576 CTCAGTTCAAAAATGGGCAAAGG + Intronic
932192942 2:69756376-69756398 TTCATTTTACAGTTGAGGAAAGG - Intronic
932420983 2:71601212-71601234 CTCATTTTACAGCAGGGGAGTGG - Intronic
932597450 2:73102873-73102895 CTCATTTTACAGAGGTGAAATGG - Intronic
932731926 2:74227554-74227576 CCCATTTTACAGATGGGGACCGG - Exonic
933189879 2:79322739-79322761 GTCATTTGACAAATGGGGACTGG + Intronic
933772409 2:85752919-85752941 CTCGTTTTACAGGTGAGGAAAGG + Intronic
934715457 2:96540442-96540464 CTCATTTCACTGCTGGGAAGAGG - Intronic
935116094 2:100137740-100137762 CTCCTTTCACCTATGGAGAACGG - Intronic
935276762 2:101481750-101481772 CTCATTTCACAGGGAGGAAAAGG + Intergenic
935863421 2:107359191-107359213 CTCATTTTACAGAGGTGGATGGG + Intergenic
936072673 2:109381761-109381783 CTCGCTTCGCAGAAGGGGAAGGG + Intronic
936143865 2:109965856-109965878 CTCACTTGACAGAAGGGGCAAGG - Intergenic
936180547 2:110263818-110263840 CTCACTTGACAGAAGGGGCAAGG - Intergenic
936200822 2:110405613-110405635 CTCACTTGACAGAAGGGGCAAGG + Intronic
937103162 2:119287085-119287107 TGCATCTTACAGATGGGGAAGGG - Intergenic
937162764 2:119781194-119781216 CTGATTTCAGAGCTGGGGCAAGG - Intronic
937249945 2:120517279-120517301 CCCATTTCACAGATGGGGGAAGG + Intergenic
937286782 2:120758847-120758869 CTCGTTGCACAGAAGGGGAGGGG + Intronic
937345636 2:121123716-121123738 CCCATTTCACAGATGAGAGAGGG + Intergenic
937430448 2:121833487-121833509 TTCATTGCACAGATGAGGCACGG + Intergenic
937845153 2:126571541-126571563 CTCATTTTACAGATGAAGCACGG + Intergenic
937906718 2:127056074-127056096 CCCATTTAACAGGTGAGGAAAGG - Intronic
938254732 2:129847737-129847759 CTCATTTCAGAAATGGGAAATGG - Intergenic
938420226 2:131139827-131139849 ATCATTTTACAGATGGGCAAAGG + Intronic
939297158 2:140282105-140282127 CTCAGTTCAAAGATGGCCAAAGG - Intronic
939639080 2:144617601-144617623 CCCTTTTTACAGATGAGGAAAGG + Intergenic
940862926 2:158788769-158788791 CCCATTTTACAGGTGGGAAAAGG - Intergenic
941121091 2:161531142-161531164 CTAATTTCAGAGATGGTCAAAGG + Intronic
941382601 2:164814207-164814229 CCGATTTATCAGATGGGGAAGGG - Intronic
941622573 2:167794930-167794952 ATAATTTCAAAGATGGGAAAAGG - Intergenic
941902490 2:170691715-170691737 CTCATTAAACAGATGATGAATGG - Intergenic
942240669 2:173962243-173962265 ATCAGTTTACAGATGGGGGAGGG - Intronic
942596739 2:177598809-177598831 CTCTTTTCACAGATGGAAAAAGG + Intergenic
943087767 2:183333764-183333786 CTCAATTAAAAGATGGGCAAAGG - Intergenic
943171983 2:184413476-184413498 ATAATTTCACAGATGGAAAATGG + Intergenic
943284438 2:185979864-185979886 CTCATATCATAGCTAGGGAATGG + Intergenic
943417422 2:187625859-187625881 CTCATTTTTCAGATAGGAAATGG + Intergenic
943542344 2:189232258-189232280 CTAATTTCCCAGGTGGGTAAGGG + Intergenic
943562706 2:189482984-189483006 CTCACTTCACTGATGAGGAAAGG - Intergenic
943697696 2:190953932-190953954 CACATATCAAAGATTGGGAATGG - Intronic
943765827 2:191661111-191661133 CACATTCCACAGATGAGAAAAGG - Intergenic
944021329 2:195108027-195108049 CTCATTTTCTAGATGGGGCATGG - Intergenic
944283964 2:197926859-197926881 TTCATTTGACAGCTGGGGCAGGG + Intronic
944691591 2:202163558-202163580 CTCATTTCACAGAGTGGGAGAGG - Intronic
944870693 2:203908862-203908884 CCCATTTCACAGATGAAGACTGG - Intergenic
945219974 2:207473587-207473609 CCCATTTAACACATGGGGTAGGG + Intergenic
945976162 2:216272624-216272646 CATATTTAACAGATGAGGAAAGG - Intronic
946055389 2:216896462-216896484 CCCATTTTACAGATAAGGAAAGG + Intergenic
947000875 2:225454776-225454798 CTTTTTCCACAGATGGGGAGGGG - Intronic
947136411 2:226980486-226980508 CTCATGTCAGAGATGGGAAATGG - Intronic
948131664 2:235605328-235605350 CCCATTTTACCGATGAGGAAAGG + Intronic
1168840321 20:905901-905923 ACCATTTTACAGATGAGGAAAGG + Intronic
1168891259 20:1296530-1296552 CTCATTTTAAAGATGGGAATGGG - Intronic
1169248658 20:4044007-4044029 CGCATTTTAGAGATGAGGAAGGG - Intergenic
1169291683 20:4358644-4358666 CTCACTTCACAGCTGGGAAATGG + Intergenic
1169607279 20:7336643-7336665 CTCATTTCACAGGTAATGAAAGG + Intergenic
1170073992 20:12399099-12399121 CCCATTTGACAGATGAAGAAAGG - Intergenic
1170153501 20:13249273-13249295 CCCATTTCACAGATGGAACAGGG + Intronic
1170262059 20:14420542-14420564 CTCAATTCAAAAATGGGGAAAGG - Intronic
1170441693 20:16385868-16385890 CCCATTTCACACATGAGAAATGG + Intronic
1170516708 20:17137597-17137619 CTCATTTCAGAGATGAGGACAGG - Intergenic
1170561567 20:17563085-17563107 CTCATCCCACAGATGGGGTAAGG - Intronic
1170641281 20:18155561-18155583 CTCATTGCAAAAATGGGTAAAGG + Intronic
1171149432 20:22814227-22814249 CTCATTTTACAGGTGAGGACAGG + Intergenic
1171378346 20:24711477-24711499 CTCATTTTAAAAATGGGCAAAGG - Intergenic
1171988627 20:31678398-31678420 TTCATTTGACAGTTGGGGAAAGG - Intronic
1172006506 20:31822104-31822126 CCCTTTTGATAGATGGGGAAAGG + Intronic
1172330747 20:34074684-34074706 CCCATTTCACAAACTGGGAAGGG - Intronic
1172882133 20:38208960-38208982 TCCATTTCACAGATGGGGAAAGG + Intergenic
1174300711 20:49580211-49580233 CGCATTTTACAGATGAGGAATGG + Intergenic
1174511004 20:51052500-51052522 CCCTTTTTACAGATGAGGAAAGG + Intergenic
1174676795 20:52365673-52365695 CTCATTTCACAGCTATGGGACGG + Intergenic
1175369807 20:58480653-58480675 CACAGTTCACAGAATGGGAAAGG + Intronic
1175588978 20:60172056-60172078 CTCACTTCACACATGAGAAATGG - Intergenic
1175881214 20:62260352-62260374 GGCATTTCTTAGATGGGGAAAGG - Intronic
1175989135 20:62778859-62778881 CTCCATTTACAGATGGGGAGAGG + Intergenic
1176127982 20:63484425-63484447 CCCCTTTCACCGATGGAGAAGGG + Intergenic
1176697705 21:10000699-10000721 CTCATTTCAAAAATGGAGGAAGG - Intergenic
1177493601 21:21860906-21860928 TTGATTTCACAGAAGGGGACTGG - Intergenic
1177918097 21:27116042-27116064 CTCATTTTATAGAAGAGGAAAGG - Intergenic
1178585434 21:33867223-33867245 CTCATTTCAGAGATTGGCAATGG + Exonic
1179496900 21:41777961-41777983 CTCATTTCACTGACCGTGAACGG - Intergenic
1179909759 21:44441566-44441588 CCCATTTCACAGAGGAGTAAAGG + Intronic
1180721738 22:17914425-17914447 TCCATTTTGCAGATGGGGAAAGG + Intronic
1180974767 22:19842345-19842367 TGCATTTCAGAGATGGGGAAGGG - Intronic
1181014386 22:20060902-20060924 CTCATGTCACAGAAAGTGAAGGG - Intronic
1181468823 22:23125673-23125695 CCCATTTTACAGATGAGGAAAGG + Intronic
1181508239 22:23376148-23376170 TTCATTTCACAGCTGGAAAATGG - Intergenic
1181764316 22:25080238-25080260 CCCATTGTACAGCTGGGGAAGGG - Intronic
1181869256 22:25885236-25885258 CCCATCTCACAGATGAGGCAAGG + Intronic
1182241433 22:28919424-28919446 CTCATTGAATAGATGAGGAAAGG + Intronic
1182722625 22:32415583-32415605 CCCATTTTACAGATGAGGAAAGG - Intronic
1182834263 22:33328900-33328922 CACATTTCACAGATAAGGAAAGG - Intronic
1182882266 22:33743730-33743752 CCCATTTTACAGATGATGAAAGG + Intronic
1183208593 22:36435852-36435874 CTAATTTGACAGACGAGGAAAGG - Intergenic
1183305610 22:37081540-37081562 CTCGTTTCACAGACAAGGAAGGG + Intronic
1183340561 22:37278387-37278409 CTCATCTTACAGATGGGAAACGG - Intergenic
1183417216 22:37689286-37689308 CCCAGTTCACTGATGGAGAAAGG - Intronic
1183528556 22:38339042-38339064 TTCATGTTACAGATGAGGAAAGG + Intronic
1183602995 22:38850839-38850861 CCCATTTTACAGATGAGGAAAGG - Intergenic
1183941982 22:41301246-41301268 CTTTTGACACAGATGGGGAAGGG + Intergenic
1184301609 22:43564046-43564068 CCCATTTCTCAGATGGAGGACGG - Intronic
1184388308 22:44188637-44188659 CCCATTTCACAGATGAGGAAAGG + Intronic
1184404798 22:44293695-44293717 CCCATTTTACAGATGAGGAAGGG - Intronic
1184476075 22:44722142-44722164 CTGATTTCACAGTTGTGCAAGGG + Intronic
1184696112 22:46139967-46139989 CTCATTTTACAGCTGGGAATGGG + Intergenic
1184813649 22:46854261-46854283 CCCATTTTACAAATGAGGAAAGG - Intronic
1203293112 22_KI270736v1_random:14620-14642 CCCATTTTACAGATGAGGATAGG - Intergenic
950110689 3:10416971-10416993 CTCACTTCCCAGATGGTGAGTGG + Intronic
950120360 3:10478197-10478219 CCCAGTTCAAAGATGGGCAAAGG - Intronic
950165404 3:10793523-10793545 CCCATTTTACAGATGGGAAATGG + Intergenic
950289056 3:11768938-11768960 GACATTTGACAGATGGTGAAAGG + Intergenic
950677713 3:14564674-14564696 CTCATCTGAAAAATGGGGAAAGG + Intergenic
950708931 3:14801658-14801680 CTCATCTTACAGATGAGGAGAGG + Intergenic
950812879 3:15666408-15666430 ACCATTTAACAGATGAGGAAAGG - Intergenic
951064129 3:18244237-18244259 CACATATCACAGAGGGGTAAGGG - Intronic
951263575 3:20540647-20540669 CTCATTTGAAAGATGCTGAATGG - Intergenic
951309048 3:21101318-21101340 ATCATTTAAAAGATGGGCAAAGG - Intergenic
951901083 3:27658271-27658293 CTCCTTTTCCAGATGAGGAAAGG + Intergenic
952101045 3:30013346-30013368 CCCATTTCCCAGATGGGGCTTGG + Intergenic
952206643 3:31186982-31187004 CTTGTTTCACAAATAGGGAAAGG - Intergenic
952466896 3:33598420-33598442 GCCATTTCACAGATGTAGAAGGG - Intronic
952627606 3:35425837-35425859 CTCATTTTAATGATGGGGAAGGG - Intergenic
952675511 3:36025739-36025761 GTCATTTCACAGAAGGAGAAAGG - Intergenic
953415188 3:42711727-42711749 CTCATTTTACGGATGGGCCAGGG + Intronic
953426858 3:42802699-42802721 CTTATTTTACAGGTGGGGAAAGG + Intronic
953602625 3:44382903-44382925 CCCATTTCAAAAATGGGCAAAGG + Intronic
953695388 3:45154287-45154309 CTCATTTTAAAGAGGGGGTAGGG + Intergenic
953886124 3:46715294-46715316 GTCATTCCGCAGATGGGAAATGG - Intronic
954109692 3:48427114-48427136 TTGATTTCACATATGGGGAGTGG - Intronic
954376881 3:50199409-50199431 CTCAATTCAAAAATGGGCAAAGG - Intergenic
955047031 3:55370108-55370130 TGCATTTCACAGATGGGGAGAGG - Intergenic
955079396 3:55644181-55644203 CTCATTTTACAGATGGTAAAAGG - Intronic
955121191 3:56060352-56060374 CCCATTTTACAGATGGGAAAAGG - Intronic
955655055 3:61236603-61236625 CTCACTTTACAGATGTGGAAAGG + Intronic
955758346 3:62250221-62250243 CCCATTTTACAGATGAGGAAAGG + Intronic
955811091 3:62790650-62790672 TTCATTTTATAGATGGGTAAAGG - Intronic
956702710 3:71972798-71972820 CTCATTTGACAGTTGACGAAAGG + Intergenic
957048593 3:75395167-75395189 GTCCTTTCACAGCTGGGGAGTGG - Intergenic
957078164 3:75617842-75617864 CTCAGTCTACAGATGCGGAAGGG + Intergenic
957665539 3:83219865-83219887 CTCATTTTAAAAATGGGGACCGG - Intergenic
958139773 3:89547438-89547460 TTCATTTTCCAGATGAGGAATGG - Intergenic
958816457 3:98921688-98921710 CTTATTTCACAGATGAGGAATGG + Intergenic
959054783 3:101556658-101556680 CTCAGTTTACAGAAGGGGAGTGG - Intergenic
959384801 3:105690485-105690507 CTCTTCTACCAGATGGGGAAAGG + Intronic
961383876 3:126513552-126513574 CCCACTTTACAGATGGGGAAAGG - Intronic
961616268 3:128183829-128183851 CTCCTTACACAGATAAGGAATGG - Intronic
962104748 3:132379177-132379199 CTCATATCACAGACGTGGAAGGG - Intergenic
962282931 3:134065894-134065916 CCCACTTCACAGATGAGGAAAGG + Intronic
962828607 3:139120670-139120692 GTCATTTCCGAGATGGGGGAAGG + Intronic
962897512 3:139729643-139729665 ATCATCTTACAGATGGGGAGTGG + Intergenic
963144889 3:141983333-141983355 CTCAATTCAAAAATGGGCAAAGG + Intronic
963666677 3:148197050-148197072 CCCATTTTACGAATGGGGAAAGG - Intergenic
964303989 3:155321117-155321139 CCCATTTTACAGATAAGGAAGGG + Intergenic
965221003 3:165925348-165925370 CTGATTTTGAAGATGGGGAAAGG + Intergenic
965522880 3:169685935-169685957 CTCATTTTACTGATTAGGAAAGG + Intergenic
965816816 3:172644561-172644583 CTCATCGCATAGATGGGGTAGGG - Intronic
966812317 3:183858003-183858025 CTCATTTCTCAGATGGGGCAAGG - Intronic
967024441 3:185552065-185552087 CTCATTTCACAGAACTAGAAAGG + Intronic
967493253 3:190117217-190117239 CTTGGTTCACAGATGAGGAAAGG - Intronic
968816839 4:2825957-2825979 GTCCTTTCACAGGTGGGGACAGG + Intronic
969056945 4:4408067-4408089 CTCCTATCACAGATGGGAACTGG + Intronic
969170494 4:5358783-5358805 CTCACTTTCAAGATGGGGAAAGG - Intronic
969464281 4:7345619-7345641 TGCATCTCACAGATGGGAAACGG - Intronic
970238020 4:13978393-13978415 CTAATTTCACATATTTGGAATGG + Intergenic
970504373 4:16712224-16712246 CTCAATTTACAAATGGGCAAAGG + Intronic
970511577 4:16786948-16786970 ATCATCTCACAGATGGGATAGGG - Intronic
971200715 4:24507336-24507358 CTCACTTCACTGCTGAGGAAGGG + Intergenic
971307816 4:25498834-25498856 CCTATTTTACAGATGAGGAATGG - Intergenic
971669273 4:29534937-29534959 TTTATTTTACAGATGAGGAAAGG + Intergenic
972280007 4:37592721-37592743 CTCACTTTACAGATGGGTAAAGG - Intronic
972707962 4:41564186-41564208 CCCATTTTACAGATGAGGAAAGG + Intronic
973222750 4:47747471-47747493 CTCAGTTCAGAAATGAGGAAAGG - Intronic
973530600 4:51833714-51833736 CCCCTTTCACAGGTGAGGAAAGG - Intergenic
973650934 4:52996542-52996564 TTTATTTCTCAGAAGGGGAAGGG - Intronic
973819265 4:54648444-54648466 CCCATTTTACAGATAAGGAAAGG - Intergenic
974366688 4:60959165-60959187 CTCATTTTACTCATGGGAAATGG - Intergenic
975283263 4:72587698-72587720 ATTATTTTACAGATGAGGAAAGG + Intergenic
976243439 4:82983769-82983791 TTCAGTTCACAGATGGCCAAAGG - Intronic
976712657 4:88088818-88088840 CTCATTTTACAGATGCATAAAGG + Intergenic
977889793 4:102296581-102296603 CTCATTTAACAGATGAGCAAAGG + Intronic
977922730 4:102663281-102663303 CTAATTTTATAGATGGGAAAAGG + Intronic
979300735 4:119084069-119084091 CTCATTTTACAGAAAGGAAATGG + Intergenic
982479286 4:155889602-155889624 CTCACTTCACAGATGGGAAACGG - Intronic
982759061 4:159259165-159259187 GTAATTTCATAGATTGGGAATGG - Intronic
982771339 4:159400188-159400210 CCCATTTGACAGATGGGAAATGG + Intergenic
983051024 4:163047967-163047989 GTCATTACACAGTGGGGGAATGG - Intergenic
983570424 4:169202011-169202033 TTCATTTTGCAGATGGGTAAAGG - Intronic
984783689 4:183549189-183549211 CTCATTTTAAAGATAGGCAAAGG - Intergenic
985819869 5:2152331-2152353 CTCATTGCACAGATGGAAGATGG + Intergenic
985819872 5:2152366-2152388 CTCATTGCACAGATGGAAGATGG + Intergenic
985819875 5:2152401-2152423 CTCATTGCACAGATGGAAGATGG + Intergenic
985915684 5:2917398-2917420 CCCACTTCACAGATGGAGACTGG - Intergenic
986245473 5:6002948-6002970 CTCAGTTCTCAAATGGTGAACGG - Intergenic
986731843 5:10640323-10640345 CCCATTTCACAGATGGGAACAGG - Intronic
989422567 5:41256820-41256842 CACATTTTACAAATGGGTAAAGG + Intronic
990180952 5:53160054-53160076 CTCAATTCAAAAATGGGCAAAGG + Intergenic
990519892 5:56569044-56569066 TTCATTTATCAGATGGGCAAAGG + Intronic
990539126 5:56754803-56754825 CCTATTTTACAGATGAGGAAAGG + Intergenic
991318115 5:65335224-65335246 CTCATTTTACATTTGAGGAAAGG + Intronic
992187757 5:74260257-74260279 CTCATTTTAGAAATGTGGAAAGG + Intergenic
992212921 5:74497825-74497847 CTAAGTTCACAGATGGGGAGGGG - Intergenic
992377490 5:76202615-76202637 CTCATTTTACATATTGGGGAAGG - Intronic
992739016 5:79754435-79754457 CCCATTTGACAGGTGAGGAAAGG + Intronic
993490936 5:88548132-88548154 CACTTTTCACAGATGATGAAGGG + Intergenic
995640064 5:114245747-114245769 TTCCTTTCACAGTTGAGGAAAGG + Intergenic
995924338 5:117352450-117352472 CACATTTTACAGGTGGGTAAGGG + Intergenic
995966550 5:117914517-117914539 CTCACTTCACCGAAGGTGAAGGG - Intergenic
997360924 5:133294366-133294388 CCCATTTTACAGAAGAGGAACGG - Intronic
997579952 5:135010914-135010936 CTCATGTGACAGATGGGAAAGGG - Intronic
997668426 5:135650741-135650763 CTCAATCCAAAGATGGGGACTGG - Intergenic
997776814 5:136616547-136616569 GTTATTTCACTGAAGGGGAATGG + Intergenic
998202650 5:140137499-140137521 CTCATCTCAGAGATGGGGGCAGG + Intergenic
998940315 5:147274765-147274787 CTCATTTTATAGATGCAGAAAGG + Intronic
999051528 5:148529030-148529052 TCCATTTCACAGATGAGGAAAGG + Intronic
999182472 5:149679855-149679877 CCCATTTTACTGATGAGGAAAGG + Intergenic
999198660 5:149800668-149800690 GTCATGTGACAGATGGGGCAGGG + Intronic
999301010 5:150490357-150490379 CCCATTTCACAGATGAGAAATGG - Intronic
1000703791 5:164486426-164486448 CCCATTTAACAGATGAGCAATGG + Intergenic
1001070428 5:168580270-168580292 CTCATTTTGAAGATGGGGCACGG + Intergenic
1001308023 5:170589977-170589999 CCCATTTTGCAGAGGGGGAAAGG - Intronic
1001547204 5:172577882-172577904 CTCACTTTACAGATGGGAAACGG + Intergenic
1001741256 5:174054707-174054729 CCCATTTCACAGACAGTGAATGG + Intronic
1001841047 5:174877111-174877133 CCCATCCTACAGATGGGGAAAGG + Intergenic
1002102923 5:176866241-176866263 CTCACATCAAAGATGGGGTAGGG + Intronic
1002347835 5:178560375-178560397 CCCATTTCAAAGATGGAGAAAGG - Intronic
1003060574 6:2859326-2859348 TTCCTTTCACAAATGAGGAATGG - Intergenic
1003126085 6:3356854-3356876 CCCATTTCCAAGATGGGAAATGG + Intronic
1004201995 6:13557038-13557060 CACATTTTACAGATGAGAAATGG + Intergenic
1004314665 6:14575402-14575424 CACATTTCACAGATGAAGAAAGG + Intergenic
1004676337 6:17846317-17846339 CTCTTTTTAAAGATGAGGAAAGG - Intronic
1005243518 6:23856214-23856236 CTCACTTCCCAGATGGTGCAGGG - Intergenic
1005459815 6:26057126-26057148 CTCTTTTCATAGATGGGGGTGGG + Intergenic
1006725871 6:36198323-36198345 CTCATTTTACTGATGGAGTATGG + Intronic
1007095493 6:39210303-39210325 CTAATTTTACACATGGGGAGAGG - Intronic
1007097972 6:39226034-39226056 CTCATTTTGCAGATGAGGAAAGG + Intronic
1007652789 6:43433568-43433590 CTCACTTTACAGATGAGGAAGGG - Intronic
1008646948 6:53524203-53524225 CCCATTTCACAGGTGGGCAAAGG + Intronic
1008679650 6:53858433-53858455 CTCATAACACAGAGGGGGAGAGG - Intronic
1009366538 6:62861430-62861452 CTTACTTCCCAAATGGGGAAGGG + Intergenic
1009398417 6:63228715-63228737 CTCACTGCCCAGATGGGGCAGGG + Intergenic
1010052572 6:71524956-71524978 CTCATGTTAGAGATGGCGAAAGG + Intergenic
1010106388 6:72174117-72174139 CTCAAATCACAGATGGAGGAGGG - Intronic
1010325649 6:74559150-74559172 CTCCTTAGACAGATGTGGAAAGG + Intergenic
1010771813 6:79840530-79840552 CAAGTTTCACACATGGGGAAAGG + Intergenic
1011008013 6:82669782-82669804 CTATTTTCAAAGAAGGGGAATGG + Intergenic
1012544276 6:100399115-100399137 CTCAATTCAAAAATGGGCAAAGG - Intronic
1013859883 6:114623100-114623122 CTAATTTTACAGATGAGGATGGG + Intergenic
1014037580 6:116785237-116785259 TTCATTTTACAGGTGGGAAAAGG + Intergenic
1014155327 6:118102984-118103006 CTAATTTTACAGATGGGTAAAGG - Intronic
1014286363 6:119503442-119503464 CTCAATTCCCACATGGGGAAAGG - Intergenic
1014293359 6:119587543-119587565 CTCATTTTATAGTTGAGGAATGG + Intergenic
1014512571 6:122342212-122342234 CTGGCTTCACAGATGGAGAATGG + Intergenic
1014993123 6:128106078-128106100 CTCATTTCATAGATTTGGGAAGG - Intronic
1015188925 6:130451561-130451583 CTCATGACAGAGATAGGGAAGGG - Intergenic
1015376720 6:132518086-132518108 CTAATTTCACTGAAGGGGATGGG - Intergenic
1015482704 6:133730777-133730799 CACATTTCAGAGATGGGAAGAGG + Intergenic
1016402584 6:143696528-143696550 CCCATTCTACAGATGAGGAAGGG + Intronic
1017837845 6:158195793-158195815 CAAACTTAACAGATGGGGAAGGG + Exonic
1018177355 6:161188874-161188896 CTCATTTCACCAATGGCAAATGG + Intronic
1018723895 6:166596027-166596049 CTTATCTCACAGAAAGGGAAAGG + Intronic
1020741435 7:12024092-12024114 ATCATTTTATAGATGGTGAAAGG - Intergenic
1021493505 7:21246609-21246631 CTCACTTCCCAGATGGGGTGGGG + Intergenic
1021695740 7:23274366-23274388 GTCATTTTAGAGATGGGGAGAGG + Exonic
1021709049 7:23396943-23396965 CCATTTTCACAGATGGGAAAGGG + Intronic
1022097989 7:27152732-27152754 CTCCTCTCAGTGATGGGGAAAGG - Intergenic
1022463222 7:30631913-30631935 CTTATTTCAGAGCTGGGAAATGG + Intronic
1022939269 7:35216431-35216453 CTTATTTTACAGATGAGAAAAGG - Intronic
1022979982 7:35595316-35595338 CTCATTTTCCGGATGAGGAAAGG - Intergenic
1023082553 7:36538994-36539016 CTCTTTTCCCAGGTGGGGAGAGG + Intronic
1023153065 7:37220805-37220827 CTTCTTTCACAGATGGGGAAAGG + Intronic
1023157372 7:37264701-37264723 CTCATGTCCCAGATAGGAAAGGG + Intronic
1023448134 7:40253151-40253173 CCCATTTCACAGATGAAAAAAGG - Intronic
1024176624 7:46846939-46846961 CCCATTTCAAAGATGGGATAGGG - Intergenic
1024548960 7:50544490-50544512 TTCATTTCTCAGATGAGGAGAGG - Intronic
1024581572 7:50805101-50805123 CCCATCTCACAGATGAGGAAAGG - Intergenic
1024598299 7:50958385-50958407 CCCATTTTACAGATGAGGAGAGG - Intergenic
1024599109 7:50963983-50964005 CCCACTTCACAGATGAGCAAAGG - Intergenic
1024676614 7:51643527-51643549 CTCAATTTACTGATGGGGAGGGG - Intergenic
1026374006 7:69731898-69731920 CCCATTTTACAGATGAGGAAAGG - Intronic
1026523464 7:71135332-71135354 CTCATTTCTCAACTGGGGATGGG - Intronic
1028066785 7:86394133-86394155 CTCATTTCATTGCTGTGGAATGG - Intergenic
1028178831 7:87691895-87691917 CTCATTTTACAGATGAGAAAAGG - Intronic
1028745531 7:94322026-94322048 CTCAATTCTGAGATAGGGAATGG - Intergenic
1029029698 7:97454587-97454609 CTCATATCACAGAAGGGGCAAGG - Intergenic
1030206300 7:106955368-106955390 CTCATATGACAGAAGGGGCAAGG - Intergenic
1030631614 7:111901792-111901814 CTCATTTCACCTATAAGGAAAGG + Exonic
1030864534 7:114683461-114683483 CCCATTTTACAGATGAGTAAAGG - Intronic
1030891445 7:115003903-115003925 CTCATTTTACAGATGAAAAACGG - Intronic
1031062714 7:117070308-117070330 CTCCTTTTACAGATGAGAAATGG - Intronic
1031123303 7:117745250-117745272 CTACTTTCAAAGGTGGGGAAAGG - Intronic
1032650182 7:133869404-133869426 CTCATTTTACAGATGAAGACAGG - Intronic
1032896030 7:136251742-136251764 CCCTTTTCTCAGGTGGGGAATGG + Intergenic
1033441012 7:141378860-141378882 CCCATTTCCCAGAGTGGGAAGGG - Intronic
1034221647 7:149451067-149451089 CTCATGTCACAGATGGAGCGCGG - Exonic
1034676729 7:152897544-152897566 CACATTTCTCAGATCGCGAAGGG - Intergenic
1036284717 8:7434140-7434162 TGCATTTCCCAAATGGGGAAAGG + Intergenic
1036286578 8:7448494-7448516 GTCACTTTACAGATGGGGACAGG + Intronic
1036334899 8:7863030-7863052 GTCACTTTACAGATGGGGACAGG - Intronic
1036336757 8:7877390-7877412 TGCATTTCCCAAATGGGGAAAGG - Intergenic
1036475310 8:9087785-9087807 CTACTTTCACAGAGAGGGAAAGG + Intronic
1036539254 8:9687982-9688004 CCCATGTCACAGAGGGGCAAAGG + Intronic
1036578596 8:10052378-10052400 TTTTTTCCACAGATGGGGAAGGG - Intergenic
1037089255 8:14893229-14893251 CTCATTTTAAAGATGGAGGAAGG + Intronic
1037582093 8:20251685-20251707 CTCGTTTGACAGATGTGGATTGG + Intronic
1037878588 8:22561616-22561638 CTCATCTTATAGATGAGGAAAGG - Intronic
1038506598 8:28090246-28090268 CTCCTTGCACAGATGAGGATAGG - Intronic
1038657251 8:29465000-29465022 CTCAGTTCAAAAATGGGCAAAGG - Intergenic
1038944110 8:32337841-32337863 CTCATTTCTGAGATGATGAATGG - Intronic
1039320940 8:36430348-36430370 TTCATTTCACAGATCAAGAATGG + Intergenic
1039567625 8:38562812-38562834 CTCATATAACAGAAAGGGAAGGG - Intergenic
1039890719 8:41683673-41683695 CTGATTTTACAGAAGGGGAGAGG + Intronic
1040652239 8:49462269-49462291 CTCATTTTACAGATGAAAAATGG + Intergenic
1041462571 8:58128183-58128205 CCCATTTAACACATGGGAAAAGG + Intronic
1043375815 8:79648217-79648239 CTCATTTTACAGATTGACAAAGG - Intronic
1044074593 8:87803902-87803924 CTCATTTCAAATATGGGTAGAGG + Intergenic
1044206503 8:89497067-89497089 ATTTTTTTACAGATGGGGAAAGG - Intergenic
1044246982 8:89959830-89959852 CTCATTTTATAGATGAGGAAAGG - Intronic
1044817142 8:96124987-96125009 ATCATTGCACAATTGGGGAAGGG + Intergenic
1044865423 8:96566029-96566051 AACATTTTACAGATGGGAAAAGG - Intronic
1044897891 8:96911978-96912000 ATCACTTTACAGATGGGGAAAGG - Intronic
1045252433 8:100493096-100493118 TCCATTTTACAGATGAGGAAAGG + Intergenic
1045375732 8:101571998-101572020 CTCATTTCACAGCTAAGGAGAGG - Intronic
1045654401 8:104371958-104371980 TTCATATCACAGATGAGGAAAGG - Intronic
1045665877 8:104483772-104483794 CCCATTTTACAGATGAAGAATGG + Intergenic
1046673992 8:117088757-117088779 ATGATTTCACAGATGGTGATGGG + Intronic
1046783169 8:118237514-118237536 CTCTTCTTACAGCTGGGGAAAGG - Intronic
1046785183 8:118258176-118258198 TTAAATTCACAGATTGGGAATGG - Intronic
1047015282 8:120717665-120717687 CTCCTGGCACAGATGGGAAATGG + Intronic
1047024965 8:120814287-120814309 CCCATTTCACAGGTGAAGAAGGG + Intergenic
1047188820 8:122659744-122659766 TTCATTTCACAGAGGAGCAAGGG + Intergenic
1047677256 8:127216281-127216303 TTCCTTTCATAGATGGGGGAAGG - Intergenic
1047750288 8:127875464-127875486 CTTATTTCATAGATGAGGAACGG - Intergenic
1048370922 8:133775488-133775510 CTCATTTTATAGATGAGGAAAGG - Intergenic
1049001311 8:139827104-139827126 CCCATTTCTAAAATGGGGAAGGG + Intronic
1049398345 8:142412339-142412361 CTCATTTTCCAGATGGGAAAAGG - Intergenic
1050301102 9:4259715-4259737 CTCTATTCACAGATGGGGTGGGG + Intronic
1051222968 9:14869593-14869615 CTCATTTAACAAATGAGGAAAGG - Intronic
1051869461 9:21720141-21720163 CTCATTTCACAAATGAGGCAAGG - Intergenic
1052338108 9:27339617-27339639 CTTATTTTACAGAGGGGTAATGG + Intronic
1052413686 9:28150189-28150211 CTCATTTCCCAGACGGTGCAGGG - Intronic
1052413697 9:28150229-28150251 CTCACTTCCCAGATGGTGAGGGG - Intronic
1052959898 9:34286473-34286495 CACATTTTACAGATGGGAAGTGG + Intronic
1053199170 9:36141198-36141220 CTCATTTTATGTATGGGGAAAGG + Intronic
1053418920 9:37964567-37964589 CTCATTATGCAGATGGGAAATGG + Intronic
1053518544 9:38753448-38753470 TCCATTGGACAGATGGGGAAAGG + Intergenic
1053715369 9:40883599-40883621 ATCCTTTCACAGCTGGGGAGTGG - Intergenic
1054077181 9:60547135-60547157 GTCCTTTCACAGCTGGGGAGTGG + Intergenic
1054799381 9:69332004-69332026 CAGAATTCACAGACGGGGAAAGG - Intronic
1054877422 9:70111452-70111474 CTCATTTTACAGATGAGCAATGG - Intronic
1054928332 9:70610812-70610834 CTTACTTTACAGATGAGGAAAGG + Intronic
1055687993 9:78798501-78798523 CCCATTTCACAGTTGAGGAAAGG + Intergenic
1055765531 9:79659105-79659127 CTTATTTCATACATGAGGAAAGG + Intronic
1056019927 9:82430913-82430935 CTCACTTCCCAGATGGTGAGGGG + Intergenic
1056513104 9:87324375-87324397 CCCATTTCACAGATTGGAAATGG - Intergenic
1056576262 9:87857941-87857963 CTCACTTCCCAGATGGTGCAGGG + Intergenic
1057071918 9:92106120-92106142 CTCACTTCCCAGATGGTGAGGGG - Intronic
1057195535 9:93114100-93114122 CCCATTTCACAGGTGGGCAAAGG - Intergenic
1057252775 9:93517118-93517140 CCCATTTCACAGATGGACAGAGG - Intronic
1057719691 9:97522015-97522037 ATCATTTCACAGATGAGCCACGG + Intronic
1058455290 9:105132753-105132775 TTCATTTCCCAGAGGGAGAATGG - Intergenic
1060033407 9:120234783-120234805 CTGATTTTGTAGATGGGGAATGG - Intergenic
1060491620 9:124089315-124089337 CCCATTTCACAGACGTGGGAAGG - Intergenic
1060517120 9:124272780-124272802 TTCATTTTACAGATGAGGAAAGG + Intronic
1060578741 9:124723791-124723813 CTCATTTCATAGATGAGAAAAGG + Intronic
1060731157 9:126037877-126037899 ATCATTTTACAGATGGAGTACGG - Intergenic
1060757426 9:126223584-126223606 CTGCTTTCACAGATGAGGGACGG - Intergenic
1060885626 9:127150110-127150132 TTCATTTTACAGAAGAGGAAAGG - Intronic
1061204775 9:129156580-129156602 CTCATTTCACAGAAGGGTCTGGG + Intergenic
1061322579 9:129840326-129840348 CTCATCTCACAGAGGAGGAATGG - Intronic
1061363257 9:130157024-130157046 CTCATCTTACAGATGGGAGAAGG - Intergenic
1061367923 9:130182165-130182187 CCCATTTTACAGATGAGGAAAGG + Intronic
1061403634 9:130382058-130382080 CTCATTTCACAGATGAGGCAGGG + Intronic
1061608471 9:131729710-131729732 CCCATTTGACAGTTGAGGAAAGG - Intronic
1061648267 9:132024315-132024337 CTCCTTTTACAGATGAAGAATGG + Intronic
1061806720 9:133141046-133141068 CCCATTTGACAGATGGGGCAAGG + Intronic
1061990324 9:134155190-134155212 CTCCTTACCCTGATGGGGAAGGG + Intronic
1062019827 9:134313931-134313953 CCCATTATACAGATGAGGAAAGG + Intergenic
1062318569 9:135979664-135979686 CCCATGCCACAGATGGGGACCGG - Intergenic
1062597562 9:137306091-137306113 GTCATTTCACAGATGGGGAGGGG - Intergenic
1062680699 9:137778395-137778417 CGCATTGCACAGATGGGGTGTGG - Intronic
1185666737 X:1771425-1771447 GTAATTTCATAGATGAGGAAAGG - Intergenic
1185668011 X:1783069-1783091 CTCATTTTACAGATGAGAAATGG - Intergenic
1185787983 X:2906797-2906819 CTTATTTCACAAATCAGGAAAGG + Exonic
1186105951 X:6206058-6206080 CTCATTTTACAGTTGAGGGAAGG + Intronic
1186134054 X:6500235-6500257 ATCATTTTACAGAAGGTGAAAGG + Intergenic
1186672931 X:11785255-11785277 CACATTTCACAGGTTAGGAAAGG - Intergenic
1187253614 X:17621859-17621881 CTCATTTTACGGATGAGGAAAGG - Intronic
1187396459 X:18923552-18923574 CTCATTCCACAGAAGGTGAGGGG + Intronic
1189030993 X:37450293-37450315 CTCACTTTGCAGATGAGGAAAGG - Intronic
1189300050 X:39945925-39945947 CCCATTTTACAAATGAGGAAAGG - Intergenic
1189431144 X:40948787-40948809 ATCATTTCACTGAAGGGGATAGG + Intergenic
1190106940 X:47567580-47567602 CTCATTTCCCAGAGGGGAAAGGG - Intronic
1190301708 X:49060839-49060861 CACAATACACAGATGGGGAAGGG + Intronic
1190301871 X:49061801-49061823 CCCATTTTAGAGATGAGGAAAGG - Intronic
1190691760 X:52918540-52918562 CTCTTGTCCAAGATGGGGAAGGG + Intergenic
1190694223 X:52937252-52937274 CTCTTGTCCAAGATGGGGAAGGG - Intronic
1192046316 X:67677787-67677809 CTCATTTTACAGATAGGAAAGGG - Intronic
1192072376 X:67954613-67954635 CTCATATGACAGATAGGGAAGGG + Intergenic
1192236906 X:69301875-69301897 CTCATTTCACAAATGGTTCAAGG - Intergenic
1192239514 X:69318288-69318310 CTCTTTTGACAGATGGGAAAAGG + Intergenic
1192547297 X:72024548-72024570 TTCATTTCACAGATGAGGACGGG + Intergenic
1192786792 X:74344080-74344102 GTCATTACTCAGAAGGGGAAAGG - Intergenic
1193223889 X:78959074-78959096 GTTGTTTCTCAGATGGGGAAGGG - Intronic
1195963838 X:110412532-110412554 CCCATTTTACAGATGAGAAACGG - Intronic
1196016767 X:110947859-110947881 CTCATTTTAAAGAGGGGGGAAGG - Intronic
1196797433 X:119513600-119513622 ATCATTGCACAGTTGGGCAAGGG + Intergenic
1196925309 X:120628453-120628475 CTCATTTTACAGAGAGGAAATGG + Intronic
1196975129 X:121150947-121150969 CCCATTTTACAGATGAGGATGGG - Intergenic
1197149362 X:123203386-123203408 CTTATTTTACAAATGGGAAAAGG - Intronic
1197370829 X:125623840-125623862 CTAATTTCAAAAATGGGCAAAGG - Intergenic
1198055180 X:132987142-132987164 CACATTTTACAGATGGGGAAAGG - Intergenic
1198249454 X:134866139-134866161 CTGATTTCACAGTTAAGGAACGG - Intergenic
1198434273 X:136600080-136600102 TCCATTGTACAGATGGGGAATGG + Intergenic
1198948064 X:142037828-142037850 CACATTTAACAGATGGGGAGAGG - Intergenic
1199074313 X:143511755-143511777 TTGATATCACAGATGGGGCAAGG - Intronic
1199538017 X:148925695-148925717 CCCATTACACAGATGAGGGAAGG - Intronic
1200586326 Y:5008999-5009021 CTCATTTTACAGATAAGAAAAGG + Intronic
1201287009 Y:12387767-12387789 CTTATTTCACAAATCAGGAAAGG - Intergenic