ID: 916806741

View in Genome Browser
Species Human (GRCh38)
Location 1:168267377-168267399
Sequence TAAGGCTATGGGTCAGCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916806741_916806750 30 Left 916806741 1:168267377-168267399 CCTCAGGCTGACCCATAGCCTTA No data
Right 916806750 1:168267430-168267452 TCTTGTAATTCTGCTGCTAAGGG No data
916806741_916806749 29 Left 916806741 1:168267377-168267399 CCTCAGGCTGACCCATAGCCTTA No data
Right 916806749 1:168267429-168267451 TTCTTGTAATTCTGCTGCTAAGG No data
916806741_916806746 -3 Left 916806741 1:168267377-168267399 CCTCAGGCTGACCCATAGCCTTA No data
Right 916806746 1:168267397-168267419 TTATCTTACGTTGGAACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916806741 Original CRISPR TAAGGCTATGGGTCAGCCTG AGG (reversed) Intergenic
No off target data available for this crispr