ID: 916806746

View in Genome Browser
Species Human (GRCh38)
Location 1:168267397-168267419
Sequence TTATCTTACGTTGGAACTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916806741_916806746 -3 Left 916806741 1:168267377-168267399 CCTCAGGCTGACCCATAGCCTTA No data
Right 916806746 1:168267397-168267419 TTATCTTACGTTGGAACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916806746 Original CRISPR TTATCTTACGTTGGAACTAC AGG Intergenic
No off target data available for this crispr