ID: 916802943

View in Genome Browser
Species Human (GRCh38)
Location 1:168231611-168231633
Sequence AAGGAAAAGACAGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3156
Summary {0: 1, 1: 2, 2: 36, 3: 368, 4: 2749}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916802943 Original CRISPR AAGGAAAAGACAGAGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr